Method and kit for monitoring microsporidia infection in silkworm egg production process

Abstract

The invention discloses a method for monitoring microsporidia infection in a silkworm egg production process, which specifically comprises the following steps: collecting silkworm excrement or silkworm eggs as a to-be-detected object, adding saturated salt water into the to-be-detected object, grinding, filtering, standing filtrate, taking supernatant, observing, and if ellipsoidal spores which can swing up and down exist in the supernatant, judging that microsporidia infection is caused. If yes, the microsporidia pathogens exist in the excrement or the silkworm eggs. The invention further provides a kit which is suitable for DNA detection and verification of various common insect microsporidia in the mulberry field, including silkworm microsporidia. According to the invention, it is found for the first time that spores of nosema bombycis float in saturated salt water and swing obviously, the spores of nosema bombycis in silkworm excrement or silkworm eggs are enriched by using the saturated salt water, and whether the spores swing or not is observed under an optical microscope, so that whether the silkworm excrement or silkworm eggs contain microspore pathogens or not can be judged. And then the infection and the infection degree of the microsporidia can be determined through specific amplification of nucleic acid of the microsporidia.

Description

Technical Field

[0001] The present invention belongs to the field of monitoring of Nosema bombycis disease of silkworms. More specifically, the present invention relates to a method and a kit for rapidly and efficiently detecting microsporidian pathogens during the production of silkworm eggs. Background Art

[0002] Nosema bombycis disease of silkworms is a common and extremely harmful infectious disease in the production of silkworm eggs. It has strong infectivity, a slow onset process, can be transmitted through embryos, and often causes a high mortality rate of young silkworms. Excreta of diseased silkworms can spread to healthy silkworms through the silkworm bed and can cross-infect with wild insects, easily causing the occurrence and spread of Nosema bombycis disease. This disease can lead to the virus-carrying of silkworm eggs, a decline in the quality and yield of silkworm cocoons. Currently, there is no effective treatment method, resulting in huge economic losses to the sericulture production every year due to the prevalence of this disease. Nosema bombycis mainly parasitizes the economic insect Bombyx mori, and is the main pathogen of Nosema bombycis disease of silkworms. The infection of Nosema bombycis to silkworms is systemic, can invade various tissues and organs of the silkworm body, is intracellular parasitism, and causes various lesions. There are no obvious symptoms in the early stage of silkworm infection, but microsporidian spores have begun to be discharged through excreta and exfoliated substances. Excreta include silkworm feces and urine, and exfoliated substances include eggshells and molting shells, all of which are direct sources of infection. As the disease progresses, it gradually shows poor group development, uneven sizes, and the corpses are not easily decomposed, etc. There are different symptoms in its larval, pupal and adult stages. Silkworms with mild infection can also mate and lay eggs, often becoming the source of transovarial transmission. Microsporidian spores are discharged into the silkworm bed by excreta and exfoliated substances, causing serious infection within the silkworm bed and resulting in group morbidity. Therefore, it is necessary to monitor different batches of silkworm larvae in real time during the production of silkworm eggs. By detecting in advance before seed production to find the epidemic situation of microsporidian infection, economic losses can be reduced and the spread of pathogens can be prevented.

[0003] For the prevention and control of Nosema bombycis disease of silkworms, it still mainly relies on a series of comprehensive prevention and control measures such as silkworm egg inspection, environmental sanitation, and disinfection and disease prevention. The key is to produce virus-free silkworm eggs and comprehensively control the occurrence and spread of Nosema bombycis disease of silkworms. Currently, the inspection of Nosema bombycis disease of silkworms is entrusted for inspection. Silkworm egg production units send female moths of silkworm eggs to the silkworm egg quality inspection and quarantine station for inspection. However, the silkworm egg quality inspection and quarantine station can only be responsible for the inspection results of the submitted samples, and cannot control the representativeness of the samples. Moreover, the sampling inspection of female moths cannot intuitively and comprehensively reflect the virus-carrying situation of silkworm eggs. In addition, since Nosema bombycis disease of silkworms can also be caused by cross-infection of microsporidia of wild insects, but the pathogenicity of microsporidia of other insects to silkworms and whether they can all be transmitted through embryos are not clear. There are situations where female moths carry the virus but the produced silkworm eggs are virus-free in production. Therefore, the sampling detection of silkworm eggs can more intuitively and comprehensively reflect the virus-carrying situation.

[0004] At present, in addition to the traditional microscopic examination method, there are also molecular biology diagnostic methods and serological detection methods for diagnosing Nosema bombycis. Serological diagnostic methods include agglutination method, enzyme-labeled antibody method, carbon agglutination method, monoclonal antibody direct method, monoclonal antibody immunogold staining method, etc., while molecular biology diagnostic methods include PCR method, fluorescence quantitative PCR method, loop-mediated isothermal amplification method, recombinase polymerase amplification method, etc. However, the mother moth microscopic examination method invented by Pasteur is still used in production. On the one hand, when applying serological methods, antiserum against various spore surface antigens needs to be prepared first, which has a long cycle and is relatively complex; on the other hand, although the PCR or fluorescence quantitative PCR detection method has good sensitivity and specificity in clinical applications, the instruments used for detection are relatively expensive and the operation is not simple enough. The mother moth microscopic examination method is simple and easy to operate, but the mother moths need to be dried and preserved before being sent for inspection, and the microsporidia spores in the mother moths are also inactivated and deformed. The result judgment depends too much on the experience of the inspectors, and misjudgment and missed judgment are likely to occur. Moreover, the representativeness of the mother moth sampling has defects, and the diseased silkworm eggs cannot be accurately and timely eliminated. Therefore, a more rapid, accurate and comprehensive detection method for Nosema bombycis is needed clinically. Summary of the Invention

[0005] One object of the present invention is to solve at least the above problems and provide at least the advantages described hereinafter.

[0006] One object of the present invention is to provide a method for monitoring microsporidia infection in the process of silkworm egg production, which can rapidly, accurately and comprehensively detect Nosema bombycis at the production site.

[0007] To achieve these objects and other advantages of the present invention, a method for monitoring microsporidia infection in the process of silkworm egg production is provided. The specific method is to collect the excrement of the same batch of silkworms or sample the silkworm eggs positive for microsporidia in the monitored excrement, add saturated brine to the excrement or silkworm eggs, grind, filter, let the filtrate stand and then centrifuge at a low speed, take the supernatant for observation. If there are spores that can swing in the supernatant, it indicates that there are microsporidia pathogens in the object to be tested.

[0008] Preferably, the volume ratio of the excrement of silkworms to saturated brine is 1:2, and the volume ratio of silkworm eggs to saturated brine is 1:10.

[0009] Preferably, the standing time is 1 h.

[0010] Preferably, the centrifugation speed is 500 r / min and the time is 60 s.

[0011] Preferably, it further includes microsporidia DNA detection verification, spore staining verification, optical or electron microscope observation verification to further confirm whether microsporidia pathogens are enriched in the supernatant.

[0012] Preferably, the DNA in the extraction supernatant is subjected to fluorescence RAA detection of the microsporidia SSU rDNA gene to further confirm whether it contains microsporidia pathogens and the level of pathogen content.

[0013] Preferably, the nucleotide sequence of the upstream primer for fluorescence RAA detection is SEQ ID NO.1: ggcttaacaagactatgacggataacggtatt;

[0014] The nucleotide sequence of the downstream primer is SEQ ID NO.2: gcatcaatcatcatacacactatcggaacaag;

[0015] The nucleotide sequence of the probe is SEQ ID NO.3:

[0016] taatattccggagaaggagcctgagagattgctac(dT-FAM)a(THF)g(dT-BHQ1)ctaaggattgcagca(C3 Spacer).

[0017] Preferably, the temperature for fluorescence RAA detection is 40 °C and the reaction time is 30 min.

[0018] Preferably, a potassium carbonate solution is added to the supernatant enriched with microsporidia spores, incubated at 28 °C to promote spore germination, the germinated spores are air-dried naturally on a glass slide, fixed with Carnoy fixative, stained with Giemsa staining solution, the Giemsa staining solution is slowly removed with deionized water, and observed under an optical microscope to further verify whether the saturated saline supernatant contains microsporidia pathogens.

[0019] A kit for DNA detection and verification of insect microsporidia including Nosema bombycis, the kit includes: reaction dry powder, A Buffer reaction buffer, deionized water, B Buffer reaction solution, positive plasmid template, and upstream primer, downstream primer and probe.

[0020] The present invention has at least the following beneficial effects:

[0021] First, the present invention for the first time discovers that the spores of Nosema bombycis can float in saturated saline and show obvious swinging. The microsporidia pathogens in silkworm excrement or silkworm eggs are enriched by saturated saline, so that the microsporidia spores in silkworm excrement or silkworm eggs are fully exposed and concentrated, different from fungal spores, pollen grains and silkworm body fat droplets which are morphologically similar but cannot swing. By observing whether there are obviously swinging spores under an optical microscope, it can be judged whether the object to be detected contains microsporidia pathogens, and after enrichment, the number of spores increases, which can improve the detection rate and reduce missed and false detections.

[0022] Second, the present invention utilizes saturated brine to enrich microsporidia spores in silkworm excrement or silkworm eggs, and these spores are active and motile. In the current method of examining female moths under a microscope, the female moths need to be dried and preserved, and the microsporidia spores in the female moths become inactivated and deformed. The former can effectively remove impurities in the sample to be examined, making the morphological outline of the spores clearer during microscopic examination, and maintaining the activity and motility of the spores, which helps to reduce the difficulty of detection and judgment and is conducive to the popularization and application of the detection method.

[0023] Third, the present invention conducts overall monitoring by collecting silkworm excrement without sampling, enabling the simultaneous monitoring of an entire batch of primary silkworms, comprehensively understanding the infection situation of pebrine in different batches, and achieving effective prediction and detection of pebrine. By starting to monitor the occurrence of pebrine during the feeding process of the larval stage, prevention and control measures can be formulated in advance to reduce the spread of pathogens and economic losses.

[0024] Fourth, the present invention samples silkworm eggs based on the monitoring results of microsporidia in silkworm excrement to further monitor the virus-carrying situation of silkworm eggs, enabling an understanding of the degree of vertical transmission of microsporidia. This is more intuitive and labor-saving than sampling and examining female moths under a microscope, providing a direct and reliable basis for the disposal of silkworm eggs, and avoiding problems such as low representativeness of sampling female moths, difficulty in corresponding and tracing back positive female moths with microsporidia detected under the microscope to the silkworm eggs they produce, and untimely treatment of silkworm eggs.

[0025] Fifth, the present invention also provides a kit for fluorescent recombinase-aided amplification (RAA) detection of Nosema bombycis pathogens, which can quickly re-detect and verify the results of detection under an optical microscope, or directly conduct RAA detection on silkworm excrement. The primers and probes can also detect cross-infection of microsporidia in wild insects, and the pathogen content in the sample can be judged based on the amplification curve. The operation is simple, the reaction is sensitive, and no complex instrument and equipment are required.

[0026] Sixth, the present invention uses the germinated microsporidia spores for detection, enabling the spores to release the internal nucleic acid. Compared with the inactivated and non-germinating spores in the dried female moth samples, it is easier to extract the nucleic acid of microsporidia, which can further improve the detection efficiency and is beneficial for the production monitoring of silkworm eggs without microsporidia virus.

[0027] Other advantages, objectives, and features of the present invention will be partially reflected by the following description and partially understood by those skilled in the art through the research and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Observation diagrams of Nosema bombycis spores under a high-power optical microscope; among them, A are Nosema bombycis spores enriched and extracted from silkworm excrement; B are Nosema bombycis spores enriched and extracted from silkworm eggs.

[0029] Figure 2It is the gel electrophoresis map of the conventional PCR product of the SSU rDNA gene of Nosema bombycis; among them, the amplified samples are germinated active spores and inactivated ungerminated spores respectively, and the molecular weight of Maker is 2000bp;

[0030] Figure 3 It is the fluorescence change curve graph of fluorescence RAA reaction using primers with different concentrations in the fluorescence RAA primer concentration optimization experiment; among them, curves 1 and 2 are the reactions with primers at 10 μmol / L, curves 3 and 4 are the reactions with primers at 5 μmol / L, curves 5 and 6 are the reactions with primers at 1 μmol / L, and 7 is the negative control with nuclease-free water;

[0031] Figure 4 It is the fluorescence change curve graph of fluorescence RAA reaction using probes with different concentrations in the fluorescence RAA probe concentration optimization experiment; among them, curves 1 and 2 are the reactions with probes at 10 μmol / L, curves 3 and 4 are the reactions with probes at 5 μmol / L, curves 5 and 6 are the reactions with probes at 1 μmol / L, and 7 is the negative control with nuclease-free water;

[0032] Figure 5 It is the fluorescence change curve graph of the fluorescence RAA amplification temperature optimization experiment; among them, from figure a to figure d are 39°C, 40°C, 41°C and 42°C in sequence;

[0033] Figure 6 It is the result graph of the sensitivity detection experiment of fluorescence RAA of Nosema bombycis; among them, curves 1-7 are 10-fold serial dilutions, that is, the positive plasmid with copy numbers of 4.98×10 7 ~4.98×10 1 copies / μL, and 8 is the negative control with nuclease-free water;

[0034] Figure 7 It is the result graph of the sensitivity detection experiment of conventional PCR; among them, M is Maker, and lanes 1-9 are 10-fold serial dilutions, that is, the positive plasmid with copy numbers of 4.98×10 9 ~4.98×10 1 copies / μL, and 10 is the negative control with nuclease-free water;

[0035] Figure 8 It is the result graph of the specificity detection experiment of fluorescence RAA of Nosema bombycis; among them, curve 1 is the positive plasmid pMD18-SSU standard of the SSU rDNA gene of Nosema bombycis, 2 is Beauveria bassiana of silkworm, and 3-6 are Bombyx mori nuclear polyhedrosis virus, Serratia marcescens, healthy silkworm cells and the negative control with nuclease-free water respectively;

[0036] Figure 9It is a test result diagram of the fluorescent RAA of Nosema bombycis for other insect microsporidia; wherein, curve 1 is the positive plasmid pMD18-SSU standard of the SSU rDNA gene of Nosema bombycis, curves 2 and 3 are Nosema armigera, curves 4 and 5 are Nosema litura, curves 6 and 7 are Nosema trichoplusia, and curve 8 is the negative control of enzyme-free water;

[0037] Figure 10 This is the Giemsa staining of the spores of Nosema bombyx mori after germination;

[0038] Figure 11 This is the Giemsa staining of ungerminated spores of Nosema bombyx mori;

[0039] Figure 12 This is a scanning electron microscope observation of the enrichment and extraction of Bombyx mori Nosema; A is the active spores that have not been dried, and B is the inactivated spores that have been dried;

[0040] Figure 13 This is a low-power optical microscope observation of Nosema bombyx mori spores in silkworm excrement enriched with distilled water;

[0041] Figure 14 This is a low-power optical microscope observation of Nosema bombyx mori spores in silkworm excrement enriched with saturated brine;

[0042] Figure 15 This is a low-power optical microscope observation of Nosema bombycis spores in silkworm eggs enriched with saturated brine;

[0043] Figure 16 This is a low-power optical microscope observation of Nosema bombyx mori spores in silkworm eggs enriched with distilled water;

[0044] Figure 17 The figure is the result of RAA test on spore germination and non-germination of Nosema bombycis in silkworm excrement enriched with saturated saline; wherein curve 1 is the positive plasmid, 2 is the spore germination treatment, 3 is the spore non-germination treatment, and 4 is the negative control of enzyme-free water;

[0045] Figure 18 The results of RAA detection of microsporidia extracted by saturated saline and distilled water enrichment; curve 1 is the positive control, 2 is the saturated saline enrichment, 3 is the distilled water enrichment, and 4 is the negative control; DETAILED DESCRIPTION

[0046] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0047] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0048] It should be noted that the experimental methods described in the following implementation examples are all conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0049] <Test content>

[0050] I. Material preparation

[0051] Analytical pure sodium chloride, potassium carbonate, Carnoy fixative, Giemsa staining solution, etc. Nosema bombycis, Nosema heliothidis, Nosema prodeniae, Nosema plodiae, Bombyx mori nuclear polyhedrosis virus, Bacillus septicus, Beauveria bassiana.

[0052] II. Collection of materials to be tested and preparation of reagents

[0053] Silkworm excrement at different instars or silkworm eggs from positive batches detected by Nosema bombycis in silkworm excrement can be used as materials to be tested for the detection of Nosema spores and nucleic acid identification.

[0054] Saturated brine: Take a certain amount of distilled water, gradually add sodium chloride and continuously stir until sodium chloride no longer dissolves, and pour the supernatant of the saturated brine into a clean container for standby.

[0055] 0.1 mol / L potassium carbonate: Weigh 13.82 g of potassium carbonate and dissolve it in 1 L of ultrapure water to obtain it.

[0056] Carnoy fixative: Prepare it according to 60% ethanol, 30% glacial acetic acid, and 10% chloroform.

[0057] Giemsa staining solution: Mix 9 parts of 1xPBS with 1 part of Giemsa stock solution. The Giemsa staining solution is prepared and used immediately.

[0058] III. Detection test

[0059] (1) Add 1 part of silkworm excrement to 2 parts of saturated brine, place it in a mortar and grind it or break it with a homogenizer; first add a small amount of saturated brine to 1 part of silkworm eggs to grind the eggshells, then break the tissue cells by ultrasonic waves, and then add them to 10 parts of saturated brine for homogenization. Filter the homogenate of the material to be tested with 4 layers of gauze, let the filtrate stand for 1 h so that the larger particulate impurities in the filtrate are evenly dispersed and precipitated in the extract, and the spores wrapped are fully released and floated, then centrifuge at 500 r / min for 60 s, aspirate the supernatant on the liquid surface, place it on a glass slide, and observe with an optical microscope to see if there are spores of Nosema that will swing up and down in the field of view. If present, take the supernatant for the following verification test. The spores of Nosema bombycis under the optical microscope are as Figure 1 shown.

[0060] IV. Verification test

[0061] (1) Extract the DNA in the supernatant according to the operation manual of the DNA extraction kit to obtain a DNA template. By promoting spore germination first and then extracting DNA, the amount of pathogen DNA template can be increased; use primers targeting the SSU rDNA gene of Nosema bombycis to verify whether the Nosema bombycis gene exists in the DNA template.

[0062] The specific method is as follows. The conventional PCR reaction system is a total of 50 μL: 25 μL of DNA polymerase (TaKaRa), 2 μL of upstream primer (SEQ ID NO: 4), 2 μL of downstream primer (SEQ ID NO: 5), 8 μL of DNA template, and deionized water is added to make up to 50 μL. The sequence of SEQ ID NO.4 is: caccaggttgattctgcc, and the sequence of SEQ ID NO.5 is: ttatgatcctgctaatggttc. The PCR reaction procedure is: pre-denaturation at 94 °C for 5 min; 94 °C for 30 s, 54 °C for 1 min, 72 °C for 1 min, for a total of 35 cycles; final extension at 72 °C for 10 min. The partial sequencing result of the amplified SSU rDNA gene of Nosema bombycis is shown in SEQ ID NO.6.

[0063] Add 0.5 mL of 0.1 mol / L potassium carbonate and 0.5 mL of the supernatant into a 2 mL EP tube, incubate in a water bath at 28 °C for 2 h to promote spore germination, and then extract DNA. Use the same amount of supernatant after drying for spore germination promotion and DNA extraction as a control to detect the PCR amplification effect of spores treated in different ways. The comparison results of the gel electrophoresis of the PCR products of the two are as Figure 2 shown. Under the same spore germination promotion conditions, the amplified band of the DNA template extracted after the germination of active spores is brighter, indicating that the content of the pathogen DNA extracted is higher. This is because germination can make the nucleic acids inside the spores easier to release. Inactivated spores cannot germinate, and the strong spore wall is difficult to break through by conventional chemical or physical methods, thus reducing the DNA extraction efficiency. The spores carried by excreted silkworm feces or silkworm eggs are active, and the spore germination promotion method can be used to increase the amount of DNA template in the test sample, which is beneficial for further nucleic acid identification.

[0064] The sequence of SEQ ID NO.6 is as follows:

[0065]

[0066] The sequencing result of the SSU rDNA gene sequence SEQ ID NO.6 was compared and analyzed by NCBI Genebank, and its homology with the known SSU rDNA sequence of Nosema bombycis was >99%, indicating that the oscillating spores observed in the supernatant were the spores of Nosema bombycis.

[0067] (2) Verification by fluorescence RAA detection

[0068] 1. According to the SSU rDNA gene sequence of the reference strain of Nosema bombycis published by NCBI, the online design was carried out using the primer design assistant software Primer Explorer V4 to design a pair of specific primers and a fluorescent probe. The primer and probe information is shown in Table 1 below.

[0069] Table 1

[0070]

[0071]

[0072] 2. DNA extraction and construction of positive plasmid

[0073] According to the operation instructions of the DNA extraction kit, the DNA of Nosema bombycis was extracted from the saturated saline supernatant, and the DNA concentration was measured by a spectrophotometer. The complete open reading frame of the SSU rDNA gene of Nosema bombycis was amplified by conventional PCR, and the target gene was ligated to the cloning vector pMD18-T to construct the positive plasmid pMD18-SSU, and the accuracy of the target gene was verified by sequencing.

[0074] 3. Establishment and optimization of the fluorescence RAA system

[0075] The total volume of the fluorescence RAA reaction system was 50 μL, including reaction dry powder, A Buffer reaction buffer, deionized water, B Buffer reaction solution, DNA sample, upstream primer, downstream primer and probe. The addition amounts of each component are shown in Table 2.

[0076] Table 2

[0077]

[0078] Using the positive plasmid pMD18-SSU standard as a template, the primer and probe concentrations and the amplification temperature were optimized respectively. When the probe concentration and the amplification temperature were the same, the primer concentrations were set at 10 μmol / L, 5 μmol / L and 1 μmol / L respectively, and the RAA reaction results were as Figure 3It shows that when the primer concentration is 10 μmol / L, the peak starts quickly and the fluorescence signal is the strongest; when the primer concentration and amplification temperature are the same, the probe concentrations are set at 10 μmol / L, 5 μmol / L, and 1 μmol / L respectively, and the results are as Figure 4 It shows that when the probe concentration is 10 μmol / L, the peak starts quickly and the fluorescence signal is the strongest; when the primer and probe concentrations are the same, the amplification temperatures are set at 39 °C, 40 °C, 41 °C, and 42 °C respectively, and the results are as Figure 5 It shows that when the amplification temperature is 40 °C, the peak starts quickly and the fluorescence signal is the strongest. Therefore, it is determined that 10 μmol / L is the optimal concentration of the primer, 10 μmol / L is the optimal concentration of the fluorescent probe, and the optimal amplification temperature is 40 °C.

[0079] 4. Sensitivity test of the fluorescence RAA detection method

[0080] The positive plasmid pMD18-SSU standard was diluted by 10-fold gradients, that is, 4.98×10 9 ~4.98×10 1 copies / μL were used as templates respectively, nuclease-free water was used as a negative control, and the fluorescence RAA method was used for detection. At the same time, conventional PCR detection was used as a control to compare the detection results of the two. The results are as Figure 6 shown. The lowest detection limit of the fluorescence RAA method is 4.98×10 1 copies / μL, while the conventional PCR method as Figure 7 shown, the lowest detection limit is 4.98×10 2 copies / μL. The lowest detection limit of the fluorescence RAA method is 10 times that of the conventional PCR method, indicating that the sensitivity of the fluorescence RAA method for detection is higher than that of the conventional PCR.

[0081] 5. Specificity test of the fluorescence RAA detection method

[0082] Using the nucleic acids extracted from common silkworm disease pathogens in production, including Beauveria bassiana, Bombyx mori nucleopolyhedrovirus, Serratia marcescens, and healthy silkworm tissues as templates, the fluorescence RAA method established in the present invention was used for detection. The positive plasmid pMD18-SSU standard was used as a positive control, and nuclease-free water was used as a negative control to detect the specific amplification of Nosema bombycis DNA by the fluorescence RAA method. The results are as Figure 8 shown. The fluorescence RAA method showed negative results for the detection of Beauveria bassiana, Bombyx mori nucleopolyhedrovirus, and Serratia marcescens, and the amplification reaction of the DNA of healthy silkworm tissues was also negative. Only the DNA of the Nosema bombycis pathogen produced an amplification reaction, and the fluorescence curve quickly reached the positive judgment standard, indicating that the fluorescence RAA detection method has specificity for the amplification of the target DNA.

[0083] In addition, using the nucleic acids extracted from Nosema bombycis, Nosema spodoptera litura, and Nosema plodia, which are common insect microsporidia causing cross-infection in mulberry fields, as templates, the fluorescence RAA method established in the present invention was used for detection. The positive plasmid pMD18-SSU standard was used as the positive control, and nuclease-free water was used as the negative control to detect the specific amplification of the fluorescence RAA method for microsporidia of the same genus but different species. The results are as Figure 9 shown. The fluorescence RAA method showed positive results for the detection of Nosema spodoptera litura, Nosema plodia, and Nosema bombycis, and the fluorescence curve quickly reached the positive judgment standard, indicating that the fluorescence RAA detection method for Nosema bombycis also has a detection effect on other similar microsporidia of insects belonging to the same Lepidoptera order as Bombyx mori.

[0084] (III) Giemsa staining test

[0085] Add 0.5 ml of 0.1 mol / L potassium carbonate and 0.5 ml of the supernatant enriched from silkworm excrement in a 2 ml EP tube, and incubate in a water bath at 28 °C for 2 h to promote germination. After germination, the spores were air-dried naturally on a glass slide, fixed with Carnoy's fixative for 10 min, stained with Giemsa staining solution for 20 min, and the Giemsa staining solution was slowly removed with deionized water, and then observed under an optical microscope. The results are as Figure 10 shown. After the spores germinated and then were stained with Giemsa, due to the ejection and entanglement of the internal polar filaments, the shape and structure of the spore wall changed, making the spores more concentrated but lighter in color.

[0086] The supernatant enriched from silkworm excrement was not promoted to germinate in a water bath, air-dried naturally on a glass slide, fixed with Carnoy's fixative for 10 min, stained with Giemsa staining solution for 20 min, and the Giemsa staining solution was slowly removed with deionized water, and then observed under an optical microscope. The results are as Figure 11 shown. When the spores were directly stained without germination, the shape and structure of the spores were clear and complete. After staining, the spores were relatively dispersed but darker in color, and the edge of the spore wall was clear.

[0087] (III) Electron scanning observation test

[0088] Take the supernatant enriched from silkworm excrement for scanning electron microscopy observation. As Figure 12 shown, a large number of oval microsporidia spores were contained in the supernatant, and schizonts in the process of division and already divided were visible, with infectious activity; when the spores lost water after being dried, the spore wall collapsed and the infectious activity was lost.

[0089] <Effect test>

[0090] Experiment 1: Collect silkworm excrement for one day at the 3rd instar and 5th instar stages for batch monitoring. Use a sieve to remove residual debris. If lime is used to disinfect silkworm beds, rinse with clean water to remove the ash. Add 2 parts of distilled water to 1 part of silkworm excrement, grind or homogenize, filter with 4 layers of gauze, let the filtrate stand for 1 hour, then centrifuge at 500r / min for 60s, take the supernatant, and observe under an optical microscope. Figure 13 As shown in Figure 2, only a few microsporidian spores were observed in each field of view of the microscope when the excrement of 3rd instar silkworms was enriched with distilled water, and the extracted excrement contained more impurities. Figure 13 This indicates that distilled water cannot enrich microsporidia, and the spores of microsporidia in the supernatant are scarce, making it difficult to observe the presence of microsporidia pathogens under a microscope.

[0091] Add 2 volumes of saturated salt water to 1 part of silkworm feces, grind or homogenize, filter with 4 layers of gauze, let the filtrate stand for 1 hour, then centrifuge at 500r / min for 60s, take the supernatant, and observe under an optical microscope. The enrichment effect is shown in Figure 14. The supernatant of the silkworm feces of 3-instar silkworms is enriched with saturated salt water. The number of microsporidian spores in each field of view is abundant, and the spores swing up and down significantly. The silkworm feces have fewer impurities and the observation field is clearer. Giemsa staining of the spores further confirmed that the saturated salt water enriched supernatant extracted is the spores of microsporidia. The supernatant was washed with distilled water, centrifuged at 5000r / min for 5 minutes, repeated 3 times, replaced with distilled water to resuspend the spores, and the suspension was placed under an optical microscope for observation again. It was found that the swing of the spores in distilled water was weaker than that in saturated salt water. The observation results of the silkworm feces of 5-instar silkworms are similar to those of Figure 14 This indicates that the buoyancy of spores in distilled water is relatively small, while the buoyancy of spores in saturated salt water is relatively large, which is not only conducive to the swing of spores, but also makes the spores float in the upper liquid surface to achieve the purpose of enrichment.

[0092] Test 2: For the batch of female moths that tested positive for microsporidia in silkworm excrement, 10 flat-attached eggs were randomly selected for monitoring. The eggs from each flat-attached egg paper were scraped off the silkworm seed paper, and 1 part of the eggs was added to 10 parts of saturated salt water and ground and homogenized. The filtrate was filtered through 4 layers of gauze, and the filtrate was allowed to stand for 1 hour, then centrifuged at 500r / min for 60s, and the supernatant was taken and observed under an optical microscope. Figure 15 As shown in the figure, the spores swing up and down significantly, the silkworm eggs have fewer impurities, and the observation field is clearer. Giemsa staining of the spores further confirmed that the saturated salt water enrichment supernatant extracted was microsporidian spores. When using distilled water for enrichment comparison, the extracted supernatant had fewer spores and more impurities, such as Figure 16As shown. Similar results were obtained for the above monitoring of randomly selected other positive batches of silkworm eggs, and details are not repeated here. For the production of original silkworm seeds, if any of the randomly sampled silkworm eggs are detected as positive for microsporidia, the entire batch will be rejected; for the production of first-generation hybrid silkworm seeds, if more than 5 out of 10 randomly sampled silkworm eggs are detected as positive for microsporidia, the entire batch will be rejected.

[0093] Experiment 3: Take two equal volumes of the supernatant of saturated brine enriched with microsporidia spores. Add an equal volume of 0.1 mol / L potassium carbonate solution to one portion and incubate in a water bath at 28 °C for 2 h to promote germination. Add an equal volume of distilled water to the other portion as an ungerminated control. After extracting the DNA of the two treated samples, perform fluorescence RAA detection of Nosema bombycis. The results show that the amplification curve of the germinated treatment has a faster peak and a higher amplification curve compared to the ungerminated one, indicating that the DNA content extracted by the germinated treatment is higher and the amplification efficiency is better, as Figure 17 shown.

[0094] Experiment 4: Take 1 flat-attached silkworm egg batch suspected of being infected with microsporidia. Scrape the silkworm eggs off the silkworm egg paper. Grind 1 part of the silkworm eggs with 10 parts by volume of saturated brine and homogenize. Grind 1 part of the silkworm eggs with 10 parts by volume of distilled water as a control and homogenize. Filter through 4 layers of gauze respectively. Let the filtrate stand for 1 h, then centrifuge at 500 r / min for 60 s and take the supernatant. Extract the DNA of microsporidia extracted from saturated brine and distilled water respectively for RAA detection. The results are as Figure 18 shown. The amplification curve of the sample extracted with saturated brine has a faster peak and a higher amplification curve than that of the sample extracted with distilled water, indicating that more spores are enriched in the saturated brine, the target DNA content is higher, and the amplification efficiency is better.

[0095] Although the embodiments of the present invention have been disclosed as above, it is not limited to the applications listed in the specification and embodiments. It can be fully applied to various fields suitable for the present invention. For those familiar with the field, additional modifications can be easily made. Therefore, without departing from the general concept defined by the claims and the equivalent scope, the present invention is not limited to specific details and the examples shown and described herein.

Claims

1. A method for monitoring microsporidia infection during silkworm seed production, characterized in that: Collect silkworm excrement or silkworm eggs from the same batch of silkworms as the objects to be tested, add saturated salt water to the objects to be tested, grind, filter, let the filtrate stand and then centrifuge, take the supernatant for observation, if there are swaying oval spores in the supernatant, it means that microsporidia pathogens are present in the silkworm excrement or silkworm eggs.

2. The method for monitoring microsporidia infection during silkworm seed production according to claim 1, characterized in that: The volume ratio of silkworm feces to saturated salt water is 1:2, and the volume ratio of silkworm eggs to saturated salt water is 1:

10.

3. The method for monitoring microsporidia infection during silkworm seed production according to claim 1, characterized in that: The standing time is 1h.

4. The method for monitoring microsporidia infection during silkworm seed production according to claim 1, characterized in that: The centrifugal speed was 500 r / min and the time was 60 s.

5. The method for monitoring microsporidia infection during silkworm seed production according to claim 1, characterized in that: The method also includes the use of microsporidia DNA detection verification, spore staining verification, and optical or electron microscope observation verification to further confirm whether the supernatant of the saturated salt water is enriched with microsporidia pathogens.

6. The method for monitoring microsporidia infection during silkworm egg production according to claim 5, characterized in that: The detection and verification of microsporidia DNA is specifically as follows: DNA is extracted from the supernatant, and the SSU rDNA gene, which is relatively conservative in the genetic evolution of microsporidia, is detected by fluorescent RAA to further confirm whether microsporidia pathogens are present and the level of pathogen content.

7. The method for monitoring microsporidia infection during silkworm seed production according to claim 6, characterized in that: The nucleotide sequence of the upstream primer for fluorescent RAA detection is SEQ ID NO.1: ggcttaacaagactatgacggataacggtatt; The nucleotide sequence of the downstream primer is SEQ ID NO.2: gcatcaatcatcatacacactatcggaacaag; The nucleotide sequence of the probe is SEQ ID NO.3: taatattccggagaaggagcctgagagattgctac(dT-FAM)a(THF)g(dT-BHQ1)ctaaggattgcagca(C3 Spacer).

8. The method for monitoring microsporidia infection during silkworm seed production according to claim 6, characterized in that: The temperature for fluorescent RAA detection was 40°C and the reaction time was 30 min.

9. The method for monitoring microsporidia infection during silkworm egg production according to claim 5, characterized in that: Potassium carbonate solution was added to the supernatant enriched with saturated brine, and the mixture was incubated at 28°C to promote spore germination to obtain germination fluid, which was then stained with Giemsa stain and tested for DNA to further verify whether the supernatant contained microsporidian pathogens.

10. A kit, characterized in that The kit is used for DNA detection and verification of insect microsporidia including Bombyx mori microsporidia, and comprises: reaction dry powder, ABuffer reaction buffer, deionized water, B Buffer reaction solution, positive plasmid template, upstream primer, downstream primer and probe.

Images