Microsatellite marker related to early body color of apostichopus japonicus and application of microsatellite marker

Abstract

The invention discloses a microsatellite marker related to the early body color of apostichopus japonicus and application of the microsatellite marker, and belongs to the technical field of molecular markers. Two microsatellite sequences are obtained based on apostichopus japonicus genome screening and are numbered as AJ732 and AJ812 respectively, and the sequences of the two microsatellite sequences are shown as SEQ ID NO.1 and SEQ ID NO.2 in sequence. The microsatellite marker primers are respectively designed for the two microsatellite sequences, and the microsatellite marker primers are high in specificity and stable in amplification, can be used for judging the body color characters of the apostichopus japonicus larvae, can improve the breeding efficiency and accuracy of apostichopus japonicus population, and provides a powerful tool for early-stage directional breeding and industrial popularization of the apostichopus japonicus.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, in particular to a microsatellite marker related to the early body color of an imitation sea cucumber and an application thereof. Background Art

[0002] Imitation sea cucumber ( Apostichopus japonicus Sea cucumbers, also known as sea cucumbers, are the most valuable single species cultivated in my country's marine agriculture industry. They primarily come in cyan, white, and purple colors, with white sea cucumbers being extremely rare. In actual cultivation, both white sea cucumber seedlings and finished products are 20 times more expensive than those of green sea cucumbers. Furthermore, hybrids produced with green sea cucumbers exhibit rapid growth, strong stress resistance, and high nutritional quality, demonstrating significant hybrid vigor and possessing significant market potential and economic value.

[0003] Body color is a key trait in the cultivation of superior varieties, influencing taste and market price, and has become a crucial element in the selection of varieties and strains. However, it is currently difficult to obtain genetically stable populations of white sea cucumbers on a large scale, and the molecular mechanisms underlying their coloration remain unclear. Furthermore, juvenile sea cucumbers are uniformly white, significantly limiting their targeted breeding and industrialization.

[0004] Existing molecular marker technologies primarily focus on detecting genetic diversity, heat tolerance, and sex identification in sea cucumbers. Few molecular markers address body color. Microsatellite sequences, also known as simple sequence repeats (SSRs), are widely used in genetic hybridization and chromosome mapping due to their abundance, high polymorphism, and indifference to seasonal, developmental stage, and environmental factors. Developing a stable microsatellite marker associated with body color is crucial for early targeted breeding and industrial expansion of white sea cucumbers. Summary of the Invention

[0005] The present invention aims to provide a microsatellite marker associated with the early body color of sea cucumbers and its application. The microsatellite marker provided by the present invention is stable in amplification and has good polymorphism, and can be used for screening research on different body colors of early sea cucumbers. By detecting the alleles of the molecular marker, it provides a molecular marker for sea cucumber genetic breeding.

[0006] To achieve the above object, the present invention provides the following solutions: One of the technical solutions of the present invention is a sea cucumber imitation ( Apostichopus japonicus ) A microsatellite molecular marker related to early body color, wherein the microsatellite molecular marker has at least one nucleotide sequence as shown in SEQ ID NO.1 to SEQ ID NO.2.

[0007] The second technical solution of the present invention is a sea cucumber imitation ( Apostichopus japonicus ) A primer combination for early body color-related microsatellite molecular markers, the primer combination comprising: (1) a primer pair as shown in SEQ ID NOs. 3 and 4; and (2) At least one of the primer pairs shown in SEQ ID NOs. 5 and 6.

[0008] The third technical solution of the present invention is a kit comprising the primer combination.

[0009] A fourth technical solution of the present invention is a genetic analysis method for sea cucumbers, comprising: synthesizing the primer composition; Using the primer combination to perform PCR amplification on the DNA sample of the sea cucumber to obtain an amplified product; The amplified products were subjected to genetic analysis.

[0010] A fifth technical solution of the present invention is an application of the primer composition, wherein the application includes at least one of the following: (1) Application in genetic diversity analysis of sea cucumbers; (2) Application in identification of sea cucumber germplasm resources; (3) Application in identification of kinship of sea cucumbers; (4) Application in genetic breeding of sea cucumber; (5) Application in the detection of body color of juvenile sea cucumbers.

[0011] Based on the above technical solution, the present invention has the following technical effects: The present invention is based on two microsatellite sequences obtained by screening the sea cucumber genome, numbered AJ732 and AJ812, respectively, and their sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively. Microsatellite marker primers were designed for each of the two microsatellite sequences. The microsatellite marker primers have strong specificity and stable amplification, and can be used to determine the body color traits of sea cucumber juveniles. This can improve the efficiency and accuracy of sea cucumber population breeding, providing a powerful tool for early targeted breeding and industrial promotion of white sea cucumbers. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the STR detection peak diagram of the specific allele D at the AJ732 locus, which is unique to the white sea cucumber population and exists in the hybrid sea cucumber population.

[0013] Figure 2The following are the STR peaks for the specific alleles F, G, H, and I, which are unique to the AJ732 locus and present in the hybrid sea cucumber population. A is the STR peak for the H allele, B is the STR peak for the I allele, C is the STR peak for the G allele, and D is the STR peak for the F allele.

[0014] Figure 3 This is the STR detection peak diagram of the specific alleles D and G possessed by hybrid sea cucumber individuals at the AJ732 locus.

[0015] Figure 4 The following are the STR peaks for alleles B, D, and F at the AJ812 locus, which are unique to the white sea cucumber population and present in the hybrid sea cucumber population. A is the STR peak for allele F, B is the STR peak for allele D, and C is the STR peak for allele B.

[0016] Figure 5 This is the STR detection peak diagram of the specific allele L at the AJ812 locus, which is unique to the green sea cucumber population and exists in the hybrid sea cucumber population.

[0017] Figure 6 This is the STR detection peak diagram of the specific alleles D and L simultaneously possessed by hybrid sea cucumber individuals at the AJ812 locus. DETAILED DESCRIPTION

[0018] The terms "include", "including", "have", "contain" etc. used in this document are open-ended terms, which mean including but not limited to.

[0019] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0020] The embodiment of the present invention provides a kind of imitation sea cucumber ( Apostichopus japonicus ) A microsatellite molecular marker related to early body color, wherein the microsatellite molecular marker has at least one nucleotide sequence as shown in SEQ ID NO.1 to SEQ ID NO.2.

[0021] The embodiment of the present invention also provides a kind of imitation sea cucumber ( Apostichopus japonicus ) A primer combination for early body color-related microsatellite molecular markers, the primer combination comprising: (1) a primer pair as shown in SEQ ID NOs. 3 and 4; and (2) At least one of the primer pairs shown in SEQ ID NOs. 5 and 6.

[0022] In some specific embodiments, the 5' ends of the upstream primers in the primer pair are both labeled with a fluorescent group HEX.

[0023] An embodiment of the present invention also provides a kit comprising the primer combination.

[0024] The embodiment of the present invention also provides a genetic analysis method for sea cucumber imitation, comprising: synthesizing the primer composition; Using the primer combination to perform PCR amplification on the DNA sample of the sea cucumber to obtain an amplified product; The amplified products were subjected to genetic analysis.

[0025] In some specific embodiments, the genetic analysis includes: allele number analysis, effective allele number analysis, Shannon diversity index analysis, gene flow analysis, genetic consistency analysis, genetic distance analysis, Nei's genetic distance analysis, heterozygosity analysis, expected heterozygosity analysis and polymorphism information content analysis.

[0026] In some specific embodiments, the genetic analysis includes: detecting the amplified product on an ABI 3730XL sequencer to obtain genotype information of each microsatellite molecular marker of the sea cucumber; Genemapper software was used to analyze the raw data files of microsatellite molecular markers, and PopGene was used to calculate the number of alleles, effective number of alleles, Shannon diversity index, gene flow, genetic identity, genetic distance, and Nei's genetic distance; Cervus was used to calculate the observed heterozygosity, expected heterozygosity, and polymorphism information content.

[0027] The present invention also provides an application of the primer composition, wherein the application includes at least one of the following: (1) Application in genetic diversity analysis of sea cucumbers; (2) Application in identification of sea cucumber germplasm resources; (3) Application in identification of kinship of sea cucumbers; (4) Application in genetic breeding of sea cucumber; (5) Application in the detection of body color of juvenile sea cucumbers.

[0028] In some specific embodiments, in the microsatellite marker locus shown in SEQ ID NO.1, the specific allele D is unique to the white sea cucumber population and exists in the hybrid sea cucumber population; the specific alleles G, H and I are unique to the green sea cucumber population and exist in the hybrid sea cucumber population.

[0029] In some specific embodiments, in the microsatellite marker locus shown in SEQ ID NO. 2, specific alleles B, D and F are specific to the white sea cucumber population and exist in the hybrid sea cucumber population; specific alleles K and M are specific to the green sea cucumber population and exist in the hybrid sea cucumber population.

[0030] In some specific embodiments, the PCR amplification system is based on 25 μL and includes: 1-2 μL template, a total of 0.5 μL upstream primer, a total of 0.5 μL downstream primer, 0.5 μL dNTP, 2.5 μL 10×PCR Buffer, 0.2 μL TaqPlus DNA polymerase and the remainder sterile deionized water.

[0031] In some specific embodiments, the PCR amplification procedure includes: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60-55°C for 30 s, extension at 72°C for 30 s, 10 cycles, with annealing decreasing by 0.5°C each cycle; denaturation at 94°C for 30 s, annealing at 52-55°C for 30 s, extension at 72°C for 30 s, 30 cycles; and further extension at 72°C for 5-10 min.

[0032] The present invention screens microsatellite markers in the sea cucumber genome, and the screening criteria for the microsatellite marker sequence are preferably that the number of 2-base repeats is greater than or equal to 9 times, and the number of 3-base repeats is greater than or equal to 9 times.

[0033] The present invention designs primer pairs based on the sequences of the microsatellite markers, and the criteria for selecting primers include: (1) primer length of 15 to 30 bp; (2) GC content of 40% to 70%; (3) annealing temperature of 50 to 65°C; and (4) expected PCR product length of 100 to 350 bp.

[0034] The template of the present invention preferably includes genomic DNA of sea cucumber body wall tissue. There is no particular limitation on the method for extracting the genomic DNA, and the extraction can be performed using conventional methods in the art.

[0035] In the present invention, after the PCR amplification is completed, the amplified product is detected on an ABI 3730XL sequencer to obtain the genotype information of each SSR site; the SSR raw data file is analyzed using Genemapper software, and the number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon diversity index (I) and allele frequency are calculated using PopGene (version: v1.32), and the polymorphism information content (PIC) is calculated using Cervus (version: v3.0.7).

[0036] The present invention is based on two microsatellite sequences obtained by screening the sea cucumber genome, numbered AJ732 and AJ812, respectively, and their sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively. The present invention designs microsatellite marker primers for the two microsatellite sequences, respectively. The microsatellite marker primers have strong specificity, stable amplification, and high polymorphism. By analyzing the alleles of the above molecular markers through PCR and sequencing technology, the body wall color of the sea cucumber can be accurately, quickly, and effectively predicted, providing a powerful molecular biological basis and implementation method for the genetic breeding of sea cucumbers.

[0037] The white sea cucumber population, green sea cucumber population and hybrid sea cucumber population in the examples of the present invention are all from Weihai Ocean Biotechnology Co., Ltd.

[0038] Example 1

[0039] The microsatellite markers used in the embodiments of the present invention are all derived from the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database.

[0040] 1. Sample collection and preservation of sea cucumber body wall tissue Ten sea cucumbers were randomly selected, and body wall tissue samples of each individual were cut with scissors and tweezers. The samples were placed in pre-cooled cryotubes, quickly frozen with liquid nitrogen, and stored in a -80°C refrigerator.

[0041] 2. Extraction of Sea Cucumber Genomic DNA Genomic DNA from sea cucumbers was extracted using the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). The extracted genomic DNA was tested for quality on a 1.5% agarose gel. After determining the concentration, the DNA was diluted to 50 ng / μL and stored at −20°C until use.

[0042] 3. Validation of microsatellite locus primers The preserved sea cucumber genomic DNA was used as a template and the sequences of microsatellite loci AJ732 and AJ812 were amplified using primers SEQ ID NO. 3 to 6 (without fluorescein) designed in Table 1.

[0043] The nucleotide sequence of the microsatellite locus AJ732 is preferably as shown in SEQ ID NO.1: SEQ ID NO.1: tgcagcactctgtatcagcccttatgtgtgtcgttttgtttcgccagtacacataacagacacacacacacacacacatacacttacgaatgataagatcgagaaattctacctg tgattcggttgtaatgtaaccatgagtttaggataacaggggaacagggatataacagagaaaagcgacaagtaactgaataactcgacgatcactattagaatgttgcttgaagggtgagt; The nucleotide sequence of microsatellite locus AJ812 is preferably as shown in SEQ ID NO.2: SEQ ID NO.2: agacctttgaccacaccccacaattgtagggtttatttactcactatggagcaactgtgtgtcaagtaagacagcaatctattctctcattatatttagctattacaagctacaggagtaacacagaca cacggaacatccacacacacacacacacacacacacgcatacaccaacttgaatgcataggttacaatacctgcctttggcatgggcaaccaaaaatgttaatgaaaaatgtctcactttgggcggc.

[0044] The PCR amplification system was 25 μL, including: 1 μL template DNA, 1 μL forward primer, 1 μL reverse primer, 12.5 μL Green Taq Mix, and 9.5 μL sterile deionized water; The PCR amplification procedure included: pre-denaturation at 95°C for 5 min; 10 cycles of denaturation at 94°C for 30 s, annealing at 60-55°C for 30 s, and extension at 72°C for 30 s, with the annealing temperature decreasing by 0.5°C each cycle; 30 cycles of denaturation at 94°C for 30 s, annealing at 55-52°C for 30 s, and extension at 72°C for 30 s; and an additional extension at 72°C for 5 min.

[0045] Table 1 Microsatellite core sequence and marker primer sequence information of the present invention

[0046] 5 μL of the PCR product was electrophoresed on a 1.5% agarose gel and labeled with a 2000 bp DNA marker. After electrophoresis at 220 V for 10 minutes, the product was detected using a gel imager. The results showed that the primers designed in Table 1, SEQ ID NOs. 3–6, could stably and specifically amplify the sequences of the microsatellite loci AJ732 and AJ812. The microsatellite loci AJ732 and AJ812 were subsequently analyzed in three populations.

[0047] Example 2

[0048] 1. Sample collection and preservation of sea cucumber body wall tissue Individuals from three populations of sea cucumbers were randomly selected, including 41 white sea cucumbers, 36 green sea cucumbers, and 53 hybrid sea cucumbers. Body wall tissue samples were then removed from each individual using scissors and tweezers, placed in pre-chilled cryovials, quickly frozen with liquid nitrogen, and stored at -80°C.

[0049] 2. Extraction of Sea Cucumber Genomic DNA Genomic DNA from sea cucumbers was extracted using the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). The extracted genomic DNA was tested for quality on a 1.5% agarose gel. After determining the concentration, the DNA was diluted to 50 ng / μL and stored at −20°C until use.

[0050] 3. Microsatellite marker amplification detection and data analysis HEX fluorescein was used to label the upstream primers of microsatellite loci AJ732 and AJ812 to amplify the genomic DNA of A. japonicus.

[0051] The PCR amplification system was 25 μL, including: 1 μL template DNA, 0.5 μL forward primer, 0.5 μL reverse primer, 0.5 μL dNTP (10 mM), 2.5 μL 10× PCR Buffer (containing Mg 2+ ), 0.2 μL Taq Plus DNA polymerase (5 U / μL), 19.8 μL sterile deionized water; The PCR amplification procedure included: pre-denaturation at 95°C for 5 min; 10 cycles of denaturation at 94°C for 30 s, annealing at 60-55°C for 30 s, and extension at 72°C for 30 s, with the annealing temperature decreasing by 0.5°C each cycle; 30 cycles of denaturation at 94°C for 30 s, annealing at 53-55°C for 30 s, and extension at 72°C for 30 s; and an additional extension at 72°C for 5-10 min.

[0052] After PCR amplification, the amplified products were sequenced on an ABI 3730XL sequencer to obtain the genotype information of each SSR locus of 130 sea cucumbers.

[0053] Genemapper software was used to analyze the SSR raw data files, and PopGene (version: v1.32) was used to calculate the number of alleles (Na), effective number of alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), Shannon diversity index (I), and allele frequency. Cervus (version: v3.0.7) was used to calculate the polymorphism information content (PIC).

[0054] Table 2 Genetic diversity parameters of two microsatellite loci in the sea cucumber population

[0055] Note: Locus: locus, Na: number of alleles, Ne: effective number of alleles, Ho: observed heterozygosity, He: expected heterozygosity, PIC: polymorphic information content.

[0056] Based on Examples 1 and 2, 10 and 15 alleles were detected at the AJ732 and AJ812 microsatellite loci, respectively. The effective number of alleles (Ne) was 5.95 and 6.602, respectively. H o) were 0.279 and 0.738, respectively, and the expected observed heterozygosity ( H e) were 0.835 and 0.852. The polymorphism information content (PIC) was 0.813 and 0.831, respectively, indicating high polymorphism.

[0057] Table 3 Allele information of microsatellite locus AJ732 in the sea cucumber population

[0058] Note: Allele, Hybrid: hybrid sea cucumber population, White: white sea cucumber population, Cran: green sea cucumber population, N: number of alleles, Freq: allele frequency.

[0059] Table 4 Allele information of microsatellite locus AJ812 in the sea cucumber population

[0060] Note: Allele, Hybrid: hybrid sea cucumber population, White: white sea cucumber population, Cran: green sea cucumber population, N: number of alleles, Freq: allele frequency.

[0061] Allele frequency analysis of the two microsatellite loci showed that: At the AJ732 locus, there were five alleles (A, B, C, D, and E) in the white sea cucumber population, among which allele E had the highest frequency, followed by alleles C and D. There were eight alleles (A, B, C, E, F, G, H, and I) in the green sea cucumber population, among which allele A had the highest frequency, followed by alleles C and G. There were nine alleles (A, B, D, E, F, G, H, I, and J) in the hybrid sea cucumber population, among which allele B had the highest frequency, followed by alleles A and I. Allele D only appeared in the white and hybrid sea cucumber populations, and alleles F, G, H, and I only appeared in the green and hybrid sea cucumber populations.

[0062] At the AJ812 locus, the white sea cucumber population had a total of 10 alleles (A, B, C, D, E, F, G, H, I, and J), of which allele I had the highest frequency, followed by alleles G and A. The green sea cucumber population had a total of 9 alleles (A, C, E, G, H, I, K, L, and M), of which allele H had the highest frequency, followed by alleles A and I. The hybrid sea cucumber population had a total of 11 alleles (A, B, C, D, F, G, H, I, L, N, and O), of which allele H had the highest frequency, followed by alleles A and C. Furthermore, alleles B, D, and F were only found in the white and hybrid sea cucumber populations, and allele L was only found in the green and hybrid sea cucumber populations.

[0063] 4. Verification of genotype and phenotype at the AJ732 and AJ812 loci in Simulanthus japonicus Individuals from three other populations of sea cucumbers were collected: 30 white sea cucumbers, 30 green sea cucumbers, and 30 hybrid sea cucumbers. Genotypes at the AJ732 and AJ812 loci were determined. The results showed that at the AJ732 locus, allele D was present only in the white and hybrid sea cucumber populations, while alleles F, G, H, and I were present only in the green and hybrid sea cucumber populations. At the AJ812 locus, alleles B, D, and F were present only in the white and hybrid sea cucumber populations, while allele L was present only in the green and hybrid sea cucumber populations, consistent with the above results.

[0064] These results indicate that different sea cucumber populations exhibit distinct genetic characteristics at the AJ732 and AJ812 loci, and that hybrid sea cucumber populations inherit the genetic characteristics of both parental populations while exhibiting greater genetic diversity and unique allelic characteristics. These results provide important information for studying the genetic structure, interspecific relationships, and mechanisms of hybridization and evolution in sea cucumber populations, and lay the foundation for further genetic selection and breeding using microsatellite markers.

[0065] Obviously, the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are intended to be included within the scope of protection of the present invention.

Claims

1. A microsatellite molecular marker related to the early body color of sea cucumber, characterized in that: The microsatellite molecular marker has at least one nucleotide sequence as shown in SEQ ID NO.1 to SEQ ID NO.

2.

2. A primer composition for microsatellite molecular markers related to the early body color of sea cucumbers, characterized in that: The primer composition consists of: (1) a primer pair as shown in SEQ ID NOs. 3 and 4; and (2) At least one of the primer pairs shown in SEQ ID NOs. 5 and 6.

3. A kit comprising the primer combination according to claim 2.

4. A method for genetic analysis of sea cucumbers, characterized in that: include: Synthesizing the primer composition as claimed in claim 2; Using the primer combination to perform PCR amplification on the DNA sample of the sea cucumber to obtain an amplification product; The amplified products were subjected to genetic analysis.

5. The method according to claim 4, wherein the genetic analysis comprises: Allele number analysis, effective allele number analysis, Shannon diversity index analysis, gene flow analysis, genetic consistency analysis, genetic distance analysis, Nei's genetic distance analysis, heterozygosity analysis, expected heterozygosity analysis and polymorphism information content analysis.

6. The method of claim 4, wherein the genetic analysis comprises: The amplified product is detected on an ABI 3730XL sequencer to obtain the genotype information of each microsatellite molecular marker of the sea cucumber; Genemapper software was used to analyze the raw data files of microsatellite molecular markers, and PopGene was used to calculate the number of alleles, effective number of alleles, Shannon diversity index, gene flow, genetic consistency, genetic distance, and Nei genetic distance; Cervus was used to calculate observed heterozygosity, expected heterozygosity and polymorphism information content.

7. The use of the primer composition as claimed in claim 2, characterized in that: The application includes at least one of the following: (1) Application in genetic diversity analysis of sea cucumbers; (2) Application in identification of sea cucumber germplasm resources; (3) Application in identification of kinship of sea cucumbers; (4) Application in genetic breeding of sea cucumber; (5) Application in the detection of body color of sea cucumber larvae.

8. A method for determining the body color characteristics of a juvenile sea cucumber, characterized in that: The following steps are involved: (1) Using the sample DNA to be tested as a template, establishing a PCR amplification system using the primer combination described in claim 2, and performing PCR amplification; (2) Perform genotyping on the amplified products and determine whether the sea cucumber carries specific alleles related to body color based on the genotyping results.

9. The method according to claim 8, characterized in that In the microsatellite marker locus shown in SEQ ID NO.1, the specific allele D is specific to the white sea cucumber population and exists in the hybrid sea cucumber population; the specific alleles G, H and I are specific to the green sea cucumber population and exist in the hybrid sea cucumber population.

10. The method according to claim 8, characterized in that In the microsatellite marker locus shown in SEQ ID NO.2, specific alleles B, D and F are specific to the white sea cucumber population and exist in the hybrid sea cucumber population; specific alleles K and M are specific to the green sea cucumber population and exist in the hybrid sea cucumber population.

Images