Primer for identifying purity of hybrid seeds of 'Lu colored honey 131' watermelon and application of primer
By providing primers for identifying the purity of hybrid seeds of "Lucaimi 131" watermelon, combined with PCR amplification and electrophoresis technology, the problem of difficulty in efficiently and accurately identifying the purity of hybrid seeds in the prior art is solved, and a rapid and accurate identification effect is achieved, significantly improving the seed sales speed.
Patent Information
- Application Number
- CN202510119216.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-24
- Publication Date
- 2025-05-27
AI Technical Summary
The prior art is difficult to efficiently and accurately identify the purity of the watermelon hybrid seeds of "Lucai Mi 131" which leads to limited seed sales speed.
A primer is provided for identifying the purity of hybrid seeds of ‘Lucaimi 131’ watermelon, and the hybrid seeds are quickly and accurately distinguished from their parents’ seeds through PCR amplification and electrophoresis technology.
The rapid and accurate identification of the purity of the watermelon hybrid seeds of "Lucai Mi 131" has been achieved, which reduces the identification cost and improves the identification efficiency. It can produce results in one day, which is 3 to 4 months faster than traditional field identification.
Smart Images
Figure CN120041597A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant germplasm resource identification, and particularly relates to a primer for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds and its application. Background Art
[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and it is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.
[0003] Watermelon is an important crop with extremely high economic value. Currently, the main method for watermelon seed production is emasculation seed production technology. Due to reasons such as untimely and incomplete manual emasculation, false hybrid seeds often appear, resulting in a decrease in the genetic purity of the seeds and causing huge economic losses to production. Therefore, the purity of hybrid seeds must be identified before sale. Traditionally, the purity identification of hybrid seeds mainly relies on field planting, which not only consumes a large amount of time, space, manpower, and material resources, but also the identification technology depends on personal experience; it is time-consuming, laborious, and inaccurate. The backward method for identifying the purity of hybrid seeds has affected the sales speed of seeds to a certain extent.
[0004] Existing molecular techniques that can be used for purity identification include SSR, SNP, InDel markers, etc. However, SNP markers are all based on the resequencing of both parents, with relatively high costs and are not conducive to the identification of ordinary hybrid seeds. 'Lucaimi 131' watermelon is a new variety of small watermelon selected by the Vegetable Research Institute of Shandong Academy of Agricultural Sciences. It is obtained by crossing red-fleshed watermelon and yellow-fleshed watermelon. However, at present, there is no efficient and accurate primer and identification method for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds. Summary of the Invention
[0005] Aiming at the deficiencies of the above-mentioned existing technologies, through long-term technical and practical exploration, the present invention provides a primer for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds and its application. Using the above primer can quickly and accurately identify the purity of 'Lucaimi 131' watermelon hybrid seeds, reduce the identification cost, and improve the identification efficiency. Based on the above research results, the present invention is thus completed.
[0006] Specifically, the present invention is realized through the following technical solutions:
[0007] In the first aspect of the present invention, a primer for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds is provided, and the primer includes an upstream primer and a downstream primer;
[0008] Among them, the upstream primer is as follows a1) or a2):
[0009] a1) A single-stranded DNA molecule as shown in SEQ ID NO.1;
[0010] a2) A DNA molecule obtained by substituting and / or deleting and / or adding one or more nucleotides to the single-stranded DNA molecule shown in SEQ ID NO.1 and having the same function as SEQ ID NO.1.
[0011] The downstream primer is any one of the following b1) or b2):
[0012] b1) A single-stranded DNA molecule as shown in SEQ ID NO.2;
[0013] b2) A DNA molecule obtained by substituting and / or deleting and / or adding one or more nucleotides to the single-stranded DNA molecule shown in SEQ ID NO.2 and having the same function as SEQ ID NO.2.
[0014] In a second aspect of the present invention, there is provided a product for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds, and the product is selected from any one of the following:
[0015] c1) A reagent containing the above primers;
[0016] c2) A kit containing the above primers and / or the above reagents.
[0017] In a third aspect of the present invention, there is provided the use of the above primers or the above product in identifying the purity of 'Lucaimi 131' watermelon hybrid seeds.
[0018] In a fourth aspect of the present invention, there is provided a method for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds, and the method includes:
[0019] S1. Extract the genomic DNA of the male parent of the 'Lucaimi 131' watermelon hybrid, the female parent of the hybrid, and the sample to be identified;
[0020] S2. Perform PCR amplification on the genomic DNA obtained in step S1 using the above primers or product to obtain the amplification products of the male parent of the hybrid, the female parent of the hybrid, and the sample to be identified;
[0021] S3. Electrophorese the amplification products of the male parent, the female parent, and the sample to be identified obtained in step S2. If the amplification product of the male parent of the hybrid shows one band, the amplification product of the female parent of the hybrid shows one band, and the amplification product of the hybrid sample to be identified shows two bands, and the bands correspond to the bands shown by the amplification products of the male parent and the female parent of the hybrid respectively, then the hybrid sample to be identified is considered a pure hybrid; otherwise, it is a non-pure hybrid.
[0022] Further, the method further includes step S4: dividing the number of samples to be identified as pure hybrids by the total number of samples to be identified to obtain the purity of the hybrid seeds.
[0023] Beneficial technical effects achieved by the above one or more technical solutions:
[0024] The primers provided by the above technical solution for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds can amplify the co-dominant differential marker bands of the male and female parents of 'Lucaimi 131' watermelon; the band patterns amplified by the co-dominant differential markers are clear and have good repeatability; the primer amplification can produce female parent-specific markers and male parent-specific markers; using the method provided by the present invention for identifying the purity of hybrid seeds can effectively distinguish hybrid seeds from their parental seeds, with short time consumption and accurate results. The identification results can be obtained within one day, while conventional field identification takes 3 to 4 months.
[0025] In summary, the above technical solution greatly improves the identification efficiency of the purity of 'Lucaimi 131' watermelon hybrid seeds, and thus has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The accompanying drawings forming a part of this invention are used to provide a further understanding of the invention. The schematic embodiments and descriptions thereof of the invention are used to explain the invention and do not constitute an improper limitation of the invention.
[0027] Figure 1 Specific bands obtained by primer amplification of the male and female parents of 'Lucaimi 131' watermelon in Example 1 of the present invention.
[0028] Figure 2 Partial electrophoresis result pictures of Example 2 in Example 2 of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0029] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.
[0030] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. It should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments and not for limiting the protection scope of the present invention.
[0031] The present invention will be further described in conjunction with specific examples. The following examples are only for explaining the present invention and do not limit its content. If the specific experimental conditions are not indicated in the examples, they are usually in accordance with conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples can be obtained from commercial sources without special instructions.
[0032] As mentioned above, there is currently no efficient and accurate primer and identification method for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds.
[0033] In view of this, in a typical specific embodiment of the present invention, a primer for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds is provided, and the primer comprises an upstream primer and a downstream primer;
[0034] Wherein, the upstream primer is as follows a1) or a2):
[0035] a1) A single-stranded DNA molecule as shown in SEQ ID NO.1;
[0036] a2) A DNA molecule obtained by substituting and / or deleting and / or adding one or more nucleotides to the single-stranded DNA molecule shown in SEQ ID NO.1 and having the same function as SEQ ID NO.1.
[0037] The downstream primer is as follows b1) or b2):
[0038] b1) A single-stranded DNA molecule as shown in SEQ ID NO.2;
[0039] b2) A DNA molecule obtained by substituting and / or deleting and / or adding one or more nucleotides to the single-stranded DNA molecule shown in SEQ ID NO.2 and having the same function as SEQ ID NO.2.
[0040] In another specific embodiment of the present invention, the molar ratio of the upstream primer to the downstream primer can be 0.5 - 5:1, preferably 1:1.
[0041] In another specific embodiment of the present invention, a product for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds is provided, and the product is selected from any one of the following:
[0042] c1) A reagent containing the above primers;
[0043] c2) A kit containing the above primers and / or the above reagents.
[0044] In another specific embodiment of the present invention, the application of the above primers or the above products in identifying the purity of 'Lucaimi 131' watermelon hybrid seeds is provided.
[0045] In another specific embodiment of the present invention, a method for identifying the purity of 'Lucaimi 131' watermelon hybrid seeds is provided, and the method includes:
[0046] S1. Extract the genomic DNA of the male parent of the 'Lucaimi 131' watermelon hybrid, the female parent of the hybrid, and the sample to be identified;
[0047] S2. Perform PCR amplification on the genomic DNA obtained in step S1 using the above primers or products to obtain the amplification products of the male parent of the hybrid, the female parent of the hybrid, and the sample to be identified;
[0048] S3. Electrophorese the amplification products of the male parent, female parent, and sample to be identified obtained in step S2. If the amplification product of the male parent of the hybrid shows one band, the amplification product of the female parent of the hybrid shows one band, and the amplification product of the hybrid sample to be identified shows two bands, and the bands correspond to the bands shown by the amplification products of the male parent and female parent of the hybrid respectively, then the hybrid sample to be identified is considered a pure hybrid; otherwise, it is a non-pure hybrid.
[0049] In another specific embodiment of the present invention, the method further includes step S4. Divide the number of samples to be identified that are identified as pure hybrids by the total number of samples to be identified to obtain the purity of the hybrid seeds.
[0050] In another specific embodiment of the present invention, in step S1, the extraction tissues of the male parent, female parent, and sample to be identified are radicles;
[0051] In another specific embodiment of the present invention, the method for extracting the genomic DNA is as follows: After crushing the radicles of the male parent of the 'Lucaimi 131' watermelon hybrid, the female parent of the hybrid, and the hybrid sample to be identified respectively, perform solid-liquid separation, and collect the supernatant as the genomic DNA.
[0052] In yet another specific embodiment of the present invention, the disruption is carried out by vortexing and shaking the radicle, grinding beads and 1×TPS extraction solution at a rotation speed of 2500 - 3500 rpm (preferably 3000 rpm).
[0053] In yet another specific embodiment of the present invention, the size of the radicle cut is preferably 1 - 3 cm; the volume of the 1×TPS extraction solution corresponding to the radicle of the above size is preferably 200 - 500 μL (preferably 500 μL).
[0054] In yet another specific embodiment of the present invention, the method of solid-liquid separation is centrifugation, the rotation speed of the centrifugation is 11000 - 13000 rpm (preferably 12000 rpm), and the time of the centrifugation is 8 - 12 min (preferably 10 min).
[0055] In step S2, the PCR amplification system, based on 20 μL, preferably includes the following components: genomic DNA (10 ng / μL) 2 μL, upstream primer (10 pmol / μL) 1 μL, downstream primer (10 pmol / μL) 1 μL, 2X M5 HiPer plus Taq HiFi PCR mix 10 μL, ddH 2 O 6 μL.
[0056] The PCR amplification program is preferably: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, 35 cycles; hold at 72 °C for 7 min.
[0057] In step S3, the voltage of the electrophoresis is 180 - 200 V (preferably 180 V), and the time of the electrophoresis is 40 - 50 min (preferably 45 min).
[0058] In step S3, the nucleotide sequence of the paternal amplification product is as shown in SEQ ID NO.3; the nucleotide sequence of the maternal amplification product is as shown in SEQ ID NO.4.
[0059] The following further explains and illustrates the present invention through examples, but does not constitute a limitation to the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.
[0060] Example 1
[0061] 1. Screen Indel primers for purity identification.
[0062] Screen from the published watermelon Indel primers among the parents, and select a pair of primer sequences with co-dominant differential marker bands as shown below:
[0063] Forward primer: AAGCTATTTTGAGAAAATGG (SEQ ID NO.1);
[0064] Reverse primer: TACTAATTTCTTCTCACTCT (SEQ ID NO.2).
[0065] 2. Use the above specific primers to identify the purity of watermelon 'Lucaimi 131' seeds.
[0066] (1) Rapid extraction of watermelon DNA
[0067] The experimental materials were commercial watermelon 'Lucaimi 131' seeds and the DNA of its female parent P1 long eggplant and male parent P2 radicle.
[0068] The steps are as follows:
[0069] ① After the watermelon seeds germinated, cut 1 - 3 cm of radicle with scissors and place it in a 96 - well PCR plate, add grinding beads and 50 μL (1×TPS) extraction solution, and shake and break it on a vortex mixer (3000 rpm).
[0070] ② Centrifuge at 12000 rpm for 10 min, and take 2 μL of the supernatant as the PCR template.
[0071] (2) PCR amplification:
[0072] PCR system (20 μL)
[0073] Component Concentration Addition amount DNA 10 ng / μL 2 μL Forward primer 10 pmol / μL 1 μL Reverse primer 10 pmol / μL 1 μL 2X M5 HiPer plus Taq HiFi PCR mix - 10 μL Ultra-pure water - 6 μL
[0074] PCR amplification program: After pre - denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, after 35 cycles; keep at 72 °C for 7 min, and then store at 4 °C for detection.
[0075] (3) Gel electrophoresis
[0076] Load the product after PCR amplification onto a 3 wt% agarose gel containing 0.01 wt% GelRed nucleic acid dye, the voltage of the electrophoresis is 180 V; the time of the electrophoresis is 45 min, and use a gel imaging system to take pictures for archiving and analyze the labeling results.
[0077] (4) Amplification results
[0078] The amplification results are shown in Figure 1 , in which the specific band amplified by the male parent P1 is 123 bp, and the specific band amplified by the female parent P2 is 145 bp (see Figure 1 );
[0079] Recover the specific bands and send them to Sangon Biotech in Shanghai for sequencing. The sequences of the bands are shown as SEQ ID NO.3 and SEQ ID NO.4. The amplification products of the hybrid have two specific bands, which respectively correspond to the bands shown by the amplification products of the male parent and the female parent. The bold sequences are the differential sequences.
[0080] Sequence of band a:
[0081]
[0082] Sequence of band b:
[0083]
[0084] Example 2
[0085] The method of Example 1 was used to identify the seed purity of 1 sample Q1 of 'Lucaimi 131' provided by the seed production base. There were 22 plants in sample Q1, which were numbered individually. The genomic DNA of each individual plant was extracted for detection. The results showed that the 22 plants in sample Q1 simultaneously contained the bands of both parents, indicating pure hybrid seeds. The seed purity was 100%, which was consistent with the field survey results, and the accuracy rate was 100% (the results are as Figure 2 shown).
[0086] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, for those skilled in the art, they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of them. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention. Although the specific implementation manners of the present invention have been described above in conjunction with the accompanying drawings, it is not a limitation to the protection scope of the present invention. Those skilled in the art should understand that based on the technical solutions of the present invention, various modifications or deformations that can be made without creative efforts by those skilled in the art are still within the protection scope of the present invention.
Claims
1. A primer for identifying the purity of 'Lu Cai Mi 131' watermelon hybrid seeds, characterized in that: The primers include an upstream primer and a downstream primer; Wherein, the upstream primer is the following a1) or a2): a1) a single-stranded DNA molecule as shown in SEQ ID NO.1; a2) a DNA molecule having the same function as SEQ ID NO.1 after one or more nucleotides are substituted and / or deleted and / or added to the single-stranded DNA molecule shown in SEQ ID NO.1; The downstream primer is the following b1) or b2): b1) a single-stranded DNA molecule as shown in SEQ ID NO.2; b2) A DNA molecule having the same function as SEQ ID NO.2 after one or more nucleotides are substituted and / or deleted and / or added to the single-stranded DNA molecule shown in SEQ ID NO.
2.
2. The primer according to claim 1, characterized in that The molar ratio of the upstream primer to the downstream primer is 0.5-5:1, preferably 1:
1.
3. A product for identifying the purity of 'Lu Cai Mi 131' watermelon hybrid seeds, characterized in that: The product is selected from any one of the following: c1) a reagent containing the primer according to claim 1 or 2; c2) A kit comprising the primers according to claim 1 or 2 and / or the reagents according to c1).
4. Use of the primers according to claim 1 or 2 or the product according to claim 3 in identifying the purity of 'Lu Cai Mi 131' watermelon hybrid seeds.
5. A method for identifying the purity of 'Lu Cai Mi 131' watermelon hybrid seeds, characterized in that: The method comprises: S1, extracting genomic DNA from the male parent of the 'Lu Cai Mi 131' watermelon hybrid, the female parent of the hybrid and the sample to be identified; S2. Using the primers described in claim 1 or 2 or the product described in claim 3 to perform PCR amplification on the genomic DNA obtained in step S1 to obtain amplified products of the male parent of the hybrid, the female parent of the hybrid, and the sample to be identified; S3. Perform electrophoresis on the amplified products of the paternal parent, the maternal parent of the hybrid and the sample to be identified obtained in step S2. If the amplified product of the paternal parent of the hybrid shows one band, the amplified product of the maternal parent of the hybrid shows one band, and the amplified product of the hybrid sample to be identified shows two bands, and they correspond to the bands shown by the amplified products of the paternal parent of the hybrid and the maternal parent of the hybrid, respectively, then the hybrid sample to be identified is considered to be a pure hybrid; otherwise, it is a non-pure hybrid.
6. The method according to claim 5, characterized in that The method further comprises step S4, dividing the number of samples to be identified as pure hybrids by the total number of samples to be identified to obtain the purity of the hybrid seeds.
7. The method according to claim 5, characterized in that In the step S1, the extracted tissues of the male parent, the female parent and the sample to be identified are radicles.
8. The method according to claim 5, characterized in that In step S1, the genomic DNA extraction method is as follows: the radicles of the male parent of the 'Lu Cai Mi 131' watermelon hybrid, the female parent of the hybrid and the hybrid sample to be identified are crushed, the solid-liquid separation is performed, and the supernatant is collected as the genomic DNA.
9. The method according to claim 5, characterized in that In step S2, the PCR amplification system preferably includes the following components in 20 μL: 2 μL of genomic DNA, 1 μL of upstream primer, 1 μL of downstream primer, 10 μL of 2X M5 HiPer plusTaq HiFi PCR mix, and 6 μL of ddH2O; The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 35 cycles; and holding at 72°C for 7 min.
10. The method according to claim 5, characterized in that In the step S3, the voltage of the electrophoresis is 180-200 V, and the time of the electrophoresis is 40-50 min.