A cucurbit fruit peel color mutation site, primer set, fruit peel color detection method and application

Abstract

This invention provides a gourd pericarp color mutation site, primer set, pericarp color detection method, and application, belonging to the field of plant breeding technology. This invention identifies pericarp color in two parents (variegated pericarp and white pericarp) and their reciprocal crosses (F1) after fruit maturity. It was found that white pericarp is a recessive trait. Then, the two parents were resequencing to screen for differentially expressed loci. After the F2 population fruits matured, pericarp color was investigated. Based on pericarp color, a mixed pool of white and variegated pericarp was constructed. Differentially expressed loci between the parents were used to detect mutations in the mixed pool. The SNP Gprime method was used for localization, and combined with bioinformatics analysis, pericarp color-related mutation sites were screened. Through natural population validation, the gourd pericarp color mutation site was found to be a G→A mutation at nucleotide position 1310809 of exon 7 of the Lsi05G000660 gene on chromosome 5 of the gourd.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, and in particular to a gourd pericarp color mutation site, primer set, pericarp color detection method and application. Background Technology

[0002] The gourd [Lagenaria siceraria (Molina) Standl.] (2n=2x=22), also known as night-blooming gourd, bottle gourd, and ground gourd, originated in Africa and is an annual vine-like herbaceous plant belonging to the Cucurbitaceae family. It is widely cultivated around the world and can be used as rootstock for grafting cucurbits, as a vegetable, and in daily necessities and cultural handicrafts. It possesses abundant germplasm and genetic resources.

[0003] The color of the gourd peel is one of the important characteristics of the variety, and it has an important influence on the gourd's ornamental, craft, and commercial value as an edible gourd. Gourds with bright, uniform, and glossy colors are often more popular with consumers and command higher prices.

[0004] The color of gourd peel is mainly solid or variegated, with green and white being the most common. Color identification allows for the differentiation of different varieties, facilitating targeted breeding and improvement efforts. Furthermore, the selection of superior varieties often involves optimizing peel color, making color identification a crucial step in the breeding process. Currently, gourd peel color screening relies primarily on conventional field observation after fruit ripening. However, this method is time-consuming, costly, and prone to errors due to the influence of leaves and other obstructions on peel color. Therefore, a highly accurate, simple, and time-efficient method for gourd peel color identification is urgently needed.

[0005] Molecular marker-assisted breeding is one of the most widely used technologies in agricultural breeding. By accurately identifying genetic markers of target traits, it significantly improves breeding efficiency and controllability, providing unprecedented technical support for crop improvement. This technology eliminates the need for complex field screening processes, significantly shortening the breeding cycle and reducing field screening costs. It overcomes the bottlenecks of traditional breeding methods, allowing genotyping at the seedling stage. It is fast, accurate, low-cost, and unaffected by environmental factors, significantly improving breeding efficiency and accuracy, and providing technical support for variety improvement. However, current technologies lack relevant molecular marker loci for gourd peel color screening. Therefore, developing relevant molecular markers for gourd peel color identification and related variety breeding is of great significance. Summary of the Invention

[0006] The purpose of this invention is to provide a gourd peel color mutation site, primer set, peel color detection method and application. By detecting gourd peel color through molecular markers, it overcomes the shortcomings of existing breeding methods, such as low breeding efficiency, high cost, long purity identification cycle, accuracy being easily affected by the environment, and insufficient related genes.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a gourd peel color mutation site located on gourd chromosome 5.

[0009] Furthermore, the mutation site for the color of the gourd peel is the G→→A mutation at nucleotide position 1310809 of exon 7 of the Lsi05G000660 gene on chromosome 5 of the gourd.

[0010] This invention also provides a set of KASP-labeled primers for detecting the color of gourd peel, comprising primers with the following sequences:

[0011] White pericarp site binding primer-F1-SEQ ID NO.1:

[0012] 5'-GAAGGTGACCAAGTTCATGCTTCAAAGATGGAAATGATTAATGTTTGTG-3';

[0013] Flower-colored pericarp site binding primer-F2-SEQ ID NO.2:

[0014] 5'-GAAGGTGACCAAGTTCATGCTTCAAAGATGGAAATGATTAATGTTTGTA-3';

[0015] Downstream primer-R1-SEQ ID NO.3:

[0016] 5'-AAACCCCTAAAACACTTCCAATGA-3'.

[0017] Furthermore, the 5' ends of the white pericarp site binding primer and the colored pericarp site binding primer are labeled with different fluorescent groups.

[0018] This invention also provides an application of a KASP marker primer set that can detect the color of gourd peel in gourd breeding.

[0019] This invention also provides a method for detecting the color of gourd peel, comprising the following steps:

[0020] (1) Extracting DNA from the gourd material to be identified;

[0021] (2) The DNA of the gourd material to be identified was amplified by PCR using primers with different fluorescent groups shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3;

[0022] (3) Analyze the results of PCR amplification.

[0023] Furthermore, in step (2), the reaction system for the PCR amplification is as follows:

[0024] 2x Taq DNA Polymerase Mix 2~4μL, 4x SNP Primer Mix 1~2μL, DNA sample 2~4μL.

[0025] Furthermore, the PRIMER mix comprises raw materials in the following volume ratios:

[0026] F1∶F2∶R1∶pure water = 0.5~2∶0.5~2∶1~4∶2~8; the concentrations of F1, F2, and R1 are all 90~110μm / mL.

[0027] Furthermore, in step (2), the PCR amplification reaction procedure is as follows:

[0028] Table 2 PCR amplification program

[0029]

[0030] The present invention also provides an application of a method for detecting the color of gourd peel in gourd breeding.

[0031] The beneficial effects of this invention compared to the prior art are as follows:

[0032] (2) This invention identifies the peel color of two parents (variegated peel and white peel) and their reciprocal cross F1 after the fruit matures. It was found that the white peel of the gourd is a recessive trait. Then, the two parents were resequencing to screen for differential loci. After the fruit of the F2 population matured, the peel color was investigated. Based on the peel color, a mixed pool of white peel and variegated peel was constructed. The mixed pool was tested using differential loci between the parents. The SNP Gprime method was used for localization. Combined with bioinformatics analysis, the mutation sites related to peel color were screened. Through natural population verification, it was found that the mutation site of gourd peel color is the G→A mutation at nucleotide position 1310809 of exon 7 of the Lsi05G000660 gene on chromosome 5 of gourd.

[0033] (2) This invention designs a set of KASP marker primers (SEQ ID NO.1 to SEQ ID NO.3) targeting the G→A mutation at nucleotide position 1310809 of exon 7 of the Lsi05G000660 gene on chromosome 5 of the gourd, which can detect the color of the gourd peel. This KASP primer set can be used for gourd peel color detection, and is characterized by high efficiency, high accuracy, and no pollution. It overcomes the shortcomings of existing breeding methods, such as low efficiency, high cost, long purity identification cycle, susceptibility to environmental influences, and insufficient related genes, thus accelerating the breeding and purity identification of related varieties. Detailed Implementation

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0039] This invention provides a method for detecting the color of gourd peel, comprising the following steps:

[0040] (1) Extracting DNA from the gourd material to be identified;

[0041] (2) The DNA of the gourd material to be identified was amplified by PCR using the primers shown in SEQ ID NO.1 to SEQ ID NO.3;

[0042] (3) Analyzing the results of PCR amplification, wherein the method for analyzing the results of PCR amplification includes:

[0043] If the genotype is G, then it is a homozygous white-peeled gourd material.

[0044] Alternatively, if the genotype is A, it is a homozygous gourd flower color peel material;

[0045] Alternatively, if the genotype is G / A, it is a gourd heterozygous flower-colored pericarp material.

[0046] Mutant sequence SEQ ID NO.4:

[0047] Note: R in the first line of the sequence represents a mutation site, indicating G or A.

[0048] >chr05 chr05:1310764..1320889(+strand)class=mRNAlength=10126

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057] Example 1

[0058] Example 1 of this invention designs a KASP-labeled primer set that can detect the color of gourd peel. The specific steps are as follows:

[0059] (1) Using gourd materials resistant to gourd wilt disease

[0060] Using one gourd material Y4 with a white gourd material HGZ as parents, the offspring F1 was obtained by reciprocal crosses. The offspring F1 were then self-crossed to obtain the F2 population.

[0061] (2) Soak and germinate Y4, HGZ, F1 and F2 seeds, and after sowing in plug trays, transplant them into the field at the 1 leaf and 1 heart stage. Prune single vines, set fruit on lateral vines, strictly self-pollinate, and set 2 fruits per plant to avoid fruit rot or environmental influences such as sunlight exposure.

[0062] Fruit peel color was examined after 55 days of fruit development. It was found that the F1 generation from both reciprocal crosses produced mottled peels, indicating that white peel is a recessive trait in gourds. Furthermore, the F2 generation produced 71 mottled gourds and 25 white-skinned gourds, matching the 3:1 ratio, indicating that peel color is a quality trait.

[0063] Leaves were sampled from the parents, F1, and F2 individual plants, and DNA was extracted using a routine genomic DNA extraction kit (containing RNase A) from Beijing TransGen Biotechnology Co., Ltd. Both parents were resequencing to detect differentially expressed sites. An extreme mixing pool was constructed for the F2 population based on pericarp color. Using BSA sequencing and the Gprime method, a functional mutation (G→A) was detected at nucleotide 1310809 of exon 7 of the gene Lsi05G000660, homologous to Cytochrome P450, on chromosome 5 (sequence shown in SEQ ID NO.4). Therefore, this gene was preliminarily identified as a gourd pericarp color-related gene. A KASP molecular marker was designed based on this mutation site sequence, the sequence of which is as follows:

[0064] Upstream primer: White pericarp site binding primer-F1-SEQ ID NO.1:

[0065] 5'-GAAGGTGACCAAGTTCATGCTTCAAAGATGGAAATGATTAATGTTTGTG-3'

[0066] Upstream primer: Flower pericarp site binding primer-F2-SEQ ID NO.2:

[0067] 5'-GAAGGTGACCAAGTTCATGCTTCAAAGATGGGAAATGATTAATGTTTGTA-3'

[0068] Downstream primer R1 - SEQ ID NO.3:

[0069] 5'-AAACCCCTAAAACACTTCCAATGA-3'

[0070] Example 2

[0071] Example 2 of this invention tested the detection effect of the KASP molecular marker primer set shown in SEQ ID NO.1 to SEQ ID NO.3 in Example 1. The specific steps are as follows:

[0072] Table 1 Sample Sources

[0073] Sample number source Sample number source Sample number source Z063 Shandong HN1 Hainan Z0618 Shandong JL082 Jilin J03 Japan Z078 Shandong Z077 Shandong JTT Japan Z0620 Shandong SD0810 Shandong JZS Japan YH2 Ningbo J081 Japan KZ Shandong JTK01 Japan C2002 Japan T2002 Japan JX0812 Beijing DP-1 Taizhou Y4 Japan JX0815 Beijing FH1 Japan Y1 Japan TB10 Japan HGZ Japan Z062 Shandong supernatural powers Japan

[0074] Note: The above-mentioned germplasm resources can be obtained from the applicant by the public within twenty years from the date of application, and are only used for repeating the experiments related to this invention.

[0075] (1) The 27 materials in Table 1 were sown and sampled at the 1-leaf-1-heart stage. Genomic DNA was extracted from the leaves, and the concentration was measured using a NanoDrop 2000. Each DNA stock solution was diluted to 20 ng / uL. The extracted genomic DNA was amplified and detected using the molecular markers described in Example 1. Simultaneously, these 27 gourd germplasm resources were transplanted into the field. Single-vine training was implemented, with lateral vines bearing fruit. Strict self-pollination was conducted, with two fruits per plant to prevent fruit rot or environmental factors such as sunlight exposure. Fruit peel color was examined after 55 days of fruit development.

[0076] (2) Prepare the PCR reaction system as follows: 2xTaq DNA Polymerase Mix 2μL, SNP Primer Mix (4x) 1μL, DNA sample 2μL.

[0077] (3) Perform PCR amplification according to the procedure shown in Table 2:

[0078] Table 2 PCR amplification program

[0079]

[0080] (4) After amplification, the mixture was used for SNP site detection. The fluorophores FAM and VIC were used to distinguish between two isogenetic sites. FAM and VIC were labeled on primers F1 and F2, respectively. Passive reference dye ROX was used to correct for signal differences between wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 3. The reading software was an LGC OEMGA device.

[0081] Table 3. Related excitation and emission wavelengths

[0082] fluorescent groups Excitation light (nm) Emitted light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0083] (5) The PCR amplification results were analyzed using LGC_OMEGA's genotyping software (Kluster Caller). The relative fluorescence values ​​of VIC and FAM for each PCR reaction well were obtained. Based on the relative fluorescence values, the samples were clustered, and the genotypes were further determined based on the sample clusters and fluorescence types. The genotype and phenotype results of the tested samples are shown in Table 4.

[0084] Table 4. Sample Genotypes and Peel Colors

[0085] Sample number genotype leather color Sample number genotype leather color Sample number genotype leather color Z063 A / A Flower skin HN1 A / A Flower skin Z0618 G / G White skin JL082 G / G White skin J03 G / G White skin Z078 G / G White skin Z077 G / G White skin JTT A / A Flower skin Z0620 A / A Flower skin SD0810 G / G White skin JZS G / G White skin YH2 G / G White skin J081 G / G White skin KZ A / A Flower skin JTK01 G / G White skin C2002 A / A Flower skin T2002 G / G White skin JX0812 A / A Flower skin DP-1 G / G White skin Y4 A / A Flower skin JX0815 A / A Flower skin FH1 A / A Flower skin Y1 G / G White skin TB10 G / G White skin HGZ G / G White skin Z062 G / G White skin supernatural powers G / G White skin

[0086] Table 4 shows that the genotype and phenotype results are consistent. All 10 mottled gourd accessions had the genotype A / A, while all 17 white-skinned accessions had the genotype G / G. This indicates that this marker can significantly distinguish between mottled and white-skinned gourd materials and can be used for the creation of gourd germplasm resources and variety breeding related to gourd skin color.

[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A KASP-labeled primer set for detecting the color of gourd peel, characterized in that, Primers including the following sequences: White pericarp site binding primer-F1-SEQ ID NO.1: 5'-GAAGGTGACCAAGTTCATGCTTCAAAGATGGAAATGATTAATGTTTGTG- 3'; Flower-colored pericarp site binding primer-F2-SEQ ID NO.2: 5'-GAAGGTGACCAAGTTCATGCTTCAAAGATGGAAATGATTAATGTTTGTA - 3'; Downstream primer-R1-SEQ ID NO.3: 5'-AAACCCCTAAAACACTTCCAATGA- 3'.

2. The KASP-labeled primer set for detecting the color of gourd peel according to claim 1, characterized in that, The 5' ends of the white pericarp site binding primer and the colored pericarp site binding primer were labeled with different fluorescent groups.

3. The application of the KASP marker primer set for detecting gourd pericarp color as described in any one of claims 1-2 in gourd breeding, characterized in that, The KASP marker primer set was used to detect a genotype of G, indicating that the material was homozygous white pericarp from gourd. If the KASP marker primer set detects a genotype of A, then it is a homozygous gourd flower color pericarp material; If the genotype detected by the KASP marker primer set is G / A, then it is a gourd heterozygous flower color pericarp material.

4. A method for detecting the color of gourd peel, characterized in that, Includes the following steps: (1) Extracting DNA from the gourd material to be identified; (2) The DNA of the gourd material to be identified was amplified by PCR using primers with different fluorescent groups shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; (3) Analyze the results of PCR amplification: If the genotype is G, then it is a homozygous white-peeled gourd material. Alternatively, if the genotype is A, it is a homozygous gourd flower color peel material; Alternatively, if the genotype is G / A, it is a gourd heterozygous flower-colored pericarp material.

5. The method for detecting the color of gourd peel according to claim 4, characterized in that, In step (2), the reaction system for PCR amplification is as follows: 2x Taq DNA Polymerase Mix 2~4μL, 4x SNP Primer Mix 1~2 μL, DNA sample 2~4μL.

6. The method for detecting the color of gourd peel according to claim 5, characterized in that, The PRIMER mix comprises raw materials in the following volume ratios: F1:F2:R1:pure water = 0.5~2:0.5~2:1~4:2~8; the concentrations of F1, F2, and R1 are all 90~110μM.

7. The method for detecting the color of gourd peel according to claim 4, characterized in that, In step (2), the PCR amplification reaction procedure is as follows: Step 1: Process: Pre-denaturation; Temperature: 94℃; Time: 10 minutes; Number of cycles: 1 cycle; Step 2: Process: Denaturation; Temperature: 94℃; Time: 20 seconds; Process: Annealing / Extension; Temperature: 61℃ -55℃, drop 0.6℃ per cycle; Time: 45 seconds; Step 2 loop count: 10 cycles; Step 3: Process: Denaturation; Temperature: 94℃; Time: 20 seconds; Process: Annealing / Extension; Temperature: 55℃; Time: 45 seconds; Step 3: 37 cycles.

8. The application of the method for detecting the color of gourd peel as described in any one of claims 4 to 7 in gourd breeding.

Images