Application of plant lactobacillus BD7807 in preparation of cheese

Abstract

The invention belongs to the technical field of biological agents, and particularly relates to application of plant lactobacillus BD7807 in preparation of cheese. According to the cheese prepared by taking the plant lactobacillus BD7807 as a core fermentation strain, the quality and functional characteristics of the cheese are remarkably improved. In particular, the cheese exhibits a higher water binding capacity, a stronger acid producing ability, a lower pH value, a lower fat content, and a richer level of taste. The characteristics not only optimize the texture and flavor of the cheese, but also endow the cheese with higher nutritional value and health attribute. Therefore, the method has important practical significance in promoting the upgrading of cheese products and meeting the requirements of consumers on high-quality and functional dairy products, and shows a wide market application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of biological agents, and particularly to the use of Lactiplantibacillus plantarum BD7807 in the preparation of cheese. Background Art

[0002] As a fermented dairy product with a long history, the production process and quality characteristics of cheese have always received extensive attention. The production of traditional cheese mainly relies on the fermentation of lactic acid bacteria (such as Lactobacillus bulgaricus and Streptococcus thermophilus). These strains convert lactose into lactic acid, reducing the pH value of the cheese, thereby forming the texture and flavor of the cheese. However, traditional starters have some limitations in practical applications, such as a relatively long fermentation time, a single flavor, limited nutritional components, and insufficient ability to regulate fat content. These problems limit the further development of cheese in the field of healthy foods.

[0003] In recent years, with the continuous in-depth research of microbiology and probiotics, Lactiplantibacillus plantarum has gradually attracted attention due to its unique metabolic characteristics and probiotic functions. Although the application of Lactiplantibacillus plantarum in fermented foods has gradually increased, its application research in cheese making is still relatively scarce. Summary of the Invention

[0004] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide the use of Lactiplantibacillus plantarum BD7807 in the preparation of cheese to solve the problems in the prior art.

[0005] To achieve the above object and other related objects, the present invention first provides the use of Lactiplantibacillus plantarum BD7807 with the preservation number of CGMCC NO.33630 in the preparation of a starter.

[0006] The present invention also provides a starter, which contains the Lactiplantibacillus plantarum BD7807.

[0007] The present invention also provides the use of the starter in the preparation of cheese.

[0008] The present invention also provides the use of the starter in the preparation of food.

[0009] As described above, the use of Lactiplantibacillus plantarum BD7807 of the present invention in the preparation of cheese has the following beneficial effects:

[0010] 1) Improve the quality of cheese: After adding Lactiplantibacillus plantarum BD7807, the water-holding capacity and taste richness of the cheese are significantly improved, the texture is more delicate, the elasticity is increased, the chewiness is reduced, and the overall sensory quality is significantly improved;

[0011] 2) Enhanced fermentation ability: Lactiplantibacillus plantarum BD7807 has a strong acid-producing ability, which can further reduce the pH value of cheese, enhance the fermentation effect, and shorten the fermentation time.

[0012] 3) Improved functionality: After adding Lactiplantibacillus plantarum BD7807 to the starter culture, the viable count of bacteria in the cheese increases significantly, providing more probiotics, which is beneficial to intestinal health. Brief Description of the Drawings

[0013] Figure 1 It shows the morphological form of Gram-stained cells of Lactiplantibacillus plantarum in Example 1 of the present invention.

[0014] Figure 2 It shows the phylogenetic tree diagram of the strain in Example 1 of the present invention.

[0015] Figure 3 It shows the radar chart of cheese measured by an electronic tongue in Example 2 of the present invention. Detailed Description of the Invention

[0016] The present invention first provides the use of Lactiplantibacillus plantarum BD7807 with the preservation number of CGMCC NO. 33630 in the preparation of a starter culture.

[0017] The preservation number of the Lactiplantibacillus plantarum BD7807 is CGMCC NO. 33630, and its taxonomic name is Lactiplantibacillus plantarum. The preservation date is February 24, 2025, and it is preserved in the General Microbiology Center of the China Center for Type Culture Collection, with the preservation address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0018] The Lactiplantibacillus plantarum BD7807 is isolated from pickles.

[0019] The Lactiplantibacillus plantarum BD7807 is a Gram-positive bacterium and rod-shaped.

[0020] In some embodiments of the present invention, the starter culture is used in the fermentation of solid foods or liquid foods.

[0021] The solid food is selected from cheese or bread; the liquid food is selected from yogurt, flavored fermented milk or lactic acid beverage.

[0022] In some embodiments of the present invention, the starter culture further includes a microbial combination of one or more other species.

[0023] The microorganisms of the other species can have a beneficial effect on the health of the host to which they are applied.

[0024] In certain embodiments of the present invention, the starter culture further comprises other bacteria and / or fungi.

[0025] The bacteria and / or fungi are probiotics or are edible.

[0026] The "probiotics" are defined as any non-pathogenic bacteria that, when administered to a host in a sufficient number of live cells, can have a beneficial effect on the health of the host.

[0027] In certain embodiments of the present invention, the other bacteria are selected from one or more of the genera Lactobacillus, Lactobacillus casei, Bifidobacterium, Lactobacillus mucosae, Lactiplantibacillus plantarum, Lactobacillus collinoides, Lactobacillus paraplantarum, Streptococcus, Lactococcus, Propionibacterium, Propionibacterium acnes, Leuconostoc, Weissella, Aerococcus, Staphylococcus.

[0028] The bacteria of the genus Lactobacillus are selected from one or more of: Lactobacillus paracasei, Lactobacillus acidophilus, Lactobacillus brevis, Lactiplantibacillus plantarum, Lactobacillus jensenii, Lactobacillus iners, Lactobacillus casei, Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus johnsonii, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus sakei, Lactobacillus salivarius, or Lactobacillus bulgaricus.

[0029] The bacteria of the genus Bifidobacterium are selected from one or more of the following: Bifidobacterium animalis, Bifidobacterium bifidum, Bifidobacterium breve, Bifidobacterium infantis, Bifidobacterium longum, and Bifidobacterium adolescentis.

[0030] In certain embodiments of the present invention, the viable count of Lactiplantibacillus plantarum BD7807 in the starter culture is 10 8 ~10 9 cfu / ml.

[0031] The present invention also provides a starter culture, which contains the Lactiplantibacillus plantarum BD7807.

[0032] The present invention also provides the use of the starter culture in the preparation of cheese.

[0033] The Lactiplantibacillus plantarum BD7807 participates in the fermentation process as an active ingredient in the starter culture.

[0034] In certain embodiments of the present invention, the cheese obtained by preparing the starter culture has the following characteristics:

[0035] 1) Increase the water-holding capacity of the cheese;

[0036] 2) Improve the acid-producing ability of the cheese;

[0037] 3) Reduce the pH value of the cheese;

[0038] 4) Reduce the fat content in the cheese;

[0039] 5) Improve the taste richness of the cheese;

[0040] 6) Increase the viable count of bacteria in the cheese.

[0041] In certain embodiments of the present invention, the starter culture in the cheese includes Lactiplantibacillus plantarum BD7807 and Lactobacillus bulgaricus.

[0042] In a specific embodiment of the present invention, based on the volume of the raw milk, the inoculation volume of Lactiplantibacillus plantarum BD7807 is 2% - 6%.

[0043] In a specific embodiment of the present invention, based on the volume of the raw milk, the inoculation volume ratio of Lactiplantibacillus plantarum BD7807 to Lactobacillus bulgaricus is (1 - 3):1.

[0044] In certain embodiments of the present invention, the viable count of the bacteria in the cheese is 10 8 ~10 9 cfu / ml.

[0045] In certain embodiments of the present invention, the cheese further comprises an additive.

[0046] Those skilled in the art can select and adjust additional additives according to requirements. In certain embodiments, the additive is a nutrient.

[0047] In certain embodiments of the present invention, the additive can have a beneficial effect on the health of the host to which it is administered.

[0048] In certain embodiments of the present invention, the additive is a nutrient selected from one or more of dietary fiber, prebiotic, protein, lipid, mineral, vitamin or plant extract.

[0049] The mineral is selected from one or more of iron, zinc, potassium, sodium, calcium or magnesium.

[0050] In certain embodiments of the present invention, the vitamin is selected from any one or more of vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin A, vitamin C, vitamin D, vitamin E or vitamin K.

[0051] The present invention also provides the use of the starter in the preparation of food.

[0052] As used herein, the term "food" is used in a broad sense and includes human food and beverages, as well as animal food and beverages (i.e., feed). In certain embodiments, the food is suitable for and designed for human consumption.

[0053] In certain embodiments of the present invention, depending on the use, application method or administration method, the food is selected from liquid, solid or semi-solid forms.

[0054] In certain embodiments of the present invention, the food is a solid food, a liquid food or a semi-solid food.

[0055] The solid food can be gummy candy, lozenges or bacterial powder; the liquid food can be a beverage; the semi-solid food can be jelly.

[0056] In certain embodiments of the present invention, the food is a dietary supplement, a nutritional preparation, a functional food or a beverage product.

[0057] In certain embodiments of the present invention, the food is a dairy product; specifically, the dairy product is selected from yogurt, fermented milk with flavor, lactic acid bacteria beverage or cheese.

[0058] In certain embodiments of the present invention, the food is formulated for oral administration.

[0059] In certain embodiments of the present invention, the food is in the form of pills, powders, capsules, tablets, granules, film-coated agents, sachets or dragees.

[0060] In certain embodiments of the present invention, the food may further contain prebiotics. Generally speaking, prebiotics are non-digestible, and they cannot be decomposed and absorbed in the stomach or small intestine. Therefore, they can remain intact when reaching the colon through the stomach and small intestine.

[0061] In certain embodiments of the present invention, the food may further include one or any combination of the following substances: probiotics, dietary fiber, protein, carbohydrates, lipids, vitamins, minerals, plant components, amino acids, immunomodulators, milk substitutes, or metabolites or extracts of Lactiplantibacillus plantarum BD7807.

[0062] In certain embodiments of the present invention, the food may further contain a protein source. Specifically, the protein source is selected from one or more of animal protein, plant protein or a mixture of free amino acids.

[0063] In certain embodiments of the present invention, the food may further contain a fat source, and the lipid constituting the fat source can be any suitable fat or fat mixture. For example, it can be vegetable fat or animal fat.

[0064] In certain embodiments of the present invention, the food may further contain carbohydrates, such as sucrose, lactose, glucose, fructose, corn syrup solids, maltodextrin and their mixtures.

[0065] In certain embodiments of the present invention, the food may further contain dietary fiber; the dietary fiber can be from any suitable source, such as soybeans, peas, oats, pectin, guar gum, gum arabic, fructooligosaccharides, galactooligosaccharides, lactosialic acid and oligosaccharides derived from animal milk.

[0066] In certain embodiments of the present invention, the food may further include suitable vitamins and minerals, and these substances can be included in the food in appropriate amounts.

[0067] In certain embodiments of the present invention, Lactiplantibacillus plantarum BD7807 of the present invention can also be combined with acceptable excipients in foods such as different sweeteners or flavoring agents, colorants, stabilizers, glidants, fillers, etc.

[0068] In certain embodiments of the present invention, Lactiplantibacillus plantarum BD7807 exists in the form of a concentrate.

[0069] In certain embodiments, the viable count of Lactiplantibacillus plantarum BD7807 in the food is 1×10 9 cfu / ml.

[0070] The following specific examples illustrate the embodiments of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0071] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for the purpose of describing specific embodiments, rather than limiting the protection scope of the present invention; in the specification and claims of the present invention, unless otherwise clearly indicated in the text, the singular forms "a", "an", and "the" include the plural forms.

[0072] When the embodiments give a numerical range, it should be understood that unless otherwise specified in the present invention, both endpoints of each numerical range and any value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of the prior art and the description of the present invention, any methods, devices, and materials similar or equivalent to the methods, devices, and materials described in the embodiments of the present invention can also be used to implement the present invention.

[0073] Example 1 Isolation, screening and identification of Lactiplantibacillus plantarum BD7807

[0074] Samples were collected from fermented potherb mustard. 0.5 g of the sample was weighed and placed in 4.5 mL of sterile physiological saline, and it was evenly dispersed by shaking. Subsequently, 100 μL of the sample was taken for gradient dilution, and a suitable dilution gradient was selected, and the sample was evenly spread on an MRS agar plate. The plate was placed in an anaerobic environment and cultured at 37 °C for 40 hours.

[0075] After the cultivation was completed, single colonies were selected and subjected to Gram staining. The morphological characteristics of the colonies were observed under a microscope to preliminarily screen out strains suspected to be Lactiplantibacillus plantarum. These strains were repeatedly streaked and purified on MRS solid medium, and finally, purified Lactiplantibacillus plantarum strains were obtained and stored in glycerol tubes at -80 °C.

[0076] The formula of MRS medium is as follows: peptone 10 g, beef extract powder 5 g, yeast powder 5 g, glucose 20 g, anhydrous sodium acetate 5 g, diammonium citrate 2 g, Tween 80 1 mL, dipotassium hydrogen phosphate (K 2 HPO 4 )2 g, magnesium sulfate (MgSO 4 )0.2 g, manganese sulfate (MnSO 4 )0.05 g. Add 1000 mL of distilled water, adjust the pH value to 6.5, and then perform autoclaving at 120 °C for 30 minutes. For solid MRS medium, an additional 1.5 g of agar powder needs to be added.

[0077] 1.2 Identification of strains

[0078] Template preparation: Using the single colony of BD7807 as a template, its genomic DNA was extracted for subsequent PCR amplification.

[0079] PCR amplification: Universal bacterial primers 27F and 1492R were used for PCR amplification of 16S rDNA, and an appropriate amount of 2×Taq PCR Mix was added.

[0080] The PCR reaction system includes: 10×buffer 10 μL, 10 mM dNTP 2 μL, 1 μL each of the forward and reverse primers, 2 μL of DNA template, 0.5 μL of Taq enzyme, ddH 2 O 34.5 μL.

[0081] The PCR reaction conditions were set as follows: initial denaturation at 98 °C for 5 minutes; cycle amplification (94 °C for 30 seconds, 55 °C for 30 seconds, 72 °C for 90 seconds) for a total of 30 cycles; final extension at 72 °C for 5 minutes.

[0082] PCR product verification: The PCR products were verified by agarose gel electrophoresis.

[0083] Sequence analysis: The verified PCR products were sent to Shanghai Bioengineering Co., Ltd. for sequence analysis. The obtained 16S rDNA sequences were subjected to BLAST alignment in the NCBI database to determine their similarity with known species.

[0084] The sequence of the 16S rDNA of the Lactiplantibacillus plantarum BD7807 obtained by sequencing is as follows:

[0085] GGTCATGGACGAAGTCTGATGGAGCACGCCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAACTCTGTTGTTAAAGAAGAACATATCTGAGAGTAACTGTTCAGGTATTGACGGTATTTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATAA. The Gram-stained cell morphology of Lactiplantibacillus plantarum is as Figure 1 shown, and the strain phylogenetic tree is as Figure 2 shown.

[0086] Example 2 Application of Lactiplantibacillus plantarum BD7807 in cheese

[0087] 2.1 Preparation of starter cultures

[0088] In this experiment, different starter culture combinations and their inoculation ratios were used, as shown in Table 1 specifically.

[0089] Table 1 Preparation schemes of different starter cultures

[0090] starter combination method inoculation volume (%) number of viable bacteria (CFU) control group Lactobacillus bulgaricus 2 <![CDATA[2×10 8 > experimental group A Lactiplantibacillus plantarum BD7807: Lactobacillus bulgaricus 2:2 <![CDATA[4×10 8 :2×10 8 > experimental group B Lactiplantibacillus plantarum BD7807: Lactobacillus bulgaricus 4:2 <![CDATA[6×10 8 :2×10 8 > experimental group C Lactiplantibacillus plantarum BD7807: Lactobacillus bulgaricus 6:2 <![CDATA[8×10 8 :2×10 8 >

[0091] Note: The inoculation ratio of the starter culture is the percentage of the volume of the starter culture in the volume of skim milk based on the volume of raw milk.

[0092] 2.2 Process flow of probiotic cheese for regulating intestinal function

[0093] 1) Raw material preparation: Skim milk is used as the raw milk;

[0094] 2) Pasteurization: Heat the skim milk to 75 °C and hold for 20 s; quickly cool the dairy product to 42 °C after sterilization;

[0095] 3) Inoculation of starter culture: Inoculate the starter cultures with different combinations and inoculation ratios in Table 1 above into the sterilized skim milk respectively, and mix well to ensure that the starter culture is evenly distributed in the milk;

[0096] 4) Addition of rennet: After adding 30 mL / 100 kg of rennet to each group; perform shearing and stirring;

[0097] 5) Coagulation: Place the dairy product under the condition of 35 °C to solidify to form curds and whey;

[0098] 6) Draining of whey: After coagulation is completed, cut the curds into pieces and gently stir the curds to separate the whey from the curds;

[0099] 7) Pressing and ripening: Put the curd after separating whey into a mold and press it to form the basic shape of cheese; Transfer the pressed cheese to a condition of 12 °C and 85% humidity for ripening.

[0100] 2.3 Determination of physicochemical properties of cheese

[0101] 2.3.1 Determination of cheese components

[0102] Samples of each group of cheese were taken for determination: Use a pH meter to measure the pH value of each group of cheese, determine the moisture content in cheese according to the direct drying method in GB 5009.3-2016 of the national standard, determine the ash content in cheese according to the method in GB 5009.4-2016 of the national standard, determine the fat content in cheese according to the Soxhlet extraction method in GB 5009.6-2016 of the national standard, and determine the protein content in cheese according to the Kjeldahl method in GB 5009.5-2016 of the national standard. Each group was measured in parallel 3 times. The composition of the cheese is shown in Table 2.

[0103] Table 2 Composition of cheese

[0104] physical and chemical indexes control group experimental group A experimental group B experimental group C pH <![CDATA[5.37±0.03 a > <![CDATA[5.35±0.04 a > <![CDATA[5.22±0.05 b > <![CDATA[5.19±0.02 b > moisture (%) <![CDATA[42.09±0.42 c > <![CDATA[45.21±0.99 b > <![CDATA[46.11±0.88 b > <![CDATA[49.14±0.56 a > ash (%) <![CDATA[1.06±0.10 a > <![CDATA[1.11±0.15 a > <![CDATA[1.16±0.11 a > <![CDATA[1.27±0.15 a > fat (%) <![CDATA[31.82±0.62 a > <![CDATA[26.11±0.66 b > <![CDATA[25.48±0.51 b > <![CDATA[24.08±0.64 c > protein (%) <![CDATA[20.56±0.32 b > <![CDATA[21.45±0.90 ab > <![CDATA[21.84±0.15 a > <![CDATA[21.58±0.14 ab >

[0105] Note: Different letters represent significant differences between groups (p < 0.05).

[0106] As can be seen from Table 2, after adding Lactiplantibacillus plantarum BD7807 compared with the control group, the moisture content of each experimental group increased significantly (P < 0.05), and the moisture content of experimental group C was the highest, indicating that the combination of Lactobacillus bulgaricus and Lactiplantibacillus plantarum increased the water-holding capacity of cheese to a certain extent. Because the moisture content in the prepared cheese was relatively high, the strains could continue to produce acid under lower pH conditions, and the pH value of the experimental groups after adding Lactiplantibacillus plantarum BD7807 was also significantly lower than that of the control group (P < 0.05), indicating that the addition of Lactiplantibacillus plantarum BD7807 could promote the continuous fermentation and acid production of probiotics in cheese, resulting in a decrease in the pH value of cheese.

[0107] After adding Lactiplantibacillus plantarum BD7807, there was no significant change in the ash mass fraction in each group (P > 0.05), indicating that Lactiplantibacillus plantarum BD7807 had little effect on ash; however, compared with the control group, the ash mass fraction in experimental groups A, B, and C increased slightly. Previous studies have found that a decrease in fat content will lead to an increase in the total amount of some soluble minerals (such as calcium ions, calcium phosphate, and potassium ions), which may be the reason for the increase in ash mass fraction. Further analysis showed that after adding Lactiplantibacillus plantarum BD7807, the fat content in the experimental group decreased significantly (P < 0.05), because Lactiplantibacillus plantarum BD7807 consumed a part of the fat during growth.

[0108] 2.3.2 Microbiological indicators

[0109] Refer to the viable count method in the national standard GB 4789.35-2016, and use the plate dilution coating method to detect the viable count of bacteria in cheese; refer to the detection method of coliforms in the national standard GB 4789.3, and use the plate counting method to detect Escherichia coli in cheese; refer to the detection method of molds in the national standard GB 4789.15 to detect molds in cheese; refer to the detection method of pathogenic bacteria in the national standard GB 29921-2021 to detect pathogenic bacteria in cheese. The microbiological indicators of cheese are shown in Table 3.

[0110] Table 3 Microbiological indicators of each cheese

[0111] microbial indexes control group experimental group A experimental group B experimental group C number of viable bacteria / lg (CFU / mL) <![CDATA[7.89±0.05 c > <![CDATA[8.48±0.05 b > <![CDATA[8.73±0.05 ab > <![CDATA[8.94±0.05 a > Escherichia coli / (CFU / mL) ≤5 ≤5 ≤5 ≤5 mold ≤5 ≤5 ≤5 ≤5 pathogenic microorganism not detected not detected not detected not detected

[0112] Note: Different letters represent significant differences between groups (p<0.05).

[0113] As can be seen from Table 3, for the soft cheese prepared by adding Lactiplantibacillus plantarum BD7807, the content of microbiological indicators is reasonable and all meet the product quality and safety standards. In particular, the viable count in experimental group C is the highest.

[0114] 2.4 Cheese texture determination

[0115] The samples were cut into cubes of 2cm×2cm×1cm, and three parallel samples were made for each batch. The texture analyzer was used to measure in TPA mode. The measurement temperature was room temperature. Under this condition, the samples were measured. The specific test parameters were: pre-test speed 5mm / s, test speed 1mm / s, post-test speed 5mm / s. The probe model was TA36, and each treatment group was measured in parallel 3 times. The results are shown in Table 4.

[0116] Table 4 Differential analysis of cheese texture parameters in each group

[0117]

[0118]

[0119] Note: Different letters represent significant differences between groups (p<0.05).

[0120] As shown in Table 4, after adding Lactiplantibacillus plantarum BD7807 to each experimental group, the hardness, gumminess, and chewiness of the cheese decreased significantly (P<0.05), while the adhesiveness and elasticity increased significantly (P<0.05).

[0121] In summary, Lactiplantibacillus plantarum BD7807 has the function of reducing the fat content in cheese, and can form a softer gel with certain components in soft cheese, improving the cheese structure, changing the water-holding capacity, reducing the hardness, and maintaining the sensory quality while reducing the fat content. It can also bind to proteins to increase the elasticity of the cheese, and the cohesiveness in the experimental group is also lower than that in the control group (P<0.05), indicating that the cheese in the experimental group has a softer and smoother taste.

[0122] 2.5 Electronic tongue determination of cheese

[0123] Pretreat the samples. Weigh 2.5 g of cheese and put it into a beaker, grind it thoroughly, add 50 mL of distilled water, homogenize and ultrasonically treat it, and then centrifuge (10000 r / min, 15 min, 4 °C). Take the supernatant for filtration, pour it into a special cup for the electronic tongue, and wait for on-machine detection. Measure and analyze the taste of the cheese with different proportions of Lactiplantibacillus plantarum BD7807 added. The measurement results are as Figure 3 shown.

[0124] As Figure 3 can be seen, there is no significant difference in the response value to bitterness between the experimental group and the control group (P>0.05), indicating that Lactiplantibacillus plantarum BD7807 has little effect on the perception of bitterness in cheese; the response values of the experimental group to astringency are all lower than those of the control group, and there are significant differences (P<0.05), which indicates that the cheese made with the strains in the experimental group has less astringency than the control group. Among them, the response value of experimental group C to astringency is the lowest, and there are significant differences with other groups (P<0.05); compared with the control group, the response value of saltiness in the experimental group increases, which means that the strains in the experimental group increase the saltiness of the cheese and make its taste more intense; the response values of the experimental group to umami are all higher than those of the control group, and the differences are significant (P<0.05); the response values of aftertaste-A (astringent aftertaste) and aftertaste-B (bitter aftertaste) in the experimental group are all lower than those of the control group, and there are significant differences (P<0.05); richness is the fresh aftertaste, and the response values of richness in the experimental group are all higher than those of the control group, and there are significant differences (P<0.05), but the gap between each experimental group is small (P>0.05). There is partial overlap in the taste indexes of the experimental group in the radar chart of the growth process of Lactiplantibacillus plantarum, probably because the human senses cannot recognize the taste index with a response value <1. The radar chart detection results show that the compound probiotic preparations with different proportions in the experimental group have little effect on the taste of cheese.

[0125] In summary, compared with the control group, the experimental group had a decrease in the components of sour, astringent, and salty tastes, while an increase in salty, umami tastes and their aftertastes (richness). These results indicate that composite probiotic preparations with different proportions have a significant impact on the taste of cheese, especially in significantly reducing the astringent and bitter aftertastes. In addition, the improvement in umami taste and its aftertaste in the experimental group may contribute to the improvement of the overall taste and flavor of cheese.

[0126] 2.6 Sensory evaluation of cheese

[0127] The sensory evaluation personnel in this experiment consisted of 20 food professionals, who analyzed and determined the color and appearance, texture and consistency, and smell and taste of the cheese. Before each tasting, it was necessary to rinse the mouth with clean water. The sensory scoring items and standards are shown in Table 5, and the comparison of sensory evaluations between the control group and each experimental group is shown in Table 6.

[0128] Table 5 Sensory evaluation scoring form

[0129]

[0130] Table 6 Comparison of sensory evaluations between the control group and each experimental group

[0131]

[0132] Note: Different letters represent significant differences between groups (p < 0.05).

[0133] As shown in Table 6, the scores of experimental groups A, B, and C in terms of color and appearance, texture and consistency, and smell and taste were all higher than those of the control group. However, there were no significant differences among experimental groups A, B, and C. Generally speaking, the scores of experimental group C in terms of color and appearance, texture and consistency, and smell and taste were all higher than those of the other four groups. Moreover, there were significant differences in the texture state and smell of experimental group C compared with the control group (P < 0.05), indicating that after adding Lactiplantibacillus plantarum BD7807, the overall sensory quality of the cheese was significantly improved. The members of the sensory evaluation panel all stated that the cheese in the experimental group had a stronger milk fragrance and a richer taste than that in the control group. This may be because adding more Lactiplantibacillus plantarum BD7807 increased the metabolites that enhance the aroma, such as lactic acid propionate and lactic acid gluconic acid, thus improving the flavor and texture of the cheese product. On this basis, the cheese in experimental group C was in a more compact state, with increased elasticity, finer texture, and stronger milk fragrance. The improvement of these sensory characteristics further demonstrated the potential of Lactiplantibacillus plantarum BD7807 in enhancing the sensory quality of cheese.

[0134] 2.7 Result analysis

[0135] In summary, compared with the soft cheese added with only Lactobacillus bulgaricus, the fat content in the soft cheese added with Lactiplantibacillus plantarum BD7807 is significantly reduced, and the fat content in the cheese is the lowest when the addition amounts of Lactiplantibacillus plantarum BD7807 and Lactobacillus bulgaricus are 6% and 2% respectively, indicating that adding Lactiplantibacillus plantarum BD7807 can reduce the fat content in soft cheese. At the same time, the soft cheese added with Lactiplantibacillus plantarum BD7807 plays a certain role in improving the taste, increasing the taste level, making its texture more delicate, with a strong milk fragrance, reducing the hardness and chewiness, and increasing the elasticity and stickiness.

[0136] The above embodiments are intended to illustrate the implementation schemes disclosed in the present invention and should not be construed as limitations on the present invention. In addition, various modifications listed herein and changes in the methods of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of Lactobacillus plantarum BD7807 with a deposit number of CGMCC NO.33630 in preparing a starter.

2. The use according to claim 1, characterized in that The fermentation agent also includes other bacteria and / or fungi; preferably, the bacteria are selected from one or more of the genera Lactobacillus, Lactobacillus casei, Bifidobacterium, Lactobacillus mucosus, Lactobacillus plantarum, Lactobacillus unisomeris, Lactobacillus spp., Streptococcus, Lactococcus, Propionibacterium, Propionibacterium, Leuconostoc, Weizmannella, Zoococcus or Staphylococcus.

3. The use according to claim 1, characterized in that The viable count of BD7807 in the fermentation agent is 10 8 ~10 9 cfu / ml.

4. A leavening agent, characterized in that The fermentation agent contains Lactobacillus plantarum BD7807 with the deposit number of CGMCC NO.33630 as claimed in any one of claims 1 to 3.

5. Use of the starter culture as claimed in claim 4 in the preparation of cheese.

6. The use according to claim 5, characterized in that The starter in the cheese includes Lactobacillus plantarum BD7807 and Lactobacillus bulgaricus; preferably, based on the volume of the raw milk, the inoculation volume of Lactobacillus plantarum BD7807 is 2% to 6%; preferably, based on the volume of the raw milk, the inoculation volume ratio of Lactobacillus plantarum BD7807 to Lactobacillus bulgaricus is (1 to 3):

1.

7. The use according to claim 5, characterized in that The cheese prepared by the starter has the following characteristics: 1) Increase the water holding capacity of cheese; 2) Improve the acid production capacity of cheese; 3) Lower the pH of cheese; 4) Reduce the fat content in cheese; 5) Improve the taste of cheese; 6) Increase the number of live bacteria in cheese.

8. The use according to claim 5, characterized in that The number of viable bacteria in the cheese is 10 8 ~10 9 cfu / ml.

9. The use according to claim 5, characterized in that The cheese also includes additives; preferably, the additives are selected from one or more of dietary fiber, prebiotics, protein, lipids, minerals, vitamins or plant extracts.

10. Use of the starter as claimed in claim 4 in preparing food; preferably, the food is a dairy product; more preferably, the dairy product is selected from yogurt, flavored fermented milk, lactic acid bacteria beverage or cheese.

Images