Method for preparing compound loquat enzyme by combining dominant strains and application of compound loquat enzyme
Through the combined directional fermentation technology of dominant strains, compound loquat enzymes are prepared using loquat fruit and loquat leaves, which solves the problems of waste of resources and long fermentation cycles in traditional technologies, achieves the effects of high nutritional value and short fermentation time, and provides products with antibacterial function.
Patent Information
- Application Number
- CN202510127001.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-27
- Publication Date
- 2025-05-30
AI Technical Summary
The traditional loquat enzyme fermentation method cannot effectively utilize loquat leaves, resulting in waste of resources, long fermentation cycle and low utilization of product nutrients.
Directed fermentation is carried out by combining dominant strains, using loquat fruit and loquat leaves as the main raw materials, and by optimizing the culture medium system and fermentation process, the nutritional value of enzymes is improved and the fermentation cycle is shortened.
It effectively improves the nutritional value of loquat enzyme, shortens the fermentation time, reduces time cost, improves the quality and efficiency of the product, and provides loquat enzyme with pathogenic bacteria and antibacterial effects.
Smart Images

Figure BDA0005260148750000121 
Figure BDA0005260148750000122 
Figure BDA0005260148750000123
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial fermentation technology, and specifically relates to a preparation process of agricultural plant enzymes produced by directed fermentation of plant-based microorganisms, and in particular to a preparation method of loquat enzymes produced by directed fermentation of screened strains and its application. Background Art
[0002] The loquat, a small evergreen tree belonging to the genus Eriobotrya in the Rosaceae family, is native to China and has since been introduced to Japan, Pakistan, Israel, Spain, Madagascar, the United States, and other regions. In China, loquat is primarily found in Fujian, Sichuan, Zhejiang, Jiangsu, Guangdong, and southern Shaanxi. It prefers warm, humid environments and typically grows near villages, on flat land, or on slopes. Loquat is not only an excellent fruit tree but also a highly ornamental landscaping species. Its flesh is soft and juicy, with a moderate sweet and sour taste, and can be eaten raw, preserved, or used in winemaking. The leaves, flowers, and roots of the loquat are all used medicinally, with benefits such as clearing the lungs and soothing the stomach, and quenching thirst. The wood, which is reddish-brown, is used to make combs, walking sticks, and handles for agricultural tools.
[0003] Loquat and its leaves are reportedly rich in nutrients. Loquats are rich in sugars such as glucose, fructose, and sucrose; vitamins such as vitamin A, vitamin B, and vitamin C; carotene; protein, cellulose, pectin, iron, calcium, phosphorus; organic acids such as citric acid; and amygdalin. Loquat leaves are rich in volatile oils, triterpenoids such as ursolic acid, sesquiterpenes, flavonoids, polyphenols; organic acids such as malic acid; amygdalin; protein, cellulose, pectin, carotene, tannins, trace elements, vitamin B1, and vitamin C. Loquats are known to relieve coughs caused by pulmonary tuberculosis, chest tightness, and phlegm, making them suitable for those suffering from overwork, hematemesis, and scurvy. They can inhibit influenza viruses, prevent colds, clear lung and stomach heat, and reduce qi and resolve phlegm. They moisten the lungs, relieve coughs, and quench thirst. Loquat enzyme is a natural fruit enzyme. However, traditional loquat enzymes use loquat fruit as raw material, resulting in a large amount of loquat leaves wasted. This is mainly because traditional enzyme fermentation methods cannot utilize loquat leaves. In addition, traditional enzyme fermentation methods also have problems with long fermentation cycles and low utilization of product nutrients. Summary of the Invention
[0004] Therefore, the technical problem to be solved by the present invention is to provide a method for preparing a composite loquat enzyme by combining dominant strains. The loquat enzyme preparation method selects dominant strains for combined fermentation, which can effectively improve the nutritional value of loquat enzyme and shorten the fermentation cycle;
[0005] The second technical problem to be solved by the present invention is to provide a loquat enzyme with antibacterial effect on pathogenic bacteria.
[0006] To solve the above technical problems, the present invention provides a method for preparing a composite loquat enzyme by combining dominant strains, comprising the following steps:
[0007] (1) selecting a yeast strain for seed liquid culture to obtain a seed liquid;
[0008] (2) preparing a fermentation medium containing secondary loquat fruits and loquat leaves, and setting aside;
[0009] (3) inoculating the seed liquid into the fermentation medium for fermentation culture to obtain the product.
[0010] Specifically, in the method for preparing composite loquat enzyme by combining dominant strains, in the step (2), the fermentation medium includes the following components by mass: 25-35% of secondary loquat fruits, 2-10% of loquat leaves, 5-10% of brown sugar, and 0.001-0.5% of composite active enzyme.
[0011] Specifically, the method for preparing a composite loquat enzyme by combining dominant strains, wherein the composite active enzyme includes at least one of cellulase, pectinase or protease;
[0012] Preferably, the composite active enzyme comprises a combination of cellulase and pectinase.
[0013] Specifically, in the method for preparing a composite loquat enzyme by combining dominant strains, in step (3), the fermentation and cultivation step includes an aerobic fermentation stage and an anaerobic fermentation stage; wherein,
[0014] The aerobic fermentation stage includes the steps of performing intermittent aeration fermentation within 8-12 days after the start of fermentation;
[0015] The anaerobic fermentation stage includes the step of performing static fermentation within 8 to 35 days of fermentation.
[0016] Specifically, in the method for preparing composite loquat enzyme by combining dominant strains, in step (3), the inoculation ratio of the seed liquid is 5 to 50 wt%.
[0017] Specifically, the method for preparing a composite loquat enzyme by combining dominant strains, in step (3), further comprises the steps of collecting the fermentation product, filtering it, and collecting the supernatant.
[0018] Specifically, in the method for preparing a composite loquat enzyme by combining dominant strains, in the step (1), the yeast strain is the Pichia manshurica strain YA, which is classified and named Pichia manshurica YA, and has been deposited in the Guangdong Provincial Microbiological Culture Collection Center with a deposit number of GDMCC No. 65839 and a deposit date of January 21, 2025.
[0019] Specifically, the method for preparing a composite loquat enzyme by combining dominant strains, in the step (1), the culture medium of the seed liquid culture step comprises the following components by mass content: 25-35% of secondary loquat fruits, 2-10% of loquat leaves, 5-10% of brown sugar, and 0.001-0.5% of composite active enzyme;
[0020] The seed liquid culture step comprises: culturing at a temperature of 26 to 35° C. for 3 to 6 days.
[0021] The invention also discloses the composite loquat enzyme prepared by the method.
[0022] The present invention also discloses the use of the composite loquat enzyme in preparing a pathogenic bacteria inhibitor;
[0023] The pathogenic bacteria include Candida albicans, Malassezia furfur, Bacillus aeruginosa or Staphylococcus aureus.
[0024] The present invention also discloses a loquat enzyme fermentation dominant strain, which is the Pichia manshurica strain YA, which is classified and named Pichia manshurica YA. It has been deposited in the Guangdong Provincial Microbial Culture Collection Center with a deposit number of GDMCC No. 65839 and a deposit date of January 21, 2025.
[0025] As an practicable method, the present invention discloses a method for preparing a compound loquat enzyme using inferior loquats and loquat leaves, and a method for preparing the same. The method comprises the following steps:
[0026] Preparation of bacterial culture medium
[0027] Yeast powder, peptone, and glucose are mixed and stirred according to the YEPD medium formula. After adding water, mix thoroughly, adjust the pH, and sterilize by moist heat at 115°C for 20 minutes; this is used to culture yeast. The YEPD medium includes the following components by mass: 8-12g / L yeast powder, 18-22g / L peptone, 18-22g / L glucose, with the balance being water; pH 5.8-6.2. Preferably, the YEPD medium includes the following components by mass: 10g / L yeast powder, 20g / L peptone, 20g / L glucose, with the balance being water; pH 6.0.
[0028] Seed culture medium preparation
[0029] The seed culture medium comprises the following components by mass: 25-35% of secondary loquat fruits, 2-10% of loquat leaves, 5-15% of brown sugar, 0.001-0.5% of composite active enzyme, and the balance being water.
[0030] Preferably, the seed culture medium comprises the following components by mass: 30% of secondary loquat fruits, 5% of loquat leaves, 10% of brown sugar, 0.01% of cellulase, 0.01% of pectinase, and the balance is water.
[0031] Crushing the second-rate loquat fruits and loquat leaves: wash the second-rate cracked loquat fruits, dry them, chop them, add water in a ratio of 1:2 and crush them appropriately. Wash the loquat leaves, dry them, add a small amount of water and crush them appropriately using a wall-breaking machine.
[0032] According to the seed culture medium formula, the secondary loquat fruits, loquat leaves, brown sugar and compound active enzymes are mixed and stirred, and water is added and mixed evenly.
[0033] The composite active enzyme is a combination of cellulase, pectinase or protease, preferably a combination of cellulase and pectinase.
[0034] Fermentation medium preparation
[0035] The fermentation medium comprises the following components by mass: 25-35% of secondary loquat fruits, 2-10% of loquat leaves, 5-15% of brown sugar, 0.001-0.5% of composite active enzyme, and the balance being water.
[0036] Preferably, the fermentation medium comprises the following components by mass: 30% of secondary loquat fruits, 5% of loquat leaves, 10% of brown sugar, 0.01% of cellulase, 0.01% of pectinase, and the balance is water.
[0037] The composite active enzyme is composed of at least one of cellulase, pectinase or protease, preferably a combination of cellulase and pectinase.
[0038] Take the second-rate loquat fruits and loquat leaves and crush them: wash the second-rate cracked loquat fruits, dry them, chop them, add water in a ratio of 1:2 and grind them appropriately; wash the loquat leaves, dry them, add a small amount of water and grind them appropriately using a wall-breaking machine.
[0039] According to the fermentation medium formula, the loquat secondary fruits, loquat leaves, brown sugar and compound active enzyme are mixed and stirred, and water is added and mixed evenly.
[0040] Dominant bacterial culture
[0041] The dominant microorganism YA isolated from plant enzymes was inoculated into YEPD culture medium at 0.1-0.3% and cultured at 28°C for 20-40 hours.
[0042] The prepared dominant bacterial liquid is transferred into the seed culture medium at an inoculation rate of 0.1-5.0%, mixed well, and fermented continuously at 26-35° C. for 3-6 days to obtain the desired seed tank seed liquid.
[0043] The seed liquid is inoculated into the fermentation medium at a ratio of 5-50%, and intermittent aeration fermentation is carried out for the first 10 days, sterile air is introduced once every 2-3 days, and static fermentation is carried out in the middle and late stages, the fermentation temperature is 28-32° C., and the fermentation is terminated after 35 days to obtain loquat enzyme fermentation liquid.
[0044] The obtained fermentation liquid is filtered through plate and frame or membrane until it becomes clear and transparent to obtain loquat enzyme.
[0045] The method for preparing compound loquat enzyme by combining dominant strains described in the present invention optimizes the culture medium system, uses inferior loquats and loquat leaves as main raw materials, and utilizes screened dominant bacteria to carry out plant-based microbial directional fermentation and transformation to prepare loquat enzyme. This method can not only greatly shorten the fermentation time of loquat enzyme preparation, reduce time cost and improve efficiency; it also helps to improve the nutritional value of loquat enzyme.
[0046] The present invention provides a method for preparing a composite loquat enzyme by combining dominant strains, and provides a method for directing the fermentation of agricultural loquat enzymes by combining dominant strains. The loquat enzymes are fermented from loquat secondary fruits and loquat leaves as main raw materials through microbial fermentation. The loquat enzymes contain a variety of beneficial microbial flora, have strong fermentation and decomposition capabilities, and are rich in specific biologically active ingredients such as a variety of enzymes, organic acids, amino acids, polysaccharides, etc. The loquat enzymes are used as microbial fermentation fertilizers for agricultural ecological planting, and can provide crops with the enzyme system and sufficient nutrients required for growth, effectively increase crop yields, reduce crop susceptibility, and achieve the effects of reducing weight, reducing medication, improving quality, and increasing efficiency.
[0047] The method for preparing a composite loquat enzyme by combining dominant strains of the present invention provides a method for directing the fermentation of agricultural loquat enzymes by combining dominant strains, which not only quickly decomposes or converts abandoned crops to release a large amount of nutrients, turning waste into treasure, but also avoids environmental pollution caused by abandoned crops, achieving the effect of pollution control and emission reduction. At the same time, the fermentation time for loquat enzyme preparation is greatly shortened, reducing time cost and improving efficiency. The prepared loquat enzyme contains a variety of beneficial microbial flora and biologically active functional groups, has strong fermentation capacity and decomposition power, and has a good antibacterial effect. As a microbial fermentation fertilizer, it can be returned to the field and applied to agricultural ecological planting, which can provide the enzyme system and sufficient nutrients required for the growth of crops, better promote the proliferation of immune cells, effectively improve the body's disease resistance and immunity, increase crop yields, reduce the use of pesticides and chemical fertilizers, reduce the incidence of crop infection, and build a virtuous cycle of agricultural production ecology.
[0048] The method for preparing a composite loquat enzyme by combining dominant strains described in the present invention uses defective loquats and loquat leaves as main raw materials, utilizes screened dominant bacteria to carry out targeted and effective fermentation conversion of agricultural waste, and turns waste into treasure in an environmentally friendly way. The waste is then returned to the fields for agricultural ecological planting to replace pesticides and chemical fertilizers, achieving the green and low-carbon effects of reducing weight, reducing drugs, improving quality, and increasing efficiency, thereby realizing a benign ecological cycle model for waste utilization in agricultural production. DETAILED DESCRIPTION
[0049] In the following examples of the present invention, the dominant strain involved in loquat enzyme fermentation was screened by the present invention, and the 26SrDNA sequencing results after isolation and identification are as follows:
[0050] ACTGCGGAAGGATCATTACTGTGAATATAACTTCCACACATGCGTGAGCGCACAAAACACACAAACCGTGAGTATTTCTAGTCGAAAACAAAACAAAAAATACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCG GTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGAACTTTTGTTAAAGAAAGATCCAGAGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAATATATCATTGAGCTCGACCTCAGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA.
[0051] Based on the comprehensive morphological, cultural characteristics and genetic identification results, the isolated strain was classified and named Pichia manshurica YA. The strain has been deposited in the Guangdong Provincial Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, with the deposit number GDMCC No. 65839 and the deposit date of January 21, 2025.
[0052] In the following examples of the present invention, loquat enzyme was fermented based on the Pichia manshurica YA screened and identified above.
[0053] Example 1
[0054] In this example, loquat enzyme was prepared in a 10 L tank.
[0055] The preserved Pichia pastoris YA was cultured on a PDA slant medium at 28°C for 5 days to obtain a fresh YA slant.
[0056] Under sterile conditions, the bacterial moss on the fresh slant of the above-mentioned dominant bacteria was washed with NS, and 0.2% was added to a shake flask of YEPD culture medium. The culture was carried out at 28-32°C and a controlled speed of 150-200 r / min for 20-40 hours to obtain a shake flask dominant bacteria culture solution.
[0057] The YEPD culture medium is prepared by adding 10 g of yeast powder, 20 g of peptone, 20 g of grape brown sugar, and 1 L of tap water, and adjusting the pH value to 6.0.
[0058] The shake flask dominant bacteria culture solution is inoculated into a 5.0L seed tank culture medium at a 2% inoculum rate and cultured at 30°C for 5 days to obtain a seed expansion culture solution. The seed culture medium is prepared by: 900g of secondary loquat fruits, 30g of loquat leaves, 300g of brown sugar, 0.3g of cellulase, 0.3g of pectinase, and 3L of tap water. During the seed culture medium preparation process, the secondary cracked loquat fruits are washed, dried, and chopped, then crushed with water in a 1:2 ratio. The loquat leaves are washed, dried, and then crushed with a small amount of water using a wall-breaking machine. A selected amount of the composite active enzyme and brown sugar are then added, mixed, and made up with water to obtain the desired product.
[0059] The cultured seed culture solution was transferred into a 10L fermentation tank culture medium at a ratio of 30%, mixed well, and the fermentation temperature was 28-32°C. Intermittent aeration fermentation was performed for the first 10 days, and sterile air was introduced once every 2-3 days. The fermentation was allowed to stand in the middle and late stages, and the fermentation was terminated after 35 days to obtain the enzyme fermentation solution.
[0060] In this embodiment, the fermentation medium is prepared as follows: 1800 g of secondary loquat fruit, 300 g of loquat leaves, 600 g of brown sugar, 0.6 g of cellulase, 0.6 g of pectinase, and 6 L of tap water. The fermentation medium is prepared in the same manner as the seed culture medium.
[0061] The obtained fermentation liquid is filtered through a Ban filter until it is clear and transparent, and then packaged to obtain the composite loquat enzyme.
[0062] Comparative Example 1
[0063] The preparation method of the loquat enzyme in this comparative example is the same as that in Example 1, the only difference being that the YA strain, the loquat leaves and the composite active enzyme are not added to the seed propagation and fermentation medium.
[0064] Wash the second-cracked loquat fruits, dry them and chop them into pieces. Then, prepare a fermentation medium in a 10L tank with 1800g of second-cracked loquat fruits, 600g of brown sugar and 6L of tap water in proportion. Mix them well and let them stand for fermentation at a temperature of 28-32°C and a pH of 3.0-3.5. The fermentation lasts for 3 months to obtain an enzyme fermentation liquid.
[0065] The obtained fermentation liquid is filtered through a Ban filter and then packaged to obtain loquat enzyme.
[0066] The enzymes obtained after the fermentation in the 10 L tanks in Example 1 and Comparative Example 1 were respectively taken and their relevant physicochemical properties and antioxidant activities were measured. The results are shown in Table 1.
[0067] Table 1 Comparison of physicochemical properties and antioxidant activity of 10L fermentation enzymes in the embodiment and the comparative example
[0068] project Example 1 Comparative Example 1 pH 3.32 3.26 Total acid 12.63 12.31 Organic acid / g / L 6.89 5.80 Organic matter / g / L 6.58 6.03 Effective viable bacteria count / cfu / mL <![CDATA[3.66*10 10 ]]> <![CDATA[2.08*10 8 ]]> Polysaccharide / g / L 67.6 31.3 β-glucanase activity / U / L <![CDATA[3.68*10 3 ]]> <![CDATA[3.43*10 3 ]]> Protease activity / U / L <![CDATA[9.37*10 4 ]]> <![CDATA[8.02*10 3 ]]> Polyphenols / g / L 0.56 0.42 ABTS free radical scavenging rate / % 53.8 40.5
[0069] As shown in Table 1, the test results show that the physical and chemical properties of the compound loquat enzyme prepared in this embodiment and the loquat enzyme prepared by conventional fermentation in the comparative example meet the requirements of the plant enzyme industry standards, and the physical and chemical properties and antioxidant activity of the compound loquat enzyme are significantly better than those of the conventionally prepared loquat enzyme, with better quality, better promotion of immune cell proliferation, and improvement of the body's own immunity. In addition, the fermentation time of the embodiment is only 35 days, while the fermentation time of the conventional preparation is 90 days, which greatly shortens the fermentation time.
[0070] Example 2
[0071] In this example, loquat enzyme was prepared in a 100 L tank.
[0072] The dominant microorganism YA was cultured on PDA slant medium at 28°C for 5 days to obtain fresh YA slant.
[0073] Under sterile conditions, the dominant bacterial moss on the fresh slant was washed with NS and inoculated into a shake flask containing the YEPD medium at a concentration of 0.2%. The culture was then incubated at 28-32°C at a controlled rotation speed of 150-200 r / min for 20-40 hours to obtain a shake flask culture of the dominant bacteria. The YEPD medium was prepared as follows: 10 g yeast powder, 20 g peptone, 20 g glucose, and 1 L tap water, adjusted to pH 6.0.
[0074] The shake flask dominant bacteria culture was inoculated into a 50 L seed tank medium at a 2% inoculum rate and incubated at 30°C for 5 days to obtain a seed expansion medium. The seed culture medium was prepared as follows: 6 kg of secondary loquat fruits, 1000 g of loquat leaves, 2 kg of brown sugar, 2 g of cellulase, 2 g of pectinase, and 20 L of tap water. The seed culture medium preparation method was the same as in Example 1.
[0075] The cultured seed culture solution was transferred to a 100L fermentation tank culture medium at a ratio of 25%, mixed well, fermented at a temperature of 30°C, and fermented intermittently for 10 days, with sterile air introduced once every 2 to 3 days. The fermentation was allowed to stand in the middle and late stages and the fermentation was terminated after 35 days to obtain an enzyme fermentation liquid. The fermentation medium was prepared as follows: 18kg of secondary loquat fruits, 3kg of loquat leaves, 6kg of brown sugar, 6g of cellulase, 6g of pectinase, and 60L of tap water. The specific preparation method was the same as in Example 1.
[0076] The obtained fermentation liquid is filtered through plate and frame and membrane until it is clear and transparent, and then packaged to obtain the composite loquat enzyme.
[0077] Comparative Example 2
[0078] The preparation method of the loquat enzyme in this comparative example is the same as that in Example 2, the only difference being that the YA strain, the loquat leaves and the composite active enzyme are not added to the seed propagation and fermentation medium.
[0079] Wash the second-cracked loquat fruits, dry them and chop them into pieces. Then, prepare a fermentation medium with 18 kg of second-cracked loquat fruits, 6 kg of brown sugar and 60 L of tap water in a 100 L tank according to the proportion. Mix them well and let them stand for fermentation at a temperature of 28-32 ° C. The fermentation is terminated after 3 months to obtain an enzyme fermentation liquid.
[0080] The obtained fermentation liquid is filtered through plate and frame and membrane until it is clear and transparent, and then packaged to obtain loquat enzyme.
[0081] The physicochemical properties and antioxidant activities of the enzymes obtained after the termination of the 100 L tank fermentation in Example 2 and Comparative Example 2 were measured, and the results are shown in Table 2.
[0082] Table 2 Comparison of physicochemical properties and antioxidant activity of 100L tank fermentation enzymes in the examples and comparative examples
[0083] project Example 2 Comparative Example 2 pH 3.35 3.31 Total acid 12.69 12.42 Organic acid / g / L 6.80 5.97 Organic matter / g / L 6.58 6.03 Effective viable bacteria count / cfu / mL <![CDATA[3.81*10 10 ]]> <![CDATA[2.20*10 8 ]]> Polysaccharide / g / L 65.9 30.6 β-glucanase activity / U / L <![CDATA[3.85*10 3 ]]> <![CDATA[3.24*10 3 ]]> Protease activity / U / L <![CDATA[9.13*10 4 ]]> <![CDATA[7.80*10 3 ]]> Polyphenols / g / L 0.58 0.46 ABTS free radical scavenging rate / % 55.7 40.1
[0084] As shown in Table 2, the test results show that the physicochemical properties and antioxidant activity of the composite loquat enzyme prepared in this embodiment are significantly better than those of the loquat enzyme prepared by conventional fermentation in the comparative example, and the quality is better. In addition, the fermentation time of the embodiment is only 35 days, while the fermentation time of the conventional preparation is 90 days, which greatly shortens the fermentation time. Therefore, it is proved that the preparation method of the present invention is significantly better than the conventional preparation.
[0085] Example 3
[0086] In this embodiment, 1 t tank of loquat enzyme was prepared.
[0087] The dominant microorganism YA was cultured on PDA slant medium at 28°C for 5 days to obtain fresh YA slant.
[0088] Under sterile conditions, the dominant bacterial moss on the fresh slant was washed with NS and inoculated into a shake flask containing the YEPD medium at a concentration of 0.2%. The culture was then incubated at 28-32°C at a controlled rotation speed of 150-200 r / min for 20-40 hours to obtain a shake flask culture of the dominant bacteria. The YEPD medium was prepared as follows: 30 g of yeast powder, 60 g of peptone, 60 g of glucose, and 3 L of tap water, adjusted to a pH of 6.0.
[0089] The shake flask dominant bacteria culture solution was inoculated into a 200 L seed tank culture medium at a 2% inoculum rate and incubated at 30°C for 5 days to obtain a seed expansion culture solution. The seed culture medium was prepared as follows: 36 kg of secondary loquat fruits, 6 kg of loquat leaves, 12 kg of brown sugar, 12 g of cellulase, 12 g of pectinase, and 120 L of tap water. The specific preparation method is the same as in Example 1.
[0090] The cultured seed culture solution was transferred to a 100L fermentation tank medium at a ratio of 20%, and intermittent aeration fermentation was performed for the first 10 days, with sterile air introduced once every 2 to 3 days. The fermentation was allowed to stand for 35 days, and the fermentation was terminated to obtain an enzyme fermentation liquid. The fermentation medium was prepared as follows: 180kg of secondary loquat fruits, 6kg of loquat leaves, 60kg of brown sugar, 60g of cellulase, 60g of pectinase, and 600L of tap water. The specific preparation method was the same as in Example 1.
[0091] The obtained fermentation liquid is filtered through plate and frame and membrane until it is clear and transparent, and then packaged to obtain the composite loquat enzyme.
[0092] Comparative Example 3
[0093] The preparation method of the loquat enzyme in this comparative example is the same as that in Example 2, the only difference being that the YA strain, the loquat leaves and the composite active enzyme are not added to the seed propagation and fermentation medium.
[0094] Wash the second-cracked loquat fruits, dry them and chop them into pieces, and then prepare a fermentation medium with 180 kg of second-cracked loquat fruits, 60 kg of brown sugar and 600 L of tap water in a 1 t tank according to the proportion. Mix them well and let them stand for fermentation at a temperature of 28-32° C. The fermentation is terminated after 3 months to obtain an enzyme fermentation liquid.
[0095] The obtained fermentation liquid is filtered through plate and frame and membrane until it is clear and transparent, and then packaged to obtain loquat enzyme.
[0096] The physicochemical properties and antioxidant activities of the enzymes obtained after the fermentation in Example 3 and Comparative Example 3 were measured, and the results are shown in Table 3.
[0097] Table 3 Comparison of physical and chemical properties and antioxidant activity of fermentation enzymes in Example 1t tank and Comparative Example
[0098] project Example 3 Comparative Example 3 pH 3.31 3.35 Total acid 12.35 11.96 Organic acid / g / L 6.72 5.80 Organic matter / g / L 6.36 6.16 Effective viable bacteria count / cfu / mL <![CDATA[3.93*10 10 ]]> <![CDATA[2.36*10 8 ]]> Polysaccharide / g / L 65.3 31.5 β-glucanase activity / U / L <![CDATA[3.76*10 3 ]]> <![CDATA[3.34*10 3 ]]> Protease activity / U / L <![CDATA[9.42*10 4 ]]> <![CDATA[8.07*10 3 ]]> Polyphenols / g / L 0.61 0.50 ABTS free radical scavenging rate / % 52.9 42.8
[0099] The results shown in Table 3 above show that the fermentation time in this embodiment is only 35 days, while the fermentation time for conventional preparation is 90 days, which greatly shortens the fermentation time. In addition, the physical and chemical properties and antioxidant activity of the composite loquat enzyme prepared in this embodiment are significantly better than those of the loquat enzyme prepared by conventional fermentation in the control example, and the quality is better, which further proves that the preparation method of the present invention is better than the conventional preparation.
[0100] Example 4
[0101] This example verifies the antibacterial effect of the compound loquat enzyme on pathogenic bacteria.
[0102] The composite loquat enzyme prepared by fermentation in Example 3 and the loquat enzyme prepared by fermentation in Comparative Example 3 were used as research objects, Candida albicans (ATCC10231), Malassezia furfur (ATCC44344), Bacillus aeruginosa (ATCC9027) and Staphylococcus aureus (ATCC25923) were used as target detection bacteria, and their antibacterial activity was determined. The results are shown in Tables 4 to 7, respectively.
[0103] Table 4 Comparison of the antibacterial activity of fermentation enzymes against Candida albicans in the examples and comparative examples
[0104]
[0105] Table 5 Comparison of the antibacterial activity of fermentation enzymes against Malassezia furfur between the embodiment and the comparative example
[0106]
[0107] Table 6 Comparison of the antibacterial activity of fermentation enzymes against Bacillus aeruginosa in Examples and Comparative Examples
[0108]
[0109] Table 7 Comparison of the antibacterial activity of fermentation enzymes against Staphylococcus aureus in Examples and Comparative Examples
[0110]
[0111] The above results show that enzymes of different concentrations have a certain inhibitory effect on the fungi Candida albicans, Malassezia furfur, Gram-positive bacteria Staphylococcus aureus, and Gram-negative bacteria Bacillus aeruginosa. The higher the enzyme content, the better the antibacterial effect. The antibacterial activity of the compound loquat enzyme in the example is significantly higher than that of the loquat enzyme in the comparison example. Among them, the compound loquat enzyme has the best inhibitory effect on Bacillus aeruginosa in the antibacterial effect of bacteria. The antibacterial rate of 10% compound grapefruit enzyme is as high as 97%. In the antibacterial effect of fungi, the inhibitory effect on Malassezia furfur is better than that on Candida albicans. The antibacterial rate of 50% compound loquat enzyme is as high as 97%, and the antibacterial rate on Candida albicans fungi is about 80%.
[0112] It can be seen that this example confirmed that the compound loquat enzyme has a certain inhibitory effect on fungi and bacteria through the detection of antibacterial activity, and has stronger antibacterial activity than the conventionally prepared grapefruit enzyme.
[0113] In summary, the present invention provides a method for preparing agricultural plant enzymes through microbial directed fermentation. The loquat enzyme preparation process is simple, the preparation and fermentation time is short, the product quality is stable, and it can be applied to its industrial production.
[0114] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.
Claims
1. A method for preparing a composite loquat enzyme by combining dominant strains, characterized in that: The steps include: (1) selecting a yeast strain for seed liquid culture to obtain a seed liquid; (2) preparing a fermentation medium containing secondary loquat fruits and loquat leaves for later use; (3) inoculating the seed liquid into the fermentation medium for fermentation culture to obtain the product.
2. The method for preparing a composite loquat enzyme by combining dominant strains according to claim 1, characterized in that: In the step (2), the fermentation medium comprises the following components in mass content: 25-35% of secondary loquat fruits, 2-10% of loquat leaves, 5-10% of brown sugar, and 0.001-0.5% of composite active enzyme.
3. The method for preparing a composite loquat enzyme by combining dominant strains according to claim 1 or 2, characterized in that: The composite active enzyme includes at least one of cellulase, pectinase or protease; Preferably, the composite active enzyme comprises a combination of cellulase and pectinase.
4. The method for preparing a composite loquat enzyme by combining dominant strains according to any one of claims 1 to 3, characterized in that: In step (3), the fermentation culture step includes an aerobic fermentation stage and an anaerobic fermentation stage; wherein, The aerobic fermentation stage includes the step of performing intermittent aeration fermentation within 8-12 days after the start of fermentation; The anaerobic fermentation stage includes the step of static fermentation within 8 to 35 days of fermentation.
5. The method for preparing a composite loquat enzyme by combining dominant strains according to any one of claims 1 to 4, characterized in that: In the step (3), the inoculation ratio of the seed solution is 5 to 50 wt %.
6. The method for preparing a composite loquat enzyme by combining dominant strains according to any one of claims 1 to 5, characterized in that: The step (3) also includes collecting the fermentation product, filtering it and collecting the supernatant.
7. The method for preparing a composite loquat enzyme by combining dominant strains according to any one of claims 1 to 6, characterized in that: In the step (1), the yeast strain is the Pichia manshurica strain YA, which is classified and named Pichia manshurica YA, and has been deposited in the Guangdong Microbiological Culture Collection Center with a deposit number of GDMCC No. 65839 and a deposit date of January 21, 2025.
8. The method for preparing a composite loquat enzyme by combining dominant strains according to any one of claims 1 to 7, characterized in that: In the step (1), the culture medium of the seed liquid culture step comprises the following components by mass content: 25-35% of secondary loquat fruit, 2-10% of loquat leaves, 5-10% of brown sugar, and 0.001-0.5% of composite active enzyme; The seed solution culture step comprises: a culture temperature of 26 to 35° C. and a culture time of 3 to 6 days.
9. The composite loquat enzyme prepared according to the method according to any one of claims 1 to 8.
10. Use of the composite loquat enzyme according to claim 9 for preparing an antibacterial agent for pathogenic bacteria; The pathogenic bacteria include Candida albicans, Malassezia furfur, Bacillus aeruginosa or Staphylococcus aureus.
Citation Information
Cited By
Bread with loquat as raw material and making method of bread
CN121014700A