Therapeutic use of bladder cancer

Abstract

The invention relates to application of bladder cancer treatment. In particular to application of SGS2 protein or functional variants thereof, nucleic acid molecules for coding the SGS2 protein, nucleic acid constructs for coding the SGS2 protein or the functional variants thereof, and / or viruses for coding the SGS2 protein or the functional variants thereof in preparation of medicines for killing bladder cancer cells or treating bladder cancer.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and the treatment of bladder cancer. More specifically, it relates to the application of SGS2 protein in plants in the preparation of drugs for treating bladder cancer. Background Art

[0002] Bladder cancer is one of the most common malignant tumors in the urinary system. Worldwide, the incidence rate of bladder cancer ranks 9th among malignant tumors, 7th among male malignant tumors (9.50 / 100,000), and 10th among female malignant tumors (2.41 / 100,000); the mortality rate ranks 13th among malignant tumors, with a male mortality rate of (3.2 / 100,000) and a female mortality rate of (0.9 / 100,000).

[0003] Bladder cancer is one of the malignant tumors that seriously threaten the health of the people. According to the data released by the National Cancer Registry Center in 2019: In 2015, the incidence rate of bladder cancer in China was 5.80 / 100,000, ranking 13th among all malignant tumors in the body, with a male incidence rate of 8.83 / 100,000, ranking 7th. The female incidence rate was 2.61 / 100,000, ranking 17th. In 2015, the mortality rate of bladder cancer in China was 2.37 / 100,000, ranking 13th, with a male mortality rate of 3.56 / 100,000, ranking 11th. The female mortality rate was 1.11 / 100,000, ranking 16th.

[0004] The global market size of the bladder cancer treatment industry has been continuously growing in recent years and is expected to reach approximately $9 billion in 2025. The market size of the bladder cancer treatment industry in China is growing rapidly and is expected to reach approximately 7.7 billion yuan in 2025.

[0005] The standard treatment methods for bladder cancer mainly include surgical treatment, chemotherapy, radiotherapy, immunotherapy, etc. Although the proportion of patients with standard treatment failure varies in different studies, the overall treatment failure rate is about 30 - 50%. Existing treatment methods cannot well solve the threat of cancer to human life, and there is an urgent need for emerging treatment methods to provide new alternative solutions and more effective treatment methods for patients who are non-responsive or have relapsed to BCG. Summary of the Invention

[0006] The first aspect of the present invention provides a nucleic acid construct for expressing the SGS2 protein or its functional variant of a plant in animal cells.

[0007] In one or more embodiments, the amino acid sequence of the SGS2 protein is any one of the sequences shown in SEQ ID NO: 1 - 11, or a functional variant having at least 80% sequence identity with any one of the sequences shown in SEQ ID NO: 1 - 11.

[0008] In one or more embodiments, the plant includes: Medicago truncatula, cotton, Arabidopsis thaliana, Nicotiana benthamiana, tobacco, Nicotiana glutinosa, tomato, maize, rice, barley, Physcomitrella patens; preferably, the plant is Arabidopsis thaliana, tobacco, rice; more preferably, the plant is Arabidopsis thaliana.

[0009] In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of an RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.

[0010] In one or more embodiments, the nucleic acid sequence encoding the SGS2 protein is shown as any one of SEQ ID NOs: 12-22. Preferably, the nucleic acid sequence encoding the SGS2 protein is shown as SEQ ID NO: 14. In one or more embodiments, the nucleic acid sequence encoding the functional variant of the SGS2 protein is shown as SEQ ID NO: 23.

[0011] In one or more embodiments, the nucleic acid construct is mRNA and contains a promoter and polyA.

[0012] In one or more embodiments, the nucleic acid construct is a vector, preferably a viral vector.

[0013] The present invention also provides a virus comprising a polynucleotide sequence encoding the SGS2 protein or its functional variant, or a virus comprising the nucleic acid construct described herein.

[0014] In one or more embodiments, the virus comprises:

[0015] (1) a nucleic acid sequence encoding the SGS2 protein or its functional variant, wherein the amino acid sequence of the SGS2 protein is shown as any one of SEQ ID NOs: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NOs: 1-11, or

[0016] (2) a nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or its functional variant shown in SEQ ID NOs: 1-11, or

[0017] (3) the reverse complementary sequence of (1) or (2).

[0018] In one or more embodiments, the virus comprises the nucleic acid construct described in any one of the embodiments herein.

[0019] In one or more embodiments, the virus includes adeno-associated virus, adenovirus, retrovirus. Preferably, the virus is an oncolytic adenovirus.

[0020] The present invention also provides a cell comprising a polynucleotide sequence encoding the SGS2 protein or a functional variant thereof, or a cell comprising the nucleic acid construct described herein.

[0021] In one or more embodiments, the cell:

[0022] (1) comprises, expresses, and / or secretes the SGS2 protein or a variant having at least 80% sequence identity therewith and retaining function, wherein the amino acid sequence of the SGS2 protein is shown in any one of SEQ ID NO: 1-11,

[0023] (2) comprises the following sequences: i) a nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is shown in any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11, ii) a nucleic acid sequence having at least 80% sequence identity with i) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, and / or, iii) the reverse complementary sequence of i) or ii),

[0024] (3) comprises the nucleic acid construct described in any embodiment herein,

[0025] (4) comprises the virus described in any embodiment herein.

[0026] In one or more embodiments, the cell is used for preparing an oncolytic adenovirus.

[0027] In one or more embodiments, the nucleic acid construct is a vector.

[0028] In one or more embodiments, the vector is a cloning vector, an integrating vector, or an expression vector.

[0029] In one or more embodiments, the vector is a viral vector, preferably, the vector is an oncolytic adenovirus vector.

[0030] In one or more embodiments, the cell is a HEK-293 cell, including one or more selected from HEK-293T, HEK-293H, HEK-293F, HEK-293S, HEK-293T / 17, HEK-293T / 17SF, HEK-293FT, HEK-293SG, HEK-293E, HEK-293-6E, HEK-293FTM, HEK-293SGGD cells.

[0031] The present invention also provides a pharmaceutical composition, comprising a pharmaceutically acceptable excipient and an active ingredient, and the active ingredient includes: SGS2 protein or its functional variant, a nucleic acid molecule encoding the same, the nucleic acid construct according to any one of the embodiments herein, the virus according to any one of the embodiments herein, and / or the cell according to any one of the embodiments herein.

[0032] In one or more embodiments, the pharmaceutical composition further comprises a delivery system for delivering the active ingredient.

[0033] In one or more embodiments, the delivery system is a viral vector or a non-viral vector; preferably, the viral vector includes adeno-associated virus, adenovirus, retrovirus, and preferably, the non-viral vector includes plasmid, lipidoid, liposome, cationic polymer, lipid nanoparticle (LNP), multifunctional envelope-type nanocarrier, polymeric compound, peptide, protein, cell, nanoparticle mimetic, nanotube, conjugate vesicle, N-acetylgalactosamine (GalNAc) or engineered bacteria; more preferably, the delivery system is adenovirus; more preferably, the delivery system is oncolytic adenovirus.

[0034] In one or more embodiments, the amino acid sequence of the SGS2 protein is shown as any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11.

[0035] In one or more embodiments, the nucleic acid molecule has: (1) a nucleic acid sequence encoding SGS2 protein or its functional variant, or (2) a nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or its functional variant shown in SEQ ID NO: 1-11, or (3) the reverse complementary sequence of (1) or (2).

[0036] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or its functional variant is shown as any one of SEQ ID NO: 12-23, or has at least 80% sequence identity therewith.

[0037] In one or more embodiments, the pharmaceutical composition is used for treating tumors or killing tumor cells. In one or more embodiments, the tumor is bladder cancer.

[0038] The present invention also provides the use of a reagent in the preparation of a drug for killing tumor cells or treating tumors, and the reagent comprises: SGS2 protein or its functional variant, a nucleic acid molecule encoding the same, the nucleic acid construct according to any one of the embodiments herein, the virus according to any one of the embodiments herein, and / or the cell according to any one of the embodiments herein.

[0039] In one or more embodiments, the plant includes: Medicago truncatula, cotton, Arabidopsis thaliana, Nicotiana benthamiana, tobacco, Nicotiana glutinosa, tomato, corn, rice, barley, Physcomitrella patens; preferably, the plant is Arabidopsis thaliana, tobacco, rice; more preferably, the plant is Arabidopsis thaliana.

[0040] In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of an RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.

[0041] In one or more embodiments, the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11.

[0042] In one or more embodiments, the nucleic acid molecule has: (1) a nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, or (2) a nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or (3) the reverse complementary sequence of (1) or (2).

[0043] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in any one of SEQ ID NO: 12-23, or has at least 80% sequence identity therewith.

[0044] In one or more embodiments, the reagent or drug comprises a delivery system for delivering an active ingredient.

[0045] In one or more embodiments, the delivery system is a viral vector or a non-viral vector; preferably, the viral vector includes adeno-associated virus, adenovirus, retrovirus, preferably, the non-viral vector includes plasmid, lipidoid, liposome, cationic polymer, lipid nanoparticle (LNP), multifunctional envelope-type nano carrier, polymeric compound, peptide, protein, cell, nanoparticle mimetic, nanotube, conjugate vesicle, N-acetylgalactosamine (GalNAc) or engineered bacteria; more preferably, the delivery system is adenovirus; more preferably, the delivery system is oncolytic adenovirus.

[0046] In one or more embodiments, the nucleic acid molecule or the nucleic acid construct is loaded in the delivery system.

[0047] In one or more embodiments, the nucleic acid construct contains at least one expression regulatory element, and the nucleic acid molecule encoding the SGS2 protein or a functional variant thereof is operably linked to the expression regulatory element.

[0048] In one or more embodiments, the tumor is bladder cancer.

[0049] In one or more embodiments, the tumor is of animal origin.

[0050] The present invention also provides a method for preparing an oncolytic adenovirus comprising a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, the method comprising the steps of:

[0051] (1) Constructing a plasmid comprising the SGS2 gene,

[0052] (2) Preparing a virus comprising the plasmid of (1).

[0053] The present invention also provides a method for treating or preventing a disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of an SGS2 protein or a functional variant thereof, a nucleic acid molecule encoding the same, a nucleic acid construct according to any one of the embodiments herein, a virus according to any one of the embodiments herein, a cell according to any one of the embodiments herein, and / or a pharmaceutical composition according to any one of the embodiments herein.

[0054] In one or more embodiments, the SGS2 protein or a functional variant thereof is from a plant, preferably, the plant includes Medicago truncatula, cotton, Arabidopsis thaliana, Nicotiana benthamiana, Nicotiana tabacum, Nicotiana glutinosa, tomato, maize, rice, barley, Physcomitrella patens, more preferably, the plant is Arabidopsis thaliana, Nicotiana tabacum, rice.

[0055] In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of an RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.

[0056] In one or more embodiments, the amino acid sequence of the SGS2 protein is any one of the sequences shown in SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of the sequences shown in SEQ ID NO: 1-11.

[0057] In one or more embodiments, the nucleic acid molecule has: (1) a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, or (2) a nucleic acid sequence having at least 80% sequence identity with (1) and encoding an SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or (3) the reverse complementary sequence of (1) or (2).

[0058] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is any one of those shown in SEQ ID NO: 12-23, or has at least 80% sequence identity therewith.

[0059] In one or more embodiments, the disease or disorder is cancer. Preferably, the cancer is bladder cancer.

[0060] Advantages of the present invention: Expression of the plant SGS2 protein, or a functional variant thereof, or a nucleic acid construct thereof in animal cells exhibits good safety and tumor suppression effect against bladder cancer both at the in vitro cell level and in tumor-bearing animals, and has broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figures 1A to 1B Shows the results of bioinformatics analysis of the SGS2 protein sequence. Figure 1A Shows the amino acid sequences of 11 plant SGS2 proteins and the results of their conservation analysis, where * represents a conserved sequence, : represents a conservative mutation, · represents a semi-conservative mutation, and - represents a gap. Figure 1B Shows that the sequences of the functional domains RdRP and RRM of various plant SGS2 proteins are highly conserved.

[0062] Figures 2A to 2C Shows the plasmid construction schematic diagrams of recombinant viruses with different structures. Figure 2A Schematic diagram of plasmid construction of H37195 for virus E9272; Figure 2B Schematic diagram of plasmid construction of H37196 for virus E9273; Figure 2C Schematic diagram of plasmid construction of H37197 for virus E9274.

[0063] Figure 3 Shows the detection graphs of different virus titers.

[0064] Figure 4A Shows the melting curves of the reference gene and the transgene after different viruses infect cells. Figure 4B Shows the mRNA expression level of SGS2 after different viruses infect cells. The data in the figure represent the average relative expression level of the exogenous gene inside and outside the group, and the error bars represent the standard error of the mean (SEM), n = 3.

[0065] Figure 5 Shows the half-maximal inhibitory concentration of different oncolytic viruses on cells. That is, the IC50 detection results of different types of viruses on various types of cells. The data in the figure represent the average cell viability rate within the group, and the error bars represent the standard error of the mean (SEM), n = 3.

[0066] Figure 6A Shows the standard curve graph of virus genome copy number. Figure 6BShows the proliferation of oncolytic viruses E9272 and E9273 on different tumor cells and normal cells. The data in the figure represent the average copy number of viral genes within the group, and the error bars represent the standard error of the mean (SEM), n = 3.

[0067] Figure 7 Shows the mRNA expression of the foreign gene SGS2 of oncolytic viruses E9272 and E9273 in different cells. The data in the figure represent the average relative expression level of the foreign gene within the group, and the error bars represent the standard error of the mean (SEM), n = 3.

[0068] Figure 8 Shows the weight changes of tumor-bearing mice in the subcutaneous xenograft tumor model of SW780 cells after treatment with oncolytic viruses. The data points represent the average weight within the group, and the error bars represent the standard error of the mean (SEM), n = 5.

[0069] Figure 9 Shows the tumor growth curve of tumor-bearing mice in the subcutaneous xenograft tumor model of SW780 cells after treatment with oncolytic viruses. The data points represent the average tumor volume within the group, and the error bars represent the standard error of the mean (SEM), n = 5.

[0070] Figure 10 Shows the relative tumor growth rate of tumor-bearing mice in the subcutaneous xenograft tumor model of SW780 cells after treatment with oncolytic viruses. The relative tumor growth rate is calculated based on the tumor volume of the animals at the time of grouping. The data points represent the percentage change in the average tumor volume within the group, and the error bars represent the standard error of the mean (SEM), n = 5. Detailed implementation

[0071] To enable those skilled in the art to understand the features and effects of the present invention, the following provides a general description and definition of the terms and phrases mentioned in the specification and claims. Unless otherwise specified, all technical and scientific terms used herein shall have the ordinary meaning understood by those skilled in the art with respect to the present invention. In case of conflict, the definition in this specification shall prevail.

[0072] The theories or mechanisms described and disclosed herein, whether correct or incorrect, shall not in any way limit the scope of the present invention, that is, the content of the present invention can be implemented without being limited by any specific theory or mechanism.

[0073] In this article, "comprising", "including", "containing" and similar terms cover the meanings of "consisting essentially of" and "consisting of". For example, when this article discloses that "A comprises B and C", it should be considered that "A consists essentially of B and C" and "A consists of B and C" have been disclosed herein.

[0074] In this text, all features defined in the form of numerical ranges or percentage ranges, such as numerical values, quantities, contents, and concentrations, are for the sake of brevity and convenience only. Accordingly, the description of a numerical range or percentage range should be regarded as having covered and specifically disclosed all possible sub-ranges and individual numerical values within the range (including integers and fractions).

[0075] In this text, unless otherwise specified, the percentage refers to the mass percentage, and the ratio refers to the mass ratio.

[0076] In this text, the sum of the percentage contents of the components of the composition is 100%.

[0077] In this text, when describing the embodiments or examples, it should be understood that they are not used to limit the present invention to these embodiments or examples. On the contrary, all alternatives, modifications, and equivalents of the methods and materials described in the present invention can be covered within the scope defined by the claims.

[0078] The inventors first revealed that the oncolytic adenovirus expressing the SGS2 protein or its functional variant has a significant effect on killing bladder tumor cells, and the killing effect on normal cells is significantly lower than that on tumor cells, showing good safety in tumor research.

[0079] "SGS2 protein" refers to a polypeptide having SGS2 activity, including but not limited to variant forms of the polypeptide. "Variant forms" include (but are not limited to): deletion, insertion and / or substitution of several (usually 1-50, preferably 1-30, 1-20, 1-10, 1-8, 1-5) amino acids, and addition or deletion of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and / or N-terminus. For example, in the art, when substituting amino acids with similar or close properties, the function of the protein is usually not changed. In the art, amino acids with similar properties often refer to amino acid families with similar side chains, which are clearly defined in the art. These families include amino acids with basic side chains (such as lysine, arginine, histidine), amino acids with acidic side chains (such as aspartic acid, glutamic acid), amino acids with uncharged polar side chains (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (such as alanine, valine, leucine, isoleucine, lactate, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (such as threonine, valine, isoleucine) and amino acids with aromatic side chains (such as tyrosine, phenylalanine, tryptophan, histidine). Also, for example, adding one or several amino acids at the amino terminus and / or carboxyl terminus usually does not change the function of the polypeptide or protein. Conservative amino acid substitutions for many common known non-genetically encoded amino acids are known in the art. Conservative substitutions for other non-coded amino acids can be determined based on comparison of their physical properties with those of genetically encoded amino acids. The amino acid sequence of the SGS2 protein herein is shown as any one of the sequences in SEQ ID NO: 1-11.

[0080] The SGS2 protein herein is from plants, and the plants include: Medicago truncatula, cotton, Arabidopsis thaliana, Nicotiana benthamiana, Nicotiana tabacum, Nicotiana glutinosa, tomato, maize, rice, barley, Physcomitrella patens; preferably, the plant is Arabidopsis thaliana, Nicotiana tabacum, rice; more preferably, the plant is Arabidopsis thaliana.

[0081] In this article, the "functional variant" of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.

[0082] In one or more embodiments, the plant is Medicago truncatula, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: XP_039687766) is as shown in SEQ ID NO:1 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:1; the polynucleotide sequence encoding the SGS2 protein or its functional variant is as shown in SEQ ID NO:12 (Sequence Registration Number: XM_039831832).

[0083] In one or more embodiments, the plant is cotton, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: ADG57590) is as shown in SEQ ID NO:2 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:2; the polynucleotide sequence encoding the SGS2 protein or its functional variant (Sequence Registration Number: GQ254649) is as shown in SEQ ID NO:13.

[0084] In one or more embodiments, the plant is Arabidopsis thaliana, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: NP_190519) is as shown in SEQ ID NO:3 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:3; the polynucleotide sequence encoding the SGS2 protein or its functional variant (Sequence Registration Number: NM_114810) is as shown in SEQ ID NO:14 and SEQ ID NO:23.

[0085] In one or more embodiments, the plant is Nicotiana benthamiana, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: AAU21242) is as shown in SEQ ID NO:4 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:4; the polynucleotide sequence encoding the SGS2 protein or its functional variant (Sequence Registration Number: AY722008) is as shown in SEQ ID NO:15.

[0086] In one or more embodiments, the plant is tobacco, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: BAF96019) is as shown in SEQ ID NO:5 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:5; the polynucleotide sequence encoding the SGS2 protein or its functional variant (Sequence Registration Number: AB361628) is as shown in SEQ ID NO:16.

[0087] In one or more embodiments, the plant is Nicotiana benthamiana, and the amino acid sequence of the SGS2 protein (sequence registration number: ACO72600) is as shown in SEQ ID NO:6 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:6; the polynucleotide sequence encoding the SGS2 protein or its functional variant (sequence registration number: FJ490363) is as shown in SEQ ID NO:17.

[0088] In one or more embodiments, the plant is tomato, and the amino acid sequence of the SGS2 protein (sequence registration numbers: NP_001266205, XP_004236660) is as shown in SEQ ID NO:7 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:7; the polynucleotide sequence encoding the SGS2 protein or its functional variant (sequence registration number: XM_039831832) is as shown in SEQ ID NO:18.

[0089] In one or more embodiments, the plant is maize, and the amino acid sequence of the SGS2 protein (sequence registration number: NP_001142097) is as shown in SEQ ID NO:8 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:8; the polynucleotide sequence encoding the SGS2 protein or its functional variant (sequence registration number: NM_001148625) is as shown in SEQ ID NO:19.

[0090] In one or more embodiments, the plant is rice, and the amino acid sequence of the SGS2 protein (sequence registration numbers: NP_001406350, XP_015622237) is as shown in SEQ ID NO:9 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:9; the polynucleotide sequence encoding the SGS2 protein or its functional variant (sequence registration numbers: NM_001419421, XM_015766751) is as shown in SEQ ID NO:20.

[0091] In one or more embodiments, the plant is barley, and the amino acid sequence of the SGS2 protein (sequence registration number: ACI16098) is as shown in SEQ ID NO:10 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:10; the polynucleotide sequence encoding the SGS2 protein or its functional variant (sequence registration number: FJ188379) is as shown in SEQ ID NO:21.

[0092] In one or more embodiments, the plant is Physcomitrella patens, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: ABF82438) is as shown in SEQ ID NO:11 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:11; the polynucleotide sequence encoding the SGS2 protein or its functional variant (Sequence Registration No.: FJ188379) is as shown in SEQ ID NO:22.

[0093] Variant forms of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, and induced mutants.

[0094] The present invention also relates to the polynucleotide sequence encoding the SGS2 protein of the present invention. The polynucleotide may be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The nucleotide sequence encoding the SGS2 protein herein is as shown in any one of SEQ ID NOs: 12-23.

[0095] As will be understood by those skilled in the art, DNA is usually a double-stranded structure with a sense strand and an antisense strand that are complementary to each other. Among them, the sense strand, also known as the coding strand, is the strand in the DNA double helix that contains genetic information and cannot be transcribed. It contains the same nucleotide sequence as the mRNA encoding the functional protein, with the only difference being that T in DNA is replaced by U in mRNA. The antisense strand, also known as the template strand, is the DNA strand used by RNA polymerase during transcription and serves as a template for transcription. RNA polymerase moves along the template strand and transcribes it into mRNA, which is then translated into a polypeptide.

[0096] Narrowly speaking, the "polynucleotide sequence encoding..." or "coding sequence of..." refers to the sequence that can directly guide transcription on the antisense strand of DNA or the sequence that can directly guide translation on mRNA. A polynucleotide may include a coding sequence (or coding region) and a non-coding sequence (or non-coding region, such as an intron). The coding sequence may be continuous or discontinuous, and the discontinuous coding sequence fragments may be separated by non-coding sequences. The complete coding region obtained by sequentially connecting the coding sequence fragments is the coding sequence of the polypeptide.

[0097] The present invention also provides a recombinant vector comprising the recombinant vector encoding the SGS2 protein or its functional variant of the present invention. As a preferred mode, a multiple cloning site or at least one cleavage site is included downstream of the promoter of the recombinant vector. When it is desired to express the target gene of the present invention, the target gene is ligated into a suitable multiple cloning site or cleavage site, thereby operably linking the target gene to the promoter. As another preferred mode, the recombinant vector comprises (in the 5' to 3' direction): a promoter, a target gene, and a terminator. If desired, the recombinant vector may further comprise elements selected from the group consisting of: a 3' polyadenylation signal; an untranslated nucleic acid sequence; a transport and targeting nucleic acid sequence; a resistance selection marker (such as dihydrofolate reductase, neomycin resistance, hygromycin resistance, and green fluorescent protein); an enhancer; or an operator.

[0098] Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Expression vectors can be bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors. In short, any plasmid and vector can be used as long as it can replicate and be stable in the host. Exemplarily, the vector of the present invention is a viral vector or a non-viral vector; the viral vectors include adeno-associated virus, adenovirus, retrovirus, and the non-viral vectors include plasmids, liposomes, cationic polymers, nanoparticles, multifunctional envelope-type nano carriers, vesicles, N-acetylgalactosamine (GalNAc), or engineered bacteria; preferably, the vector is an adenovirus; more preferably, the vector is an oncolytic adenovirus.

[0099] "Adenovirus" is a non-integrating, non-enveloped double-stranded DNA virus, and "oncolytic virus" is a virus that naturally exists or is genetically engineered to replicate only in tumor cells and lyse tumor cells. As a highly effective anti-tumor agent, the mechanism of action of oncolytic virus is to replicate only in tumor cells and finally lyse tumor cells to produce an oncolytic effect. As used herein, the term "oncolytic adenovirus" refers to a class of tumor-lytic adenoviruses with replication ability.

[0100] Those of ordinary skill in the art can use well-known methods to construct an expression vector containing the gene of the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. When using the gene of the present invention to construct a recombinant expression vector, any enhancer-type, constitutive, tissue-specific, or inducible promoter can be added before the transcription start nucleotide.

[0101] Vectors containing the gene of the present invention can be used to transform appropriate host cells to enable the host to express the protein. The host cell can be a prokaryotic cell, such as Escherichia coli, Streptomyces, Agrobacterium; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. The plants described herein include Medicago truncatula, cotton, Arabidopsis thaliana, Nicotiana benthamiana, tobacco, Nicotiana glutinosa, tomato, maize, rice, barley, Physcomitrella patens; preferably, the plant is Arabidopsis thaliana, tobacco, rice; more preferably, the plant is Arabidopsis thaliana. Those of ordinary skill in the art are well aware of how to select appropriate vectors and host cells. Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote (such as Escherichia coli), it can be treated with CaCl 2 method, or electroporation can also be used. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, conventional mechanical methods (such as microinjection, electroporation, liposome packaging, etc.). Agrobacterium transformation or gene gun transformation and other methods can also be used for plant transformation, such as leaf disc method, immature embryo transformation method, floral bud soaking method, etc. For transformed plant cells, tissues or organs, plants can be regenerated by conventional methods to obtain transgenic plants. When the polynucleotide is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. An enhancer is a cis-acting factor of DNA, usually about 10 to 300 base pairs, which acts on the promoter to enhance gene transcription.

[0102] Those of ordinary skill in the art are well aware of how to select appropriate vectors, promoters, enhancers and host cells.

[0103] Transformation of the host with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. Agrobacterium transformation or gene gun transformation and other methods can be used for plant transformation, such as spraying method, leaf disc method, rice immature embryo transformation method, etc. For transformed plant tissues or organs, plants can be regenerated by conventional methods to obtain plants with altered traits.

[0104] Accordingly, the present invention provides the use of the gene silencing suppressor 2 (SGS2) protein or a functional variant thereof from a plant described in any embodiment herein in the preparation of an anti-tumor drug. The plant sources of the SGS2 include, but are not limited to: Medicago truncatula, cotton, Arabidopsis thaliana, Nicotiana benthamiana, tobacco, Nicotiana glutinosa, tomato, maize, rice, barley, Physcomitrella patens; preferably, the plant is Arabidopsis thaliana, tobacco, rice; more preferably, the plant is Arabidopsis thaliana. In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of an RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region. In one or more embodiments, the amino acid sequence of the SGS2 protein is any one of the sequences shown in SEQ ID NO: 1-11, or a functional variant having at least 80% sequence identity with any one of the sequences shown in SEQ ID NO: 1-11.

[0105] In one or more embodiments, the plant is Medicago truncatula, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: XP_039687766) is as shown in SEQ ID NO:1 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:1. In one or more embodiments, the plant is cotton, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: ADG57590) is as shown in SEQ ID NO:2 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:2. In one or more embodiments, the plant is Arabidopsis thaliana, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: NP_190519) is as shown in SEQ ID NO:3 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:3. In one or more embodiments, the plant is Nicotiana benthamiana, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: AAU21242) is as shown in SEQ ID NO:4 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:4. In one or more embodiments, the plant is tobacco, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: BAF96019) is as shown in SEQ ID NO:5 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:5. In one or more embodiments, the plant is Nicotiana glutinosa, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: ACO72600) is as shown in SEQ ID NO:6 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:6. In one or more embodiments, the plant is tomato, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: NP_001266205 XP_004236660) is as shown in SEQ ID NO:7 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:7. In one or more embodiments, the plant is maize, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: NP_001142097) is as shown in SEQ ID NO:8 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:8. In one or more embodiments, the plant is rice, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: NP_001406350 XP_015622237) is as shown in SEQ ID NO:9 or is a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:9.In one or more embodiments, the plant is barley, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: ACI16098) is as shown in SEQ ID NO:10 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:10. In one or more embodiments, the plant is Physcomitrella patens, and the amino acid sequence of the SGS2 protein (Sequence Registration Number: ABF82438) is as shown in SEQ ID NO:11 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO:11.

[0106] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in any of SEQ ID NOs: 12 - 23. In one or more embodiments, the plant is Medicago truncatula, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in SEQ ID NO: 12 (Sequence Registration Number: XM_039831832). In one or more embodiments, the plant is cotton, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: GQ254649) is as shown in SEQ ID NO: 13. In one or more embodiments, the plant is Arabidopsis thaliana, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: NM_114810) is as shown in SEQ ID NO: 14 and SEQ ID NO: 23. In one or more embodiments, the plant is Nicotiana benthamiana, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: AY722008) is as shown in SEQ ID NO: 15. In one or more embodiments, the plant is Nicotiana tabacum, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: AB361628) is as shown in SEQ ID NO: 16. In one or more embodiments, the plant is Nicotiana glutinosa, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: FJ490363) is as shown in SEQ ID NO: 17. In one or more embodiments, the plant is Solanum lycopersicum, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: XM_039831832) is as shown in SEQ ID NO: 18. In one or more embodiments, the plant is Zea mays, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: NM_001148625) is as shown in SEQ ID NO: 19. In one or more embodiments, the plant is Oryza sativa, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: NM_001419421 XM_015766751) is as shown in SEQ ID NO: 20. In one or more embodiments, the plant is Hordeum vulgare, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: FJ188379) is as shown in SEQ ID NO: 21. In one or more embodiments, the plant is Physcomitrella patens, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration Number: FJ188379) is as shown in SEQ ID NO: 22.

[0107] As used herein, the tumor is bladder cancer. In one or more embodiments, the tumor is derived from an animal.

[0108] The present invention also provides the use of a reagent in the preparation of an anti-tumor drug, wherein the reagent comprises: (1) a nucleic acid molecule encoding an SGS2 protein or a functional variant thereof, a nucleic acid construct, a virus or a cell as described in any one of the embodiments herein. Optionally, the reagent or the drug comprises a delivery system.

[0109] As used herein, a delivery system refers to a component that can deliver a drug or its active ingredient to the body or a target location (such as a tissue or a cell). Selecting different delivery systems according to different active ingredients is a conventional technique in the art. For example, common delivery systems for delivering proteins include: lipid-based nano-delivery systems (liposomes, exosomes, cell membrane-coated nanoparticles), polymeric carriers (polymeric micelles, polymeric vesicles, layer-by-layer self-assembled carriers, dendrimers, nanogels, scaffolds and hydrogels, metal-organic frameworks), inorganic nanoparticles (mesoporous silica nanoparticles, gold nano-carriers, carbon nanotubes, graphene oxide nanosheets, magnetic nanoparticles), peptide / protein-based nano-carriers (cell-penetrating peptides, protein carriers, virus-like nano-carriers), DNA nano-carriers, etc. Common delivery systems for delivering nucleic acids include: viral carriers (adenovirus, adeno-associated virus, lentivirus, retrovirus) and non-viral carriers (liposomes, polymers, inorganic nano-materials, exosomes). Common delivery systems for delivering cells include: natural biomaterial carriers (extracellular matrix (ECM), hydrogels), synthetic biomaterial carriers (polylactic-co-glycolic acid (PLGA), polycaprolactone (PCL)), bioengineered carriers (microcapsules, engineered extracellular vesicle carriers), bioactive glass, magnetic nanoparticle carriers. Common delivery systems for delivering viruses include: liposome carriers, polymeric carriers (polyethyleneimine (PEI), polylactic-co-glycolic acid (PLGA)), inorganic nano-material carriers (nano-gold, mesoporous silica nanoparticles (MSN)), biological carriers (phage carriers, exosome carriers).

[0110] In one or more embodiments, the delivery system comprises a nucleic acid component encoding an SGS2 protein, or a nucleic acid construct expressing the nucleic acid component. Exemplarily, the delivery system described herein is a viral vector or a non-viral vector; preferably, the viral vector includes adeno-associated virus, adenovirus, retrovirus, and preferably, the non-viral vector includes plasmid, liposome, cationic polymer, nanoparticle, multifunctional envelope-type nano-vector, vesicle, N-acetylgalactosamine (GalNAc) or engineered bacteria; more preferably, the delivery system is adenovirus; even more preferably, the delivery system is oncolytic adenovirus.

[0111] The nucleic acid constructs herein can be vectors, including polynucleotide sequences encoding the SGS2 protein or functional variants thereof described herein, such as expression vectors and recombinant vectors. These vectors can be used to transform appropriate host cells to enable them to express the protein. Vectors generally contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. The sequences (collectively referred to as "flanking sequences" in certain embodiments) generally include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splice sites, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a multiple linker region for inserting the nucleic acid encoding the anti-mesothelin antibody to be expressed, and optional marker elements.

[0112] The present invention also provides a method for preparing an oncolytic adenovirus comprising a nucleic acid molecule encoding the SGS2 protein or a functional variant thereof, the method comprising the steps of: (1) constructing a plasmid containing the SGS2 gene, and (2) preparing a virus containing the plasmid in (1).

[0113] The present invention provides the use of an oncolytic adenovirus comprising a nucleic acid molecule encoding the SGS2 protein or a functional variant thereof in the preparation of an anti-tumor drug. In one or more embodiments, the oncolytic adenovirus comprises a polynucleotide sequence encoding the SGS2 protein or its nucleic acid construct.

[0114] The present invention also provides the use of the oncolytic adenovirus in the preparation of a kit for killing tumor cells or treating a disease, the kit containing the oncolytic adenovirus described herein. Exemplarily, the kit may further contain various reagents suitable for manipulating (such as culturing, transplanting, purifying, genetic engineering, maturation, etc.) the oncolytic adenovirus, and optionally instructions for guiding those skilled in the art to operate. The disease includes cancer, and in certain embodiments herein, the disease is bladder cancer.

[0115] The present invention also provides a method for treating or preventing a disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of the anti-tumor drug according to any one of the embodiments herein.

[0116] The term "subject" or "patient" can refer to a patient or other animal, especially a mammal, such as a human, mouse, rat, dog, monkey, cow, horse, etc., who receives the pharmaceutical composition of the present invention for treating, preventing, ameliorating, and / or alleviating the snake venom of the present invention.

[0117] The term "effective amount" refers to the dose that can achieve treatment, prevention, alleviation, and / or remission of a disease or disorder in a subject. The therapeutically effective amount can be determined based on factors such as the age, gender, disease condition and its severity, and other physical conditions of the patient. In this article, the subject or patient generally refers to a mammal, especially a human. The dosage form, dose, and administration route of the anti-tumor drug can be adjusted according to the age, gender, disease state of the patient, the amount of hepatocytes or extracts required, etc. The dosage forms include, for example, gels, aerosols, tablets, capsules, powders, granules, syrups, solutions, suspensions, injections, powders, pills, controlled-release agents, infusions, suspensions. The administration routes of the anti-tumor drug described in this article can include but are not limited to subcutaneous injection, percutaneous injection, implantation, topical administration, intramuscular injection, sustained-release administration, and oral administration, etc.

[0118] Other aspects of the present invention will be apparent to those skilled in the art from the present disclosure. The present invention will be further illustrated below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are generally carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0119] Examples

[0120] Table 1. Viruses, cell lines and their sources

[0121] Name Type Source E9272 Oncolytic adenovirus NeoEvolve (Beijing) Medical Technology Co., Ltd. E9273 Oncolytic adenovirus NeoEvolve (Beijing) Medical Technology Co., Ltd. E9274 Oncolytic adenovirus NeoEvolve (Beijing) Medical Technology Co., Ltd. HEK-293 Human embryonic kidney cells Nantong WuXi AppTec Medical Science & Technology Co., Ltd. HUVEC Human vascular endothelial cells Nantong WuXi AppTec Medical Science & Technology Co., Ltd. MRC5 Human embryonic lung fibroblasts Nantong WuXi AppTec Medical Science & Technology Co., Ltd. SW780 Human bladder cancer cells Nantong WuXi AppTec Medical Science & Technology Co., Ltd.

[0122] Table 2. Reagents, consumables, instruments and their sources and catalog numbers

[0123]

[0124]

[0125]

[0126] Experimental methods:

[0127] I. The method for SGS2 protein sequence analysis includes the following steps:

[0128] 1. Obtaining the SGS2 protein sequence

[0129] Log in to the website of the National Center for Biotechnology Information of the United States (http: / / www.ncbi.nlm.nih.gov / ), select the tblastn method to retrieve the protein sequence of published Arabidopsis thaliana SGS2 in the non-redundant (nr) and partial non-redundant (nt) databases, and obtain the protein sequences of SGS2 from other plant sources.

[0130] 2. Analysis of the functional domains of the SGS2 protein

[0131] Use the HMMER software based on the hidden Markov model in the SMART online tool (https: / / smart.embl.de / ) to perform amino acid sequence analysis and domain prediction on the SGS2 protein. During the analysis, select the two parameters of "abnormal homologs and homologs with known structures" and "PFAM domains", and keep other parameters at the default settings. To further verify the obtained results, all conserved domains are verified through the online tool of the National Center for Biotechnology Information domain database (NCBI-CDD; https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) and the Pfam database (http: / / pfam.xfam.org).

[0132] II. Methods for plasmid cloning and construction, including the following steps:

[0133] Obtain the target gene by PCR or restriction enzyme digestion, construct it into the target vector by ligation or homologous recombination / assembly, and transform competent E. coli DH5α cells. Screen the transformants by colony PCR, and send the positive clones for sequencing. Extract the plasmids from the clones that have been verified to be correct.

[0134] 1. Obtaining the target gene fragment

[0135] Method 1: Amplify the target gene by PCR

[0136] (1) Query the target gene and its upstream and downstream sequences from GenBank, and design primers using Vector NTI software.

[0137] (2) PCR amplification of the target gene: Use high-fidelity HSDNA Polymerase to amplify the target gene, and the reaction system and conditions are as described in the product manual.

[0138] (3) The PCR products were detected by agarose gel electrophoresis to evaluate the amplification effect. The target gene band was excised from the gel after agarose gel electrophoresis, and gel extraction was performed using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0. The reaction system and conditions were as described in the product manual.

[0139] Method 2: Obtain the target gene by digestion

[0140] (1) The plasmid containing the target gene was digested with restriction endonucleases. The digestion reaction system was as follows: 2 μg of plasmid, 5 μL of 10× reaction Buffer, 1 μL each of restriction endonucleases EcoRI and SalI, and filled up to 50 μL with water. Incubate in a 37°C water bath for more than 2 h.

[0141] (2) The digestion products were detected by agarose gel electrophoresis to evaluate the digestion effect. The target gene band was excised from the gel after agarose gel electrophoresis, and gel extraction was performed using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0. The reaction system and conditions were as described in the product manual.

[0142] 2. Preparation of linearized expression vector

[0143] The expression vector was digested with restriction endonucleases. The digestion reaction system was as follows: 2 μg of plasmid, 5 μL of 10× reaction Buffer, 1 μL each of restriction endonucleases EcoRI and SalI, and filled up to 50 μL with water. Incubate in a 37°C water bath for more than 2 h. The digestion products were detected by agarose gel electrophoresis to evaluate the digestion effect. The target vector band was excised from the gel after agarose gel electrophoresis, and gel extraction was performed using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0. The reaction system and conditions were as described in the product manual.

[0144] 3. Insert the target gene into the linearized expression vector

[0145] Method 1: Use a seamless cloning kit (suitable for a single target gene insertion fragment)

[0146] The target gene fragment and the linearized vector were added to a centrifuge tube at a molar ratio of 2:1 for recombination reaction. The reaction system and conditions were as described in the seamless cloning kit product manual. After mixing, incubate at 37°C for 30 min, then transfer to ice and place for 5 min. Direct transformation or storage at -20°C and thaw for transformation when needed.

[0147] Method 2: Use a seamless assembly kit (suitable for multiple target gene insertion fragments)

[0148] Add the target gene fragment and the linearized vector to a centrifuge tube at a molar ratio of 1:1 for recombination reaction. The reaction system and conditions are as described in the seamless cloning kit product manual. After mixing, incubate at 37 °C for 30 min, then transfer to ice and place for 5 min. For direct transformation or storage at -20 °C, thaw and transform when needed.

[0149] Method 3: Use T4 DNA ligase

[0150] Add the target gene fragment and the linearized vector to a centrifuge tube at a molar ratio of 3:1 for recombination reaction. Generally, 100 ng of the linearized expression vector is added, and the amount of the target gene fragment added is 300 × (number of base pairs of the target gene / number of base pairs of the linearized expression vector) (unit: ng). The reaction system and conditions are as described in the T4 DNA Ligase product manual. After mixing, incubate at 16 °C overnight, and take 10 μL of the reaction liquid to transform into competent cells.

[0151] 4. Preparation and transformation of competent cells

[0152] Use E.coli DH5α Competent Cells for plasmid vector transformation. Thaw E.coli DH5α Competent Cells on ice before use. Mix gently, take 100 μL and transfer it into a 14 mL round-bottom tube. Add the DNA sample (recommended ≤10 ng), place on ice for 30 min, at 42 °C for 45 s, and on ice for 1 - 2 min. Add pre-warmed SOC medium at 37 °C to a final volume of 1 mL. Incubate with shaking at 37 °C for 1 h (160 - 225 rpm). Take an appropriate amount and spread it on an LB agar plate (containing 30 μg / mL Kanamycin). Incubate overnight at 37 °C. The reaction system and conditions are as described in the E.coli DH5α Competent Cells product manual.

[0153] 5. Colony PCR identification of positive transformants

[0154] Pick the transformants grown on the plate and resuspend them in 10 μL of LB culture medium. Take 1 μL as a template for colony PCR identification. The reaction system and PCR cycling conditions are as described in Premix Taq TM (TaKaRa Taq TM Version 2.0 plus dye) product manual.

[0155] 6. Send positive clones for sequencing

[0156] The positive clones obtained by colony identification were sent to Genewiz (Suzhou) Inc. for sequencing verification. The sequencing primers were mCMV-F: GGTATAAGAGGCGCGACCAG (SEQ ID NO: 24); SV40-pArev-R: GAAATTTGTGATGCTATTGC (SEQ ID NO: 25). The Snapgene software was used to align and analyze the sequencing results.

[0157] 7. Mini-prep of Plasmid

[0158] For the positive clones that passed the sequencing, mini-prep of plasmid was arranged. The specific steps can be found in the product manual of AxyPrep Plasmid DNA Miniprep Kit.

[0159] III. Methods for plasmid transfection, virus amplification, virus harvest and virus purification, including the following steps:

[0160] 1. Plasmid Transfection

[0161] (1) One day before transfection, select HEK-293 cells in good condition, digest and collect the cells. After counting, seed the cells at a density of 1×10 6 cells / well in a 6-well plate, shake well, and place in an incubator at 37°C and 5% CO 2 2 for culture.

[0162] (2) One hour before transfection, take out the cell culture dish, discard the original cell culture medium, add Opti-MEM medium, and put the cells back into the incubator.

[0163] (3) Mix the plasmid to be transfected in equal proportion and dissolve it in Opti-MEM medium, gently mix well, and let it stand to obtain a plasmid dilution.

[0164] (4) Dissolve the transfection reagent in Opti-MEM medium, gently mix well, and let it stand to obtain a transfection reagent dilution.

[0165] (5) Drop the transfection reagent dilution into the plasmid dilution, gently mixing while adding. Let it stand at room temperature for 15 - 25 min to allow the DNA and transfection reagent to fully combine to form a stable transfection complex.

[0166] (6) Take out the cell culture dish, add the prepared DNA-transfection reagent complex to the cell culture dish, avoid disturbing the cells, and gently put it back into the incubator.

[0167] (7) After 5 - 8 hours, aspirate the medium, wash with DPBS solution, and then add fresh complete medium for culture.

[0168] 2. Virus Amplification, Virus Harvest and Purification

[0169] (1) Replace the culture medium of the transfected cells every 3 - 5 days, and observe the virus release. After the virus is released, perform virus amplification.

[0170] (2) Use a 1 mL pipette to aspirate the cell supernatant and pipette up and down the cells in the dish to completely detach the cells. Collect all the cells and the supernatant into a 50 mL centrifuge tube.

[0171] (3) After repeated freezing and thawing in liquid nitrogen, centrifuge at 4000 rpm for 10 min, take the supernatant, filter the virus with a 0.22 μm filter, aliquot and store at -80 °C.

[0172] IV. Method for detecting adenovirus titer, including the following steps:

[0173] Adenovirus can infect and replicate in HEK-293 cells. Adenovirus type 5 expresses a special capsid protein Hexon. After the HEK-293 cells infected with adenovirus are fixed with methanol, they are incubated with the primary antibody against Hexon. The primary antibody will bind to the Hexon protein on the adenovirus. Then, add the secondary antibody labeled with horseradish peroxidase and incubate. After the secondary antibody binds to the primary antibody, add the substrate DAB of horseradish peroxidase for staining. Finally, wash away the excess staining solution. At this time, the positive cells infected with the virus will be stained brown. By counting the positive cells and using the formula, the virus titer can be calculated.

[0174] 1. Select HEK-293 cells in good condition, resuspend the cells with complete medium, and prepare a cell suspension of 2.5×10 5 cells / mL. Seed 1 mL of the cell suspension into each well of a 24-well plate and culture at 37 °C, 5% CO 2 for 1 h.

[0175] 2. Dilute the virus sample with DMEM medium in a 10-fold gradient, and then sequentially add the virus solutions diluted from 10 -5 to 10 -8 to the 24-well plate (the virus dilution can be adjusted according to the actual experimental situation). Add 100 μL to each well, and each dilution occupies one well.

[0176] 3. Gently remove the culture medium, and slowly add 0.5 mL of pre-cooled methanol along the side wall of the 24-well plate. Fix at -20 °C for 20 min (the pipette tip should not touch the cells).

[0177] 4. Gently wash the cells 3 times with DPBS, 5 min each time (be careful not to wash the cells off), and then block with DPBS solution containing 1% BSA at 37 °C for 1 h.

[0178] 5. Discard the blocking solution, add 200 μL of Anti-Hexon working solution to each well, and incubate at 37 °C for 1 h.

[0179] 6. Discard the Anti-Hexon working solution, gently rinse the cells 3 times with DPBS for 5 minutes each time, then add 200 μL of HRP secondary antibody working solution to each well and incubate at 37 °C for 1 h.

[0180] 7. Discard the HRP secondary antibody working solution, gently rinse the cells 3 times with DPBS for 5 minutes each time, then add 200 μL of freshly prepared 1×DAB working solution to each well and incubate at room temperature for 5 - 10 min (the incubation time should not exceed 10 min).

[0181] 8. Discard the DAB working solution, wash 2 times with DPBS, then add 1 mL of DPBS to each well.

[0182] 9. Virus titer calculation method

[0183] (1) Select a gradient where there are 5 - 50 positive cells in the field of view. Randomly select 5 fields of view for each well, observe and count under an optical microscope, and calculate the average number of positive cells per well and the virus titer.

[0184] (2) Calculate the number of fields of view per well in a 24-well plate. For most microscopes, the field of view diameter observed with a standard 10× eyepiece and 10× objective is 1.8 mm. Therefore: Area of each field of view = 3.14×(D / 2) 2 = 3.14×0.81 = 2.54 mm 2 . For a standard 24-well plate, the culture area is 2.0 cm 2 , so: Number of fields of view per well = 2.0 cm 2 / (2.54×10 - 2 cm 2 ) = 79.

[0185] (3) Calculate the titer. Calculate the infectious units (ifu) / mL per well = (infected cells / field of view) × (number of fields of view per well 79) × (dilution factor) × (virus volume (mL)).

[0186] V. Detection method for SGS2 mRNA expression level, including the following steps:

[0187] 1. Total RNA extraction

[0188] (1) Centrifuge to remove the cell supernatant, add 1000 μL of TRIzol Reagent to each well, gently pipette to suspend the cells, let stand at room temperature for 5 min, and then transfer to a new 1.5 mL centrifuge tube.

[0189] (2) Add 200 μL of chloroform to each sample, shake vigorously for 15 s, and let stand at room temperature for 15 min.

[0190] (3) Centrifuge at 4°C, 12000 rpm for 15 min.

[0191] (4) Pipette the supernatant from each tube into a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol, mix well, and precipitate at 4°C for 10 min.

[0192] (5) After centrifuging at 4°C, 12000 rpm for 10 min, discard the supernatant.

[0193] (6) Add at least 1 mL of 75% ethanol pre-cooled at 4°C to wash the precipitate and the centrifuge tube wall.

[0194] (7) Centrifuge at 4°C, 10000 rpm for 5 min, and discard the supernatant.

[0195] (8) Centrifuge at 4°C, 10000 rpm for 5 min, aspirate the residual liquid, and dry at room temperature.

[0196] (9) Add 30 - 40 μL of RNase-free water until completely dissolved, and measure the concentration and absorbance value of RNA by ultraviolet analysis.

[0197] 2. Reverse transcription of total RNA

[0198] (1) Prepare the gDNA Eraser reaction mixture on ice according to the reagents and dosages of the PrimeScript TM RT reagent Kit with gDNA Eraser (Perfect Real Time) product.

[0199] (2) After placing the gDNA Eraser reaction mixture in a 42°C water bath for 2 min, immediately place it on ice.

[0200] (3) Prepare the RNA reverse transcription mixture on ice according to the reagents and dosages of the PrimeScript TM RT reagent Kit with gDNA Eraser (Perfect Real Time) product.

[0201] (4) First place the RNA reverse transcription mixture in a 42°C water bath for 15 min, then in an 85°C water bath for 5 s, and immediately place it on ice to obtain the reverse transcription product (cDNA).

[0202] (5) The reverse transcription product (cDNA) can be immediately used for qPCR detection or stored at -80°C.

[0203] 3. Real-time PCR detection

[0204] (1) The primer sequences of the internal reference gene (Gapdh) are F: GTCTTCACCACCATGGAGAA (SEQ ID NO: 26); R: TAAGCAGTTGGTGGTGCAG (SEQ ID NO: 27).

[0205] (2) The primer sequences of the target gene (SGS2) are F: CAATCACACCTGACCTCGCT (SEQ ID NO: 28); R: ACGAGCAACAACCCCTTTGA (SEQ ID NO: 29).

[0206] (3) Prepare the Real-time PCR reaction mixture (Table 3) on ice according to the reagents and dosages of the ChamQ Universal SYBR qPCR Master Mix product.

[0207] Table 3. Preparation table of Real-time PCR reaction system

[0208]

[0209]

[0210] (4) After preparing the reaction system Mix, add it to a 96-well reaction plate respectively, and add the test samples to the corresponding wells, 1 μL (1 μg) per well, with 3 replicates for each sample. After adding all the test samples, add the serially diluted standards to the wells respectively, with 3 replicates for each dilution, and centrifuge the detection plate briefly.

[0211] (5) Run the following program using an Applied Biosystems QuantStudio 7Flex: pre-denaturation at 50 °C for 2 min, 95 °C for 10 min, amplification: 95 °C for 15 s, 60 °C for 1 min, for 40 cycles.

[0212] (6) Data analysis. According to the detection data, calculate the gene expression level using the 2 -ΔΔCt method, and perform statistical analysis using GraphPad Prism 10.1.2 software to evaluate the differences between groups. The comparison between two groups is analyzed by Student’s t-test, and p < 0.05 is considered to be significantly different.

[0213] VI. The detection method for evaluating the selective killing of viruses on different types of cells using the CCK-8 method includes the following steps:

[0214] 1. Cell lines and culture methods

[0215] Table 4. Information table of cell lines and culture methods

[0216]

[0217] 2. Cell culture and seeding

[0218] (1) Culture the cell line in an incubator at 37 °C with or without 5% CO 2 . Passage regularly and use cells in the logarithmic growth phase for seeding.

[0219] (2) Stain the cells with trypan blue and count the viable cells.

[0220] (3) Adjust the cell concentration to an appropriate concentration, such as 5×10 4 cells / mL.

[0221] (4) Add 100 μL of cell suspension to each well of the culture plate, and add cell-free culture medium to the blank control wells.

[0222] (5) Incubate the culture plate overnight in an incubator at 37 °C with or without 5% CO 2 and 100% relative humidity.

[0223] 3. Virus preparation and dilution

[0224] Virus preparation and dilution: Take out the virus and thaw it at room temperature. First, dilute the virus with the medium to 5000 MOI / 0.1 mL and 3000 MOI / 0.1 mL according to the cell density, and then perform serial dilutions to prepare 1000 MOI / 0.1 mL, 300 MOI / 0.1 mL, 100 MOI / 0.1 mL, 30 MOI / 0.1 mL, 10 MOI / 0.1 mL, 3 MOI / 0.1 mL and 1 MOI / 0.1 mL for standby.

[0225] 4. Virus infection

[0226] The next day, add the diluted virus solution (100 μL / well) to the wells of the cell plate as shown in Table 5. Add an equal volume of culture medium to the Vehicle group and the Negative group, and add DPBS to the surrounding wells of the cell plate. Place the cell plate in the incubator and culture for 72 h.

[0227] Table 5. Information table of cell seeding and virus infection

[0228]

[0229] Neg.: Negative control, only cells without virus; Blank: Blank control, only culture medium. Solvent: Solvent treatment group.

[0230] 5. Cell viability detection by CCK-8 method

[0231] (1) Restore the Cell Counting Kit-8 reagent to room temperature in advance.

[0232] (2) At 72 h after virus infection, add 20 μL of Cell Counting Kit-8 detection solution to each cell well, and gently shake the cell plate to mix the solution evenly.

[0233] (3) Return the cell plate to the incubator and continue culturing for 2 h.

[0234] (4) Use a microplate reader Spectra Max M2 to read the absorbance at 450 nm.

[0235] 6. Data analysis

[0236] Calculate the inhibition rate (IR) of the test substance using the following formula: IR(%) = [(Ac - As) / (Ac - Ab)] × 100%. Where As is the absorbance of the experimental group, Ac is the absorbance of the control group, and Ab is the absorbance of the Blank group. Calculate the inhibition rate of the test articles at different concentrations in Excel, and then use GraphPad Prism 10.1.2 software to plot the inhibition curve and calculate the relevant parameters.

[0237] VII. A detection method for detecting the replication of the test oncolytic virus in tumor cells and normal cells by probe-based PCR, comprising the following steps:

[0238] 1. Cell line and culture method

[0239] Culture the cell line in an incubator at 37 °C with or without 5% CO 2 . Passage regularly, and use cells in the logarithmic growth phase for experimental plating. Stain the cells with trypan blue and count the live cells, and adjust the cell concentration to 3×10 5 cell / mL. Add 1 mL of cell suspension to each well in the culture plate, with 3×10 5 cells per well, and culture the culture plate overnight in an incubator at 37 °C with or without 5% CO 2 , and 100% relative humidity.

[0240] 2. Preparation and dilution of the test article

[0241] On the next day, perform virus preparation and dilution: Take out the virus, thaw it at room temperature, and dilute the virus to 3 MOI / 0.5 mL with the corresponding serum-free medium according to the cell density. At the same time, dilute the Vehicle group according to the dilution ratio and method of the virus.

[0242] 3. Cell treatment

[0243] Add the diluted virus solution into the cell plate wells, 500 μL / well, and add an equal volume of diluent to the Vehicle group. Place the cell plate in the incubator for 2 h, supplement with 500 μL of fresh complete medium and continue culturing, and collect the cells and supernatant samples at 24 h, 48 h, and 72 h respectively and store them at -80 °C.

[0244] 4. Viral genome extraction

[0245] The following steps are carried out according to the instructions of the DNeasy Blood&Tissue Kits kit.

[0246] (1) Take out the sample from -80 °C, after dissolving at room temperature, take 200 μL of the sample for genome extraction, and store the remaining sample at -80 °C;

[0247] (2) Add 20 μL of proteinase K to 200 μL of the sample and mix well;

[0248] (3) Add 200 μL of Buffer AL, mix well, and incubate at 56 °C for 10 min;

[0249] (4) Add 200 μL of absolute ethanol and mix well;

[0250] (5) Transfer the supernatant to a DNeasy mini column, centrifuge at 6,000 g for 1 min, and transfer the DNeasy mini column to a new 2 mL collection tube;

[0251] (6) Add 500 μL of Buffer AW1 to the DNeasy mini column, centrifuge at 6,000 g for 1 min, and transfer the DNeasy mini column to a new 2 mL collection tube;

[0252] (7) Add 500 μL of Buffer AW2 to the DNeasy mini column, centrifuge at 20,000 g for 1 min, and transfer the DNeasy mini column to a new 2 mL collection tube;

[0253] (8) Add 500 μL of Buffer AW2 to the DNeasy mini column, centrifuge at 20,000 g for 1 min, and transfer the DNeasy mini column to a new 1.5 mL EPP tube;

[0254] (9) Add 100 μL of Buffer AE (preheated at 56 °C) to the DNeasy mini column, let it stand at room temperature for 2 min, and centrifuge at 6000 g for 1 min;

[0255] (10) Use a spectrophotometer NanoDrop 2000 to measure the DNA concentration.

[0256] 5.qPCR detection

[0257] (1) The reaction system was prepared as shown in Table 6.

[0258] Table 6. qPCR reaction system

[0259]

[0260]

[0261] (2) Primer dilution: The standard plasmid primer sequences are F: AGTTTAGAAACCCCACGGTGG (SEQ ID NO: 30); R: GTCAAAGTACGTGGAAGCCAT (SEQ ID NO: 31). The probe is: FAM-AATCATGCATGGAGATACACCTACATTGCATGA-MGB (SEQ ID NO: 32). According to the number of primers, dilute with ddH 2 Dilute the primer to 5 μM with 50 μL per tube and store in 1.5 mL centrifuge tubes at -20°C until use.

[0262] (3) Dilution of standard: Take out the standard, re-dissolve it, measure the concentration with Nanodrop, and dilute it with ddH 2 Make a 10-fold dilution and keep aside.

[0263] (4) Prepare the reaction system mix and add it to a 96-well reaction plate. Add the test samples to the corresponding wells, 1 μL (1 μg) per well, and three replicates for each sample. After adding the test samples, add the gradient diluted standards, three replicates for each dilution, and instantly remove the test plate.

[0264] (5) The following program was run using Applied Biosystems QuantStudio 7Flex: pre-denaturation at 50°C for 2 min, 95°C for 10 min, amplification at 95°C for 15 s, 60°C for 1 min, for 40 cycles.

[0265] (6) After the program is completed, a standard curve is drawn based on the standard data to calculate the number of viral genome copies in the sample to be tested.

[0266] 8. A method for detecting the selective expression of the oncolytic virus transgene to be tested in tumor cells and normal cells using SYBR Green dye method fluorescence quantitative PCR method, comprising the following steps:

[0267] 1. Cell lines and culture methods

[0268] At 37°C, without or with 5% CO 2Cultivate the cell line in an incubator (Table 4). Passage regularly and use cells in the logarithmic growth phase for experimental plating. Stain the cells with trypan blue and count the viable cells, and adjust the cell concentration to 3×10 5 cell / mL. Add 1 mL of cell suspension to each well in the culture plate, with 3×10 5 cells per well. Incubate the culture plate overnight in an incubator at 37 °C, with or without 5% CO 2 , and 100% relative humidity.

[0269] 2. Preparation and dilution of the test substance

[0270] On the next day, prepare and dilute the virus: Take out the virus and thaw it at room temperature. According to the cell density, dilute the virus to 3 MOI / 0.5 mL with the corresponding serum-free medium. At the same time, dilute the Vehicle group according to the dilution ratio and method of the virus.

[0271] 3. Cell treatment

[0272] On the next day, discard the liquid in the wells, and add 0.5 mL of the diluted virus solution at 3 MOI to the wells of the cell plate. Incubate at 37 °C, with or without 5% CO 2 in an incubator for 2 h, then add 0.5 mL of medium, and place the cell plate in the incubator for continued culture for 48 h.

[0273] 4. Sample collection and nucleic acid extraction

[0274] The following steps are carried out according to the instructions of the FastPure Cell / Tissue Total RNA Isolation Kit V2 kit.

[0275] (1) Discard the liquid in the wells, wash 3 times with DPBS, and add 500 μL of Buffer RL. Pipette and mix well until there are no obvious cell clumps.

[0276] (2) Transfer the lysed sample to FastPure gDNA-Filter ColumnsⅢ and centrifuge at 12,000 rpm for 30 s. Discard FastPure gDNA-Filter ColumnsⅢ and collect the filtrate.

[0277] (3) Add anhydrous ethanol with a volume 0.5 times that of the filtrate (for liver tissue samples, add 50% ethanol with a volume 1 time that of the filtrate) to the filtrate and mix well.

[0278] (4) Transfer all of the mixture from step 2 to FastPure RNA ColumnsⅢ and centrifuge at 12,000 rpm for 30 s. Discard the filtrate.

[0279] (5) Add 700 μL of Buffer RW1 to FastPure RNA ColumnsⅢ, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0280] (6) Add 700 μL of Buffer RW2 (pre-added with absolute ethanol) to FastPure RNA ColumnsⅢ, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0281] (7) Add 500 μL of Buffer RW2 (pre-added with absolute ethanol) to FastPure RNA ColumnsⅢ, centrifuge at 12,000 rpm for 2 min, carefully remove the adsorption column from the collection tube, avoiding contact with the filtrate to cause contamination.

[0282] (8) Place FastPure RNA ColumnsⅢ back into the collection tube, centrifuge at 12,000 rpm for 1 min with no sample to prevent ethanol contamination.

[0283] (9) Carefully transfer the adsorption column to a new 1.5 ml RNase-free Collection Tube. Drop 50 μL of RNase-free ddH 2 O onto the center of the adsorption column, let it stand at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min to elute the RNA, and measure the nucleic acid concentration using IMPLEN-N60 / N50.

[0284] 5. Reverse transcription and qPCR detection

[0285] (1) Place Enzyme Mix, 5×All-in-one qRT SuperMix, and No RT Control Mix on ice. Briefly centrifuge before use and gently pipette to mix well. Prepare the reverse transcription system according to Table 7 below and perform the reaction at 50 °C for 15 min and 85 °C for 5 s.

[0286] Table 7. RNA reverse transcription reaction system

[0287] Component Volume <![CDATA[RNase-free ddH 2 O]]> to 20μL 5×All-in-one qRT SuperMix 4μL Enzyme Mix 1μL Template RNA 1pg - 1μg

[0288] (2) Prepare 2 reaction systems using the amplification primers for the target gene and the internal reference primers respectively, as shown in Table 8 and Table 9 below:

[0289] Table 8. qPCR reaction system

[0290] Component Volume cDNA 5μL Power SYBR Green Master Mix 10μL Forward primer 0.6μL Reverse primer 0.6μL <![CDATA[H 2 O]]> 3.8μL Total volume 20μL

[0291] Table 9. Primer sequence list

[0292]

[0293] (3) Prepare the reaction system mix and add it to a 384-well reaction plate respectively. Then add the test samples to the corresponding wells, 1 μL (1 μg) per well, with 3 replicates for each sample. Centrifuge the detection plate briefly.

[0294] (4) Run the following program using Applied Biosystems QuantStudio 7Flex: Pre-denaturation at 50 °C for 2 min, 95 °C for 30 s, amplification: 95 °C for 5 s, 60 °C for 34 s, for 40 cycles. Melting curve: 95 °C for 10 s, 60 °C for 1 min, 97 °C for 1 s.

[0295] (5) Calculate the relative expression level of the gene in the test samples according to the 2 –ΔΔCt method.

[0296] 5. Data analysis

[0297] Perform statistical analysis, plot graphs, and calculate relevant parameters using GraphPad Prism 10.1.2 software.

[0298] IX. A method for detecting the pharmacodynamics of oncolytic adenovirus on a tumor model of subcutaneous xenograft of human bladder cancer cell SW780 in Balb / c nude mice, comprising the following steps:

[0299] 1. Cell line and culture method

[0300] Culture human bladder cancer cell SW780 (purchased from ATCC, catalog number ATCC-CRL-2169) in an incubator at 37 °C with or without 5% CO 2 . Change the culture medium and passage the cells twice a week. When the cell confluence reaches 80%-90% and the cell number meets the requirements, harvest the cells, count them, and inoculate them.

[0301] 2. Tumor cell inoculation

[0302] Inoculate 10×10 6 SW780 cells subcutaneously into the right cervical and dorsal region of each mouse, with an inoculation volume of 0.2 mL (DPBS + Matrigel = 1:1). Mark the experimental animals with ear tags before inoculation as the only confirmation marker for subsequent experiments. For in vivo pharmacodynamic experiments, start grouping and administering drugs on the 17th day after cell inoculation when the average tumor volume reaches 100 mm 3 . Each group has 5 mice.

[0303] 3. Daily observation of experimental animals

[0304] The use and welfare of experimental animals comply with the regulations of the "Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC)". The health status and mortality of animals are monitored daily. Routine examinations include observing the growth of tumors and the effects of drug treatment on the daily behavior of animals, such as behavioral activities, food and water intake (only by visual inspection), body weight changes, external signs or other abnormal conditions. The number of animal deaths and side effects within each group are recorded based on the number of animals in each group.

[0305] 4. Sample Collection

[0306] Euthanize the animals with PG-D31, collect tumor tissues for measurement and weighing.

[0307] 5. Tumor Measurement and Experimental Indicators

[0308] (1) The experimental indicators are to examine whether tumor growth is inhibited, delayed or cured. The tumor diameter is measured twice a week with vernier calipers. The formula for calculating the tumor volume is: V = 0.5a × b 2 , where a and b represent the long diameter and short diameter of the tumor respectively.

[0309] (2) The relative tumor inhibitory efficacy of the test article is evaluated by TGI (%) or relative tumor proliferation rate T / C (%). Tumor growth inhibition rate TGI (%): The calculation formula is TGI% = [1 - (T i - T 0 ) / (V i - V 0 )] × 100%, where T i , V i are the average tumor volumes of the treatment group and the control group on the i-th day respectively, and T 0 , V 0 are the average tumor volumes of the treatment group and the control group at the start of drug administration respectively. According to the results of tumor measurement, the relative tumor volume (RTV) is calculated, and the formula is RTV = V t / V 0 , where V 0 is the tumor volume of the animal at the time of grouping, and V t is the tumor volume of the animal after treatment. Relative tumor proliferation rate T / C (%): The calculation formula is T / C% = T RTV / C RTV × 100%, where T RTV is the RTV of the treatment group, C RTV is the RTV of the vehicle control group, and T RTV and C RTV take data on the same day.

[0310] 6. Data Analysis

[0311] Statistical analysis included the mean and standard error of the mean (SEM) of tumor volume at each time point for each group and the tumor growth inhibition rate. After outlier analysis using SPSS software Boxplot, statistical analysis was performed using GraphPad Prism 10.1.2. Two-way ANOVA was used for comparison between multiple groups, ns, p > 0.05; *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.

[0312] Example 1: Sequence alignment of plant SGS2 protein

[0313] Bioinformatics analysis was performed on the sequence of plant SGS2 according to the specific implementation provided in this application. By performing a BLAST search on the sequence of Arabidopsis thaliana SGS2 in the database, the SGS2 sequences of 10 other plants were obtained. Through sequence comparison analysis, it was found that the SGS2 proteins of 11 plants contained a high proportion of conserved sequences, conserved mutations, and semi-conserved mutations, suggesting that these regions are important and conserved in structure or function. In the figure, * represents conserved sequence (identical), : represents conservative mutation, · represents semi-conservative mutation, and - represents gap ( Figure 1A ).

[0314] Further, through domain prediction analysis, it was found that the SGS2 proteins of 11 plants all contained the sequence of RNA-dependent RNA polymerase domain (RdRP), and the SGS2 proteins of 10 plants contained the RNA recognition motif (RRM)( Figure 1B , Table 10), suggesting that the functions of SGS2 in 11 plants are highly similar. In Table 10, the E-value represents the expected value of the match. The smaller the E-value, the more significant the match and the more biological significance it has.

[0315] Table 10. Information table of conserved domains of plant SGS2 protein

[0316]

[0317] Example 2: Preparation of plasmids

[0318] The following plasmids were constructed according to the specific implementation provided in this application (Table 11) and stored at -20 °C for later use.

[0319] Table 11. Information table of plasmids in Preparation Examples 1-7

[0320]

[0321] Example 3: Preparation of Viruses

[0322] Prepare the following viruses (Table 12) according to the specific embodiments provided in this application, and store them at -80 °C for later use.

[0323] Table 12. Virus Information Table in Preparation Examples 8 - 10

[0324] Preparation example Virus number Plasmid number Inserted sequence 8 E9272 H37195 —— 9 E9273 H37196 SEQ ID NO: 14 10 E9274 H37197 SEQ ID NO: 23

[0325] Example 4: Determination of Virus Titer

[0326] Determine the virus titers of E9272, E9273, and E9274 according to the specific embodiments provided in this application. Perform serial dilutions on viruses E9272, E9273, and E9274 respectively, Figure 3 showing that viruses E9272, E9273, and E9274 are respectively diluted to 10 -5 、10 -6 ,10 -7 ,10 -8 4 concentrations. Pictures of Hexon staining are taken after infecting HEK - 293 cells. After viruses E9272, E9273, and E9274 are respectively diluted 1×10 7 times, as shown in Table 13, the average number of Hexon - stained positive cells calculated in 5 fields of view under the microscope are 17, 20, and 15 respectively, all meeting the requirement of having 5 - 50 Hexon - stained positive cells in the field of view. It can be calculated according to the formula: infectious units (ifu) / mL per well = (infected cells / field of view) × (number of fields of view per well 79) × (dilution factor) × (virus volume (mL)). After calculation, the titer of virus E9272 is 1.34×10 11 ifu / mL, the titer of virus E9273 is 1.58×10 11 ifu / mL, and the titer of virus E9274 is 1.18×10 11 ifu / mL.

[0327] Table 13. Virus Titer Information Table

[0328] Virus number The 1st field of view The 2nd field of view The 3rd field of view The 4th field of view The 5th field of view Average value Rounded average value Calculate titer value E9272 16 20 17 17 15 17 17 1.34E+11 E9273 26 18 18 16 21 19.8 20 1.58E+11 E9274 15 15 12 17 16 15 15 1.18E+11

[0329] Example 5: Detection of Transgene Expression Level after Viral Infection of Cells

[0330] Extract the total RNA of HEK-293 cells, HEK-293 cells infected with virus E9272, HEK-293 cells infected with virus E9273, and HEK-293 cells infected with virus E9274 according to the specific embodiments provided in this application, and detect whether the reference gene Gapdh and the transgenic SGS2 mRNA are specifically expressed and their expression levels in virus-infected cells. First, verify the specificity of the real-time fluorescence quantitative PCR reactions of the reference gene Gapdh and the transgenic SGS2 by collecting and analyzing the fluorescence signals of the melting curves. Figure 4A It is shown that the melting curve of the reference gene Gapdh in the samples of HEK-293 cells, HEK-293 cells infected with virus E9272, HEK-293 cells infected with virus E9273, and HEK-293 cells infected with virus E9274 is a tight single peak, indicating that the reference gene Gapdh is specifically expressed in all the above 4 samples. While the melting curve of the transgenic SGS2 in the samples of HEK-293 cells and HEK-293 cells infected with virus E9272 is a mixed multi-peak, and the melting curves of the transgenic SGS2 in the samples of HEK-293 cells infected with virus E9273 and HEK-293 cells infected with virus E9274 are tight single peaks, indicating that the transgenic SGS2 is specifically expressed only in the samples of HEK-293 cells infected with viruses E9273 and E9274.

[0331] Figure 4B It shows the relative expression levels of the transgenic SGS2 / reference gene in the samples of HEK-293 cells, HEK-293 cells infected with virus E9272, HEK-293 cells infected with virus E9273, and HEK-293 cells infected with virus E9274. The data are expressed as mean ± standard error, n = 3. The data were statistically analyzed using unpaired Student's t-test. *, **, and *** indicate p < 0.05, p < 0.01, and p < 0.001, respectively. Compared with the HEK-293 cells infected with the control virus E9272, the relative expression level of SGS2 / Gapdh in the HEK-293 cells infected with virus E9273 was 399064.90 ± 0.12 (p < 0.001). Compared with the HEK-293 cells infected with the control virus E9272, the relative expression level of SGS2 / Gapdh in the HEK-293 cells infected with virus E9274 was 1175045.72 ± 0.12 (p < 0.001). The above results indicate that the transgenic SGS2 is significantly highly expressed in the HEK-293 cells infected with viruses E9273 and E9274, respectively.

[0332] Example 6: Study on the selective killing of tumor cells by viruses

[0333] According to the specific embodiments provided in the present application, the selective killing effects of oncolytic adenoviruses E9272, E9273, and E9274 on SW780 cells and normal cells were evaluated using the CCK-8 method, so as to screen out the virus strain with the best oncolytic effect. MRC5 and HUVEC are human embryonic lung fibroblasts and human vascular endothelial cells, respectively, and are used as normal control cells in this example. According to the number of cells seeded per well in the 96-well plate and the titers of each oncolytic virus, the viruses E9272, E9273, or E9274 were used to infect tumor cells and normal cells at different multiplicities of infection (MOI; MOI 1, 3, 10, 30, 100, 300, 1000, 3000, 5000). As Figure 5 shown, the IC50 of virus E9273 against SW780 cells was 3.036 MOI (n = 3, R 2 = 0.9658), the IC50 of virus E9274 against SW780 cells was 3.183 MOI (n = 3, R 2 = 0.9725), while the IC50 of virus E9272 against SW780 cells was 12.16 MOI (n = 3, R 2 = 0.9871). The results suggest that viruses E9273 and E9274 showed better oncolytic effects on SW780 cells, and their killing effects on SW780 cells were better than those of virus E9272 on SW780 cells.

[0334] Meanwhile, the IC50 of virus E9273 against MRC5 cells was 14.09 MOI (n = 3, R 2 = 0.9907), the IC50 of virus E9274 against MRC5 cells was 30.03 MOI (n = 3, R 2 = 0.9873), while the IC50 of virus E9272 against MRC5 cells was 10.16 MOI (n = 3, R 2 = 0.9787). The IC50 of virus E9273 against HUVEC cells was 54.76 MOI (n = 3, R 2 = 0.9948), the IC50 of virus E9274 against HUVEC cells was 58.61 MOI (n = 3, R 2 = 0.9838), while the IC50 of virus E9272 against HUVEC cells was 31.25 MOI (n = 3, R 2= 0.9747). At the same MOI, the IC50 of viruses E9273 and E9274 on normal cells was higher than that of virus E9272 on normal cells, indicating that the killing effect of viruses E9273 and E9274 on normal cells was much lower than that on tumor cells. The above results suggest that viruses E9273 and E9274 exhibit good safety in in vitro cell model studies.

[0335] Example 7: Study on Selective Replication of Viruses in Different Cells

[0336] In this experiment, the probe-based qPCR method was used to detect the replication of the oncolytic virus to be tested in tumor cells and normal cells to evaluate the safety of the oncolytic virus to be tested.

[0337] Gradient-dilute the standard quality plasmid HEXON according to the specific implementation in Table 14 and store it at -20 °C for later use. The length of the standard quality plasmid is 5872 bp and the concentration is 340 ng / μL. According to the calculation formula: (6.02×10 23 )×(plasmid concentration ng / μL×10 -9 ) / (number of plasmid bases×660), it is converted into a copy number of 5.3E+10 copies / μL.

[0338] Table 14. Information Table of Gradient Dilution of Virus Standard Quality Plasmid

[0339] Plasmid number Dilution Concentration (copies / μL) STD0 40μL standard + 360μL ultrapure water 5.3E+09 STD1 40μL STD0 + 360μL ultrapure water 5.3E+08 STD2 40μL STD1 + 360μL ultrapure water 5.3E+07 STD3 40μL STD2 + 360μL ultrapure water 5.3E+06 STD4 40μL STD3 + 360μL ultrapure water 5.3E+05 STD5 40μL STD4 + 360μL ultrapure water 5.3E+04 STD6 40μL STD5 + 360μL ultrapure water 5.3E+03 STD7 40μL STD6 + 360μL ultrapure water 5.3E+02 STD8 40μL STD7 + 360μL ultrapure water 5.3E+01 STD9 40μL STD8 + 360μL ultrapure water 5.3E+00

[0340] First, verify the specificity of the real-time fluorescence quantitative PCR reaction of the virus genomic gene by collecting and analyzing the fluorescence signal of the melting curve. Figure 6A Show the standard curve graph of the virus genomic copy number. Perform linear regression with the LOG copy number as the x-axis and the Ct value as the y-axis. The linear equation of the standard curve: y = -3.682x + 41.62, R 2 = 0.999.

[0341] HEK-293 is a human embryonic kidney hypo-triploid cell line transformed by 75 strains of adenovirus type 5 and containing the Ad5E1 region, and it is an E1 region-deficient complementary cell line. Viruses E9272, E9273 or E9274 should have good replication ability in HEK-293 cells, and HEK-293 cells are used as positive control cells in this example. Extract the viral genomic DNA of each cell sample to be tested according to the specific implementation provided in this application, and detect the proliferation of the viral genomic gene in virus-infected cells. Figure 6BThe viral selective replication of oncolytic viruses E9272 and E9273 in tumor cells SW780 and normal cells HEK-293 and HUVEC is shown. In normal cells and tumor cells, the replication ability of oncolytic virus E9273 is weaker than that of oncolytic virus E9272. In normal cell HUVEC, oncolytic virus E9273 does not have the replication ability. In tumor cell SW780, oncolytic virus E9273 has a certain replication ability. In HEK-293 cells, oncolytic virus E9273 has a relatively strong replication ability. The above results indicate that oncolytic virus E9273 has a certain selective replication ability, that is, the replication ability of E9273 on tumor cells is relatively strong, and the replication ability on normal cells is relatively weak.

[0342] Example 8: Study on the selective expression of the foreign gene SGS2 of oncolytic virus in different cells

[0343] In this experiment, the RT-qPCR SYBR Green method was used to evaluate the expression of the foreign gene SGS2 of oncolytic virus after infecting tumor cells and normal cells. Figure 7 The relative expression levels of transgenic / housekeeping genes in tumor cells SW780 and normal cell HEK-293 and HUVEC cell samples infected with oncolytic viruses E9272 and E9273 are shown. The data are expressed as mean ± standard error, n = 3. Unpaired Student’s t-test was used for statistical analysis of the data. * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001. The results of Example 7 suggest that viruses E9272 and E9273 have good replication ability in HEK-293 cells, and the foreign gene SGS2 of the virus should have a relatively high expression level in HEK-293 cells. HEK-293 cells were used as positive control cells in this example.

[0344] Compared with HEK-293 cells without virus infection, the relative expression level of SGS2 / Gapdh in HEK-293 cells infected with virus E9272 was 4.73 ± 0.61, and the relative expression level of SGS2 / Gapdh in HEK-293 cells infected with virus E9273 was 840070.56 ± 0.26. The transgenic SGS2 was significantly highly expressed in HEK-293 cells infected with virus E9273 (p<0.001).

[0345] Compared with virus - free HEK - 293 cells, the relative expression level of SGS2 / Gapdh in virus - free SW780 cells was 4.73 ± 0.62, the relative expression level of SGS2 / Gapdh in SW780 cells infected with virus E9272 was 9.37 ± 1.46, and the relative expression level of SGS2 / Gapdh in SW780 cells infected with virus E9273 was 4595.05 ± 0.60. Transgenic SGS2 was significantly highly expressed in SW780 cells infected with virus E9273 (p < 0.001).

[0346] Compared with virus - free HEK - 293 cells, the relative expression level of SGS2 / Gapdh in virus - free HUVEC cells was 120.04 ± 1.66, the relative expression level of SGS2 / Gapdh in HUVEC cells infected with virus E9272 was 154.29 ± 0.92, and the relative expression level of SGS2 / Gapdh in HUVEC cells infected with virus E9273 was 1245.42 ± 0.41. Transgenic SGS2 was significantly highly expressed in SW780 cells infected with virus E9273 (p < 0.001).

[0347] Compared with HUVEC cells infected with oncolytic virus E9273, transgenic SGS2 was significantly highly expressed in both HEK - 293 cells and tumor cells SW780 infected with virus E9273 (p < 0.001, p < 0.001).

[0348] The above results indicate that oncolytic virus E9273 can express foreign genes on HEK - 293 cells, SW780 tumor cells and HUVEC normal control cells, but the expression is significantly decreased in HUVEC normal control cells.

[0349] Example 9: Pharmacodynamic research protocol for tumor - bearing mice with subcutaneous xenograft tumor model of SW780 cells after treatment with oncolytic virus

[0350] Group the experimental animals and administer drugs according to the specific implementation methods provided in this application (Table 15).

[0351] Table 15. Information table of experimental animal grouping and drug administration plan for in - vivo pharmacodynamic experiments

[0352] Group N Dose (ifu / animal) Route of administration Frequency of administration SW780 + Vehicle 5 —— i.t. TIW×4W SW780 + E9272 low dose 5 1E7 i.t. TIW×4W SW780 + E9272 medium dose 5 1E8 i.t. TIW×4W SW780 + E9272 high dose 5 1E9 i.t. TIW×4W SW780 + E9273 low dose 5 1E7 i.t. TIW×4W SW780 + E9273 medium dose 5 1E8 i.t. TIW×4W SW780 + E9273 high dose 5 1E9 i.t. TIW×4W

[0353] Example 10: Monitoring of mortality, morbidity and body weight of tumor - bearing mice with subcutaneous xenograft tumor model of SW780 cells after treatment with oncolytic virus

[0354] The body weight of experimental animals is an important reference index for indirectly measuring drug toxicity. Figure 8The change curves of the body weights of mice in each group in the subcutaneous xenograft tumor model of human bladder cancer cell SW780 after administration of oncolytic viruses E9272 and E9273 are shown. The data points represent the average body weight within the group, and the error bars represent the standard error of the mean (SEM), n = 5. The results show that all groups of mice showed good tolerance, without morbidity and mortality.

[0355] Example 11: Efficacy study of tumor-bearing mice in the subcutaneous xenograft tumor model of SW780 cells after treatment with oncolytic viruses

[0356] According to the specific implementation provided in this application, the tumor volumes of mice in each group at different time points after treatment with oncolytic viruses were measured and calculated in the subcutaneous xenograft tumor model of human bladder cancer cell SW780 established on male Balb / c nude mice (Table 16, Figure 9 ). Based on the tumor volumes, the relative tumor growth rates of mice in each group at different time points ( Figure 10 ), the tumor growth inhibition rates TGI (%) of mice in each group (Table 17), and the relative tumor proliferation rates T / C (%) of mice in each group (Table 18) were calculated.

[0357] Table 16. Information table of tumor volumes of each experimental animal group at different time points

[0358]

[0359] Table 17. Information table of tumor growth inhibition rates TGI (%) of each experimental animal group at different time points

[0360]

[0361]

[0362] Table 18. Information table of relative tumor proliferation rates T / C (%) of each experimental animal group at different time points

[0363]

[0364] The tumor volume data of each experimental animal group 31 days after grouping were statistically analyzed among multiple groups using two-way ANOVA test with GraphPad Prism 10.1.2 software (Table 19), ns, p > 0.05; *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.

[0365] Table 19. Information table of in vivo efficacy evaluation of oncolytic viruses on the subcutaneous xenograft tumor model of tumor cell SW780

[0366]

[0367]

[0368] Note: a. ns, p > 0.05; *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001.

[0369] The above results indicate that 31 days after administration, compared with the Vehicle control group, any oncolytic virus treatment had a significant tumor inhibitory effect. Compared with the low-dose group of oncolytic virus E9272, the medium-dose group of E9272 had no obvious tumor inhibitory effect, while the high-dose group of E9272 had an obvious tumor inhibitory effect. Compared with the low-dose group of oncolytic virus E9273, both the medium-dose and high-dose groups of E9273 had a significant tumor inhibitory effect, and had a dose-dependent effect. Compared with the medium-dose and high-dose groups of oncolytic virus E9272, the same dose of oncolytic virus E9273 had a more significant therapeutic effect on SW780, and SGS2 showed a significant tumor inhibitory effect in the subcutaneous xenograft tumor model of tumor cell SW780.

[0370] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not limitations on the implementation manners of the present invention. For those of ordinary skill in the art, without departing from the principles and purposes of the present invention, various changes, alterations, substitutions, and modifications made on the basis of the present invention are still within the protection scope of the present invention.

[0371] Sequences in this article:

[0372] The amino acid sequence of Medicago truncatula SGS2 shown in SEQ ID NO: 1 (sequence registration number: XP_039687766) is as follows:

[0373]

[0374] The amino acid sequence of Gossypium hirsutum SGS2 shown in SEQ ID NO: 2 (sequence registration number: ADG57590) is as follows:

[0375]

[0376] The Arabidopsis thaliana SGS2 amino acid sequence shown in SEQ ID NO: 3 (sequence registration number: NP_190519) is as follows:

[0377]

[0378] The Nicotiana benthamiana SGS2 amino acid sequence shown in SEQ ID NO: 4 (sequence registration number: AAU21242) is as follows:

[0379]

[0380] The Nicotiana tabacum SGS2 amino acid sequence shown in SEQ ID NO: 5 (sequence registration number: BAF96019) is as follows:

[0381]

[0382] The Nicotiana glutinosa SGS2 amino acid sequence shown in SEQ ID NO: 6 (sequence registration number: ACO72600) is as follows:

[0383]

[0384] The Solanum lycopersicum SGS2 amino acid sequence shown in SEQ ID NO:7 (sequence registration number: NP_001266205 XP_004236660) is as follows:

[0385]

[0386] The Zea mays SGS2 amino acid sequence shown in SEQ ID NO: 8 (sequence registration number: NP_001142097) is as follows:

[0387]

[0388] The amino acid sequence of Hordeum vulgare SGS2 shown in SEQ ID NO: 10 (sequence registration number: ACI16098) is as follows:

[0389]

[0390] The Physcomitrella patens SGS2 amino acid sequence shown in SEQ ID NO: 11 (sequence registration number: ABF82438) is as follows:

[0391]

[0392] The nucleotide sequence of SEQ ID NO: 23 is as follows:

[0393]

Claims

1. Use of an agent in the preparation of a drug for killing bladder cancer cells or treating bladder cancer, the agent comprising: SGS2 protein or its functional variant, a nucleic acid molecule encoding the same, a nucleic acid construct, a virus, and / or a cell, wherein The nucleic acid construct comprises: (i) a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, (ii) a nucleic acid sequence having at least 80% sequence identity with (i) and encoding an SGS2 protein or a functional variant thereof, or (iii) the reverse complementary sequence of (i) or (ii), The virus comprises: (i) a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, (ii) a nucleic acid sequence having at least 80% sequence identity with (i) and encoding an SGS2 protein or a functional variant thereof, or (iii) a reverse complementary sequence of (i) or (ii); The cell: (1) contains, expresses and / or secretes SGS2 protein or a variant thereof having at least 80% sequence identity and retaining function, (2) contains the following sequences: i) a nucleic acid sequence encoding SGS2 protein or a functional variant thereof, ii) a nucleic acid sequence having at least 80% sequence identity with i) and encoding SGS2 protein or a functional variant thereof, and / or, iii) a reverse complementary sequence of i) or ii), (3) contains the nucleic acid construct, and (4) contains the virus.

2. The use according to claim 1, characterized in that The SGS2 protein or its functional variant is from a plant, preferably, the plant includes Medicago truncatula, cotton, Arabidopsis thaliana, Nicotiana benthamiana, tobacco, Nicotiana cordifolia, tomato, corn, rice, barley, Physcomitrella patens, more preferably, the plant is Arabidopsis thaliana, tobacco, or rice.

3. The use according to claim 1 or 2, characterized in that: The functional variant of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.

4. The use according to claim 1 or 2, characterized in that: The amino acid sequence of the SGS2 protein is any one of SEQ ID NOs: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NOs: 1-11.

5. The use according to claim 1 or 2, characterized in that: The nucleic acid construct comprises: (i) a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NOs: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NOs: 1-11, (ii) a nucleic acid sequence having at least 80% sequence identity with (i) and encoding the SGS2 protein shown in SEQ ID NO: 1-11 or a functional variant thereof, or (iii) the reverse complement of (i) or (ii); Preferably, the nucleic acid sequence of the SGS2 protein or its functional variant is as shown in any one of sequences 12-23.

6. The use according to claim 5, characterized in that The nucleic acid construct is a vector or mRNA; preferably, the vector is a cloning vector, an integration vector or an expression vector; more preferably, the vector is a viral vector.

7. The use according to claim 1 or 2, characterized in that: The viruses include: (i) a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NOs: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NOs: 1-11, (ii) a nucleic acid sequence having at least 80% sequence identity with (i) and encoding the SGS2 protein shown in SEQ ID NO: 1-11 or a functional variant thereof, and / or (iii) the reverse complement of (i) or (ii), Preferably, The virus includes adeno-associated virus, adenovirus, retrovirus, and / or The virus comprises the nucleic acid construct.

8. The use according to claim 1 or 2, characterized in that: The cell: (1) comprising, expressing and / or secreting SGS2 protein or a variant thereof having at least 80% sequence identity and retaining function, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NOs: 1-11, (2) comprising the following sequences: i) a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NOs: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NOs: 1-11, ii) a nucleic acid sequence having at least 80% sequence identity with i) and encoding an SGS2 protein or a functional variant thereof as shown in SEQ ID NOs: 1-11, and / or, iii) a reverse complementary sequence of i) or ii), (3) comprising the nucleic acid construct, (4) comprising the virus. Preferably, the cells are HEK-293 cells.

9. The use according to claim 1 or 2, characterized in that The agent or drug comprises a delivery system.

10. The use according to claim 9, characterized in that The delivery system is a viral vector or a non-viral vector.

Images