Use of micro RNA-2184 in promoting axonal regeneration and recovery of central nervous system

Abstract

The invention provides a method for regulating in-vivo central nervous system axon regeneration by using micro RNA-2184. The invention also provides micro RNA-2184 as a new target for treating central nervous system axon regeneration and recovery by using micro RNA-2184 as a small molecule substance. When the micro RNA-2184 is overexpressed in vivo, axon regeneration and recovery of a central nervous system are remarkably facilitated, and axon regeneration and recovery of the central nervous system can be inhibited by silent deletion of the micro RNA-2184.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and particularly relates to a microRNA-2184 and its use in promoting axonal regeneration and recovery in the central nervous system. Background Art

[0002] In modern society, central nervous system injury is a common phenomenon, which is characterized by nerve axon breakage and is common in various accidents induced by external forces, such as car accidents, falls, etc. Axon injury will lead to the loss of nerves, bringing great inconvenience to the lives of patients. At the current treatment level, there are few successful cases of axon repair problems in life and clinically. The main reason is that the axons of central neurons in higher animals can hardly regenerate after injury, resulting in difficulty in the nerves returning to normal. Therefore, exploring the molecular mechanism of axonal regeneration after central neuron axon injury can help us understand the principle of regeneration, which is conducive to promoting the repair of central neuron axon injury.

[0003] As one of the endogenous factors of axonal regeneration, microRNAs are a class of endogenous small RNAs with a length of about 20-24 nucleotides and are found to have important regulatory functions in various cells. MicroRNA-2184 is a novel miRNA identified by reading a small RNA library extracted from samples collected from zebrafish at different developmental stages and then through high-throughput sequencing microchips. Its current functional role is not yet clear, and there is no research on microRNA-2184 participating in the regulation of axonal regeneration. Summary of the Invention

[0004] The problem to be solved by the present invention is to provide the application of microRNA-2184 in promoting nerve axon regeneration and recovery. Overexpression of microRNA-2184 in vivo can significantly promote the regeneration of neuronal axons, providing a new treatment method and target for the axonal regeneration of central neurons.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] On the one hand, the present invention provides the use of a reagent for promoting the expression of microRNA-2184 in the preparation of a drug for promoting axonal regeneration and recovery in the central nervous system.

[0007] In some embodiments, the reagent includes a system for overexpressing microRNA-2184.

[0008] In some embodiments, the GAL4 / UAS molecular system is used to overexpress microRNA-2184. The GAL4 gene and the UAS gene are located on two expression vectors respectively. The nucleotide sequence of the microRNA-2184 is ligated to the downstream of the UAS gene, and the CMV promoter is ligated to the upstream of the GAL4 gene. After the GAL4 gene binds to the UAS gene, it strongly initiates the expression of the microRNA-2184.

[0009] In some embodiments, the promoter is the CMV promoter.

[0010] In some embodiments, the nucleotide sequence of the CMV promoter is as shown in SEQ ID NO:2.

[0011] In some embodiments, the nucleotide sequence of the GAL4 gene is as shown in SEQ ID NO:3.

[0012] In some embodiments, the nucleotide sequence of the UAS gene is as shown in SEQ ID NO:4.

[0013] On the other hand, the present invention provides a pharmaceutical composition for promoting axonal regeneration and recovery of the central nervous system, which is characterized in that the composition contains a reagent for promoting the expression of microRNA-2184.

[0014] In some embodiments, the mature microRNA-2184 contains the sequence as shown in SEQ ID NO:1, and the precursor nucleotide sequence of the microRNA-2184 molecule is as shown in SEQ ID NO:5.

[0015] On the other hand, the present invention provides a method for screening drugs for promoting axonal regeneration and recovery of the central nervous system, which includes detecting the expression level of the microRNA-2184 small molecule.

[0016] On the other hand, the present invention provides a pharmaceutical composition for promoting axonal regeneration and recovery of the central nervous system, which is characterized in that the pharmaceutical composition contains a reagent for promoting the expression of microRNA-2184 and a pharmaceutically acceptable carrier.

[0017] On the other hand, the present invention provides the use of a reagent or nucleic acid construct for overexpressing microRNA-2184 in the preparation of a drug for promoting axonal regeneration and recovery of the central nervous system of a subject.

[0018] On the other hand, the present invention provides a method for promoting axonal regeneration and recovery of the central nervous system, which is characterized in that the method includes administering an effective amount of microRNA-2184 to a subject or overexpressing microRNA-2184 in the subject.

[0019] An embodiment of the present invention provides a microRNA-2184, which can be used as a small molecule target for the repair of central nerve axon injury.

[0020] The present invention also provides the use of microRNA-2184 for preparing a drug for promoting nerve axon regeneration and recovery.

[0021] In some embodiments, drugs can be screened or nerve injury can be verified by using a model of unilateral axon of Mauthner neurons in zebrafish damaged by two-photon ablation.

[0022] The present invention also provides the application of microRNA-2184 in promoting nerve axon regeneration and recovery, including the following verification steps:

[0023] S1. Obtain zebrafish with green fluorescent protein-labeled Mauthner neurons, and use single-cell electroporation technology to overexpress microRNA-2184 in single cells. After using two-photon laser to ablate the axons of zebrafish, observe the promotion of axon regeneration by its overexpression;

[0024] S2. Use the GAL4 / UAS molecular system to overexpress a sponge plasmid vector by electroporation in zebrafish with green fluorescent protein-labeled Mauthner neurons. After using two-photon laser to ablate its axons, the expression of the sponge plasmid vector will hinder the normal expression of microRNA-2184. Observe the inhibition of axon regeneration by the silencing and deletion of miRNA-2184;

[0025] Among them, the specific steps of step S1 are as follows:

[0026] S1.1. In the evening of the first day, separate three female zebrafish of strain T056 from two male WT zebrafish with a partition and place them in the same spawning tank, and culture them overnight for 12 h under dark conditions.

[0027] S1.2. In the early morning of the second day, place all the zebrafish in a bright place, remove the partition and mix the male and female zebrafish.

[0028] S1.3. After the zebrafish finish spawning, recover the zebrafish and collect the one-cell stage zebrafish eggs produced.

[0029] S1.4. Transfer the zebrafish eggs to a glass culture dish, remove the unfertilized and dead eggs, and place them in a bright incubator for 24 h.

[0030] S1.5. Take out the zebrafish eggs, change the water and remove the dead eggs, add an appropriate amount of PTU to inhibit pigment formation, and continue to place them in the incubator for 24 h.

[0031] S1.6. Take out the zebrafish eggs, change the water and remove the dead fish and dead eggs, add an appropriate amount of PTU to inhibit pigment formation, and continue to place them in the incubator for 48 h.

[0032] S1.7. Remove zebrafish larvae four days post-fertilization (4 dpf), anesthetize them with MS222, and fix them on a special electroporation plate with 1% melted agarose.

[0033] S1.8. Mix the CMV-GAL4 and UAS-mCherry-miR-2184 plasmids in a certain proportion and add a certain amount of red fluorescent dye.

[0034] S1.9. Transfer the mixed plasmids to a pre-pulled glass electrode wire with a fine pipette tip and install it on the micromanipulator of the electroporation stage.

[0035] S1.10. Place the fixed zebrafish larvae under a confocal microscope, and bring the manipulation electrode wire into contact with the soma of the Mauthner neuron under the microscope, apply an electric stimulus, so that the successful transfection of the soma shows red fluorescence.

[0036] S1.11. Release the fixed zebrafish larvae and place them in an incubator for 24 h.

[0037] S1.12. Take out the zebrafish, change the water and remove the dead fish, and place them in an incubator for 24 h.

[0038] S1.13. Remove zebrafish larvae six days post-fertilization (6 dpf), anesthetize them with MS222 and fix them on a glass slide with 1% melted agarose.

[0039] S1.14. Place the glass slide with the fixed zebrafish larvae under a confocal microscope equipped with a two-photon laser, search for the axon site near the cloaca, and use the high-energy two-photon laser to damage the axon at a wavelength of 800 nm.

[0040] S1.15. Release the zebrafish larvae after axon injury and place them in an incubator for 24 h.

[0041] S1.16. Take out the zebrafish, change the water and remove the dead fish, and place them in an incubator for 24 h.

[0042] S1.17. Take out the zebrafish, anesthetize them with MS222 and fix them on a glass slide with 1% melted agarose.

[0043] S1.18. Place the fixed zebrafish larvae under a confocal microscope, image the axon regeneration situation, and take pictures to count the lengths of each group.

[0044] Among them, the specific steps of step S2 are as follows:

[0045] S2.1. On the evening of the first day, separate three female zebrafish of the T056 strain from two WT male zebrafish with a partition and place them in the same spawning tank for overnight culture for 12 h under dark conditions.

[0046] S2.2. In the early morning of the second day, place all the zebrafish in a bright place, remove the partition and mix the male and female zebrafish.

[0047] S2.3. After the zebrafish finish spawning, recover the zebrafish and collect the one-cell stage zebrafish eggs produced.

[0048] S2.4. Transfer the zebrafish eggs to a glass culture dish, remove the unfertilized and dead eggs, and place them in a bright incubator for 24 h.

[0049] S2.5. Take out the zebrafish eggs, change the water and remove the dead eggs, add an appropriate amount of PTU to inhibit pigment formation, and continue to place them in the incubator for 24 h.

[0050] S2.6. Take out the zebrafish eggs, change the water and remove the dead fish and dead eggs, add an appropriate amount of PTU to inhibit pigment formation, and continue to place them in the incubator for 48 h.

[0051] S2.7. Take out the zebrafish larvae at four days post-fertilization (4 dpf), anesthetize them with MS222 and fix them on a special electroporation plate with 1% melted agarose.

[0052] S2.8. Mix the CMV-GAL4 and UAS-mCherry-sponge 2184 plasmids in proportion and add a certain amount of red fluorescent dye.

[0053] S2.9. Transfer the mixed plasmids to a pre-pulled glass electrode wire with a fine pipette tip and install it on the mechanical micromanipulator of the electroporation stage.

[0054] S2.10. Place the fixed zebrafish larvae under a confocal microscope, and under the microscope, make the manipulation electrode wire contact the cell body of the Mauthner neuron, apply an electric stimulus, so that the cell body transfection is successful and shows red fluorescence.

[0055] S2.11. Release the fixed zebrafish larvae and place them in the incubator for culture for 24 h.

[0056] S2.12. Take out the zebrafish, change the water and remove the dead fish, and place them in the incubator for 24 h.

[0057] S2.13. Take out the zebrafish larvae at six days post-fertilization (6 dpf), anesthetize them with MS222 and fix them on a glass slide with 1% melted agarose.

[0058] S2.14. Place the slide with zebrafish larvae fixed thereon under a confocal microscope equipped with a two-photon laser, search for the axon site near the cloaca, and damage the axon using a high-energy two-photon laser at a wavelength of 800 nm.

[0059] S2.15. Release the zebrafish larvae after axon injury and place them in an incubator for 24 h.

[0060] S2.16. Take out the zebrafish, change the water and remove the dead fish, and place them in an incubator for 24 h.

[0061] S2.17. Take out the zebrafish, anesthetize it with MS222 and fix it on a slide with 1% melted agarose.

[0062] S2.18. Place the fixed zebrafish larvae under a confocal microscope, image their axon regeneration, and take pictures to count the lengths of each group.

[0063] Definition

[0064] GAL4 / UAS: GAL4 / UAS is a gene expression regulation system existing in yeast. UAS is the abbreviation of upstream activating sequence. GAL4 is a transcriptional regulatory factor. After its binding domain (BD) binds to the UAS sequence, its activation domain (AD) binds to the promoter region, thereby inducing gene expression. The key point of the GAL4 / UAS system is that the GAL4 and UAS genes exist in two transgenic lines respectively. There is a transcriptional activator in the GAL4 transgenic line, but no target gene. The establishment of the system requires a tissue-specific promoter or enhancer. In the UAS-target gene line, the target gene to be needed is inserted downstream of the UAS, and then the UAS-transgenic line can be established. Since there is no transcriptional activation in the UAS-target gene line, the target gene is in a silent state. Only by crossing the GAL4 transgenic line with the UAS-target gene line can offspring specifically expressing the target gene be produced, which can be used for gene overexpression, gene knockout and cell-specific deletion.

[0065] mCherry: A red fluorescent small molecule, widely used in biotechnology as a tracer. It has low cytotoxicity and is superior to other fluorescent small molecule tags.

[0066] CMV promoter: Derived from cytomegalovirus, it is a recognized strong promoter for initiating eukaryotic gene expression and is widely used for constructing high-efficiency eukaryotic expression vectors.

[0067] miRNA: MicroRNA, a class of endogenous small RNAs with a length of about 20 - 24 nucleotides.

[0068] Sponge plasmid: A molecule that can adsorb numerous miRNAs like a sponge absorbs water. A typical sponge structure contains 4 to 10 miRNA binding sites, and each binding site contains a mismatch in the middle position to avoid being affected by Ago2-mediated endonuclease, and is used for long-term silencing of the corresponding miRNA

[0069] "Reagent" or "reagent for promoting the expression of microRNA-2184": In this article, the terms "reagent" or "reagent for promoting the expression of microRNA-2184" should be understood in a broad sense. For example, the terms "reagent" or "reagent for promoting the expression of microRNA-2184" can include any substance that increases the level of microRNA-2184 in a subject relative to when the reagent is not used. In some embodiments, the level of microRNA-2184 in a subject can be increased by administering microRNA-2184 to the subject. Thus, in this sense, "reagent for promoting the expression of microRNA-2184" can include microRNA-2184 itself. In some embodiments, the level of microRNA-2184 in a subject can be increased by administering an expression vector or nucleic acid construct that promotes the expression of microRNA-2184 to the subject. In some embodiments, the expression vector or nucleic acid construct for promoting the expression of microRNA-2184 can include any appropriate elements such as promoters and enhancers that promote the expression of microRNA-2184. In some embodiments, the expression vector for promoting the expression of microRNA-2184 can include an expression vector, plasmid, functional gene fragment, etc. that can overexpress microRNA-2184.

[0070] The beneficial effects of the present invention include, for example:

[0071] 1. The present invention uses microRNA-2184 as a small molecule intervention target, and shows that overexpression of microRNA-2184 promotes axonal regeneration of neurons.

[0072] 2. The present invention uses microRNA-2184 as a small molecule intervention target, and shows that inhibition of the expression of microRNA-2184 leads to weakened axonal regeneration of neurons.

[0073] 3. The microRNA-2184 provided by the present invention can promote the recovery of zebrafish by promoting axonal regeneration of neurons, which helps to better understand the important role of microRNA-2184 in the process of nerve axon injury repair, and provides a new target for the treatment after axon injury. Brief Description of the Drawings

[0074] Figure 1 It is a schematic diagram showing that in vivo overexpression of microRNA-2184 in Example 1 of the present invention can significantly promote axonal regeneration of Mauthner neurons in zebrafish. Figure 1A shows the comparison of axon regeneration of Mauthner neurons between the in-vivo empty UAS-mCherry (negative control) and UAS-mCherry-miR-2184. Bar = 50 μm. Figure 1 B shows the axon statistical chart of axon regeneration of Mauthner neurons between the in-vivo empty UAS-mCherry (negative control) and UAS-mCherry-miR-2184. ****P < 0.0001.

[0075] Figure 2 This is a schematic diagram showing that overexpressing the sponge knockdown plasmid in vivo to inhibit the expression level of microRNA-2184 in Example 2 of the present invention will inhibit the axon regeneration of zebrafish Mauthner neurons. Figure 2 A shows the comparison of axon regeneration of Mauthner neurons between the in-vivo empty UAS-mCherry (negative control) and UAS-mCherry-sponge 2184 microRNA-2184. Figure 2 B shows the axon statistical chart of axon regeneration of Mauthner neurons between the in-vivo empty UAS-mCherry (negative control) and UAS-mCherry-sponge 2184. ****P < 0.0001 Detailed implementation manners

[0076] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to specific embodiments and the accompanying drawings.

[0077] The present invention provides a small molecule target microRNA-2184 (SEQ ID NO: 1, the sequence is from zebrafish, NCBI ID: 337737), which significantly promotes axon regeneration during the repair of central nerve axon injury.

[0078] MicroRNA-2184 is used to prepare a drug for promoting nerve axon regeneration and nerve recovery, and the nerve axon injury is the two-photon ablation of the axon of zebrafish Mauthner neurons.

[0079] The present invention also provides the application of microRNA-2184 in promoting nerve axon regeneration and nerve recovery, including the following verification steps:

[0080] S1. Obtain zebrafish with green fluorescent-labeled Mauthner neurons, and use the single-cell electroporation technique to overexpress microRNA-2184 in a single cell. After using two-photon laser to ablate its axon, observe the situation of its overexpression promoting axon regeneration;

[0081] S2. Use the GAL4 / UAS molecular system to overexpress the sponge plasmid vector in zebrafish with green fluorescent protein-labeled Mauthner neurons. After using two-photon laser to damage their axons, the expression of the sponge plasmid vector will hinder the normal expression of microRNA-2184, and observe the situation where the silencing deletion of miRNA-2184 inhibits axon regeneration.

[0082] Example 1. Effects of overexpressing microRNA-2184 on axon regeneration

[0083] Obtain zebrafish with green fluorescent protein-labeled Mauthner neurons, and use single-cell electroporation technology to overexpress microRNA-2184 in single cells. After using two-photon laser to damage their axons, observe the situation where its overexpression promotes axon regeneration. The specific steps are as follows:

[0084] 1.1. Obtain zebrafish with green fluorescent protein-labeled Mauthner neurons

[0085] 1.1.1. On the first night, place three female zebrafish of T056 strain (obtained from RIKEN, Saitama, Japan) and two male WT zebrafish (purchased from China Zebrafish Resource Center, CZ1) separately in the same spawning tank with a partition, and culture overnight for 12 h in the dark to promote spawning.

[0086] 1.1.2. In the early morning of the next day, place all zebrafish in a bright place, remove the partition and mix male and female zebrafish.

[0087] 1.1.3. After the zebrafish finish spawning, recover the zebrafish and collect the one-cell stage zebrafish eggs produced.

[0088] 1.1.4. Transfer the zebrafish eggs to a glass culture dish, remove unfertilized and dead eggs, and place them in a bright incubator for 24 h.

[0089] 1.1.5. Take out the zebrafish eggs, change the water and remove dead eggs, add an appropriate amount of PTU (N-phenylthiourea, Sigma, P7629) to inhibit pigment formation. Continue to place them in the incubator for 24 h.

[0090] 1.1.6. Take out the zebrafish eggs, change the water and remove dead fish and dead eggs, add an appropriate amount of PTU to inhibit pigment formation. Continue to place them in the incubator for 48 h.

[0091] 1.2. Electroporate to overexpress microRNA-2184 in Mauthner neurons in zebrafish

[0092] 1.2.1. Take out the T056 zebrafish larvae at four days post-fertilization (4 dpf), anesthetize them with MS222 (ethyl 3-aminobenzoate, Sigma, E10521), and fix them on a 2% agarose electroporation plate wrapped with copper wire using 1% melted agarose.

[0093] 1.2.2. Mix the CMV-GAL4 (Cytomegalovirus-Galactokinase4, with CMV as the promoter and the GAL4 sequence derived from yeast. GAL4 can initiate the expression of downstream small molecules when combined with UAS) and the constructed UAS-mCherry-miR-2184 (Upstream activating sequence-mCherry-microRNA-2184, with the UAS sequence from yeast) plasmids in a 1:1 ratio to a final concentration of 200 ng / μL, and add 1 μL of alexa 488 / 594 nm red fluorescent dye (Sigma, 1623-7) to indicate the entry of the plasmid.

[0094] 1.2.3. Transfer all the mixed plasmids to a pre-pulled electrode (the electrode wire is similar to a reduced needle tip with a volume larger than that of the configured plasmid) using a fine pipette tip, and install it on a micromanipulation device (an instrument that can step in micrometers and can achieve three-axis movement for fine adjustment of the needle tip position).

[0095] 1.2.4. Place the fixed zebrafish larvae under a confocal microscope, and under the microscope, bring the electrode wire into contact with the soma of the Mauthner neuron, and apply an electric stimulus to successfully transfect the soma and show red fluorescence.

[0096] 1.2.5. Release the fixed zebrafish larvae and place them in an incubator for 24 h.

[0097] 1.2.6. Take out the zebrafish, change the water and remove the dead fish, and place them in an incubator for 24 h.

[0098] 1.3. Double-photon ablation of the axons of zebrafish Mauthner neurons

[0099] 1.3.1. Take out the T056 zebrafish larvae at six days post-fertilization (6 dpf), anesthetize them with MS222, and fix them on a glass slide using 1% melted agarose.

[0100] 1.3.2. Place the glass slide with the fixed zebrafish larvae under a confocal microscope equipped with a two-photon laser, search for the axon site near the cloaca, and use the high energy of the two-photon laser at 800 nm to ablate the axons.

[0101] 1.3.3. Release the zebrafish larvae after axonal injury and place them in an incubator for 24 h.

[0102] 1.3.4. Take out the zebrafish, change the water and remove the dead fish, and place them in an incubator for 24 h.

[0103] 1.4. Observe the effect of overexpressing microRNA-2184 on the axonal regeneration of zebrafish Mauthner neurons

[0104] 1.4.1. Take out the T056 zebrafish, anesthetize it with MS222 and fix it on a glass slide with 1% melted agarose.

[0105] 1.4.2. Place the fixed zebrafish larvae under a confocal microscope, image their axonal regeneration, and take pictures to count the lengths of each group.

[0106] The results showed that overexpressing microRNA-2184 could significantly promote the axonal regeneration of zebrafish Mauthner neurons ( Figure 2 ), among which, Figure 1 A shows the comparison of axonal regeneration of Mauthner neurons between the in vivo empty UAS-mCherry (negative control) and UAS-mCherry-miR-2184, Bar = 50 μm. Figure 1 B is the axon statistical chart of axonal regeneration of Mauthner neurons between the in vivo empty UAS-mCherry (negative control) and UAS-mCherry-miR-2184. The regrowth length of the UAS-mCherry-miR-2184 group increased by about 169% compared with the control group (UAS+injured: n = 10; OE microRNA-2184+injured: n = 8, using unpaired t test). ****P<0.0001.

[0107] Example 2. Effect of inhibiting the expression of microRNA-2184 on axonal regeneration

[0108] Mate female T056 zebrafish with WT male zebrafish to obtain zebrafish with green fluorescent-labeled Mauthner, and use a sponge plasmid to inhibit the expression of microRNA-2184 and observe the axonal regeneration of Mauthner. The specific steps are as follows:

[0109] 2.1. Obtain zebrafish with green fluorescent-labeled Mauthner neurons

[0110] 2.1.1. Separate three female T056 strain zebrafish and two WT male zebrafish with a partition and place them in the same spawning tank, and treat them overnight for 12 h under dark conditions.

[0111] 2.1.2. In the morning, place all zebrafish in a well-lit area, remove the partition, and mix male and female zebrafish.

[0112] 2.1.3. After zebrafish finish spawning, recover the zebrafish and collect the one-cell stage zebrafish eggs produced.

[0113] 2.1.4. Transfer the zebrafish eggs to a glass petri dish, remove unfertilized and dead eggs, and place them in a well-lit incubator for 24 h.

[0114] 2.1.5. Take out the zebrafish eggs, change the water, remove dead eggs, add an appropriate amount of PTU to inhibit pigment formation. Continue to place them in the incubator for 24 h.

[0115] 2.1.6. Take out the zebrafish eggs, change the water, remove dead fish and dead eggs, add an appropriate amount of PTU to inhibit pigment formation. Continue to place them in the incubator for 96 h.

[0116] 2.2. Electrotransfect the overexpressed sponge plasmid to inhibit RNA-2184 in the Mauthner neurons of zebrafish

[0117] 2.2.1. Take out the T056 zebrafish larvae at four days post-fertilization (4 dpf), anesthetize them with MS222 (ethyl 3-aminobenzoate, Sigma, E10521), and fix them on a 2% agarose electroporation plate wrapped with copper wire using 1% melted agarose.

[0118] 2.2.2. Mix the CMV-GAL4 (Cytomegalovirus-Galactokinase4, with CMV as the promoter and the GAL4 sequence derived from yeast. GAL4 can bind to UAS to initiate the expression of downstream small molecules) and the constructed UAS-mCherry-sponge 2184 (Upstream activating sequence-mCherry-sponge 2184, with the UAS sequence from yeast) plasmids in a 1:1 ratio to a final concentration of 200 ng / μL, and add 1 μL of alexa 488 / 594 nm red fluorescent dye (Sigma, 1623-7) to indicate the entry of the plasmid.

[0119] 2.2.3. Transfer all the mixed plasmids to a pre-pulled electrode (the electrode wire is similar to a reduced needle head and has a volume larger than the volume of the configured plasmid) using a fine pipette tip, and install it on a micromanipulation device (an instrument that can step in micrometers and can achieve three-axis movement for fine adjustment of the needle position).

[0120] 2.2.4. Place the fixed zebrafish larvae under a confocal microscope. Under the microscope, bring the electrode wire into contact with the soma of the Mauthner neuron and apply an electrical stimulus so that successful transfection of the soma shows red fluorescence.

[0121] 2.2.5. Release the fixed zebrafish larvae and place them in an incubator for 24 h.

[0122] 2.2.6. Take out the zebrafish, change the water and remove the dead fish, and place them in an incubator for 24 h.

[0123] 2.3. Double-photon ablation of the axon of the zebrafish Mauthner neuron

[0124] 2.3.1. Take out the T056 zebrafish larvae at six days post-fertilization (6 dpf), anesthetize them with MS222 and fix them on a glass slide with 1% melted agarose.

[0125] 2.3.2. Place the glass slide with the fixed zebrafish larvae under a confocal microscope equipped with a two-photon laser, search for the axon site near the cloaca, and use the high energy of the two-photon laser at a wavelength of 800 nm to ablate the axon.

[0126] 2.3.3. Release the zebrafish larvae with axon damage and place them in an incubator for 24 h.

[0127] 2.3.4. Take out the zebrafish, change the water and remove the dead fish, and place them in an incubator for 24 h.

[0128] 2.4. Observe the effect of overexpressing the sponge plasmid to inhibit microRNA-2184 on the axon regeneration of the zebrafish Mauthner neuron

[0129] 2.4.1. Take out the T056 zebrafish, anesthetize them with MS222 and fix them on a glass slide with 1% melted agarose.

[0130] 2.4.2. Place the fixed zebrafish larvae under a confocal microscope, image their axon regeneration, and take pictures to count the lengths of each group.

[0131] The results showed that overexpression of the sponge plasmid to inhibit microRNA-2184 could significantly promote the axon regeneration of the zebrafish Mauthner neuron ( Figure 2 ), among which, Figure 2 A is the comparison of axon regeneration of the Mauthner neuron between the in vivo empty UAS-mCherry (negative control) and UAS-mCherry-sponge 2184, Bar = 50 μm. Figure 2B is the axon statistical graph of the axon regeneration of the Mauthner neurons with empty UAS-mCherry (negative control) and UAS-mCherry-sponge 2184 in vivo. The regrowth length of the UAS-mCherry-sponge 2184 group decreased by about 169% compared with the control group (UAS+injured: n = 10; OE sponge 2184+injured: n = 8, unpaired t test). ****P<0.0001.

[0132] References

[0133] B.B. Hu, M. Chen, R.C. Huang, Y.B. Huang, Y. Xu, W. Yin, L. Li, B. Hu, In vivo imaging of Mauthner axon regeneration, remyelination and synapses re-establishment after laser axotomy in zebrafish larvae, Exp Neurol 300 (2018) 67-73.

[0134] R.C. Huang, M. Chen, L.Q. Yang, M. Wagle, S. Guo, B. Hu, MicroRNA-133b Negatively Regulates Zebrafish Single Mauthner-Cell Axon Regeneration through Targeting tppp3 in Vivo, Front Mol Neurosci 10 (2017).

[0135] Wang Z, Wang X, Shi L, Cai Y, Hu B. Wolfram syndrome 1b mutation suppresses Mauthner-cell axon regeneration via ER stress signal pathway. Acta Neuropathol Commun. 2022;10(1):184. Published 2022 Dec 17. doi:10.1186 / s40478-022-01484-8

[0136] L.Q.Yang, M.Chen, J.L.Zhang, D.L.Ren, B.Hu, Hypoxia Delays Oligodendrocyte Progenitor Cell Migration and Myelin Formation by Suppressing Bmp2b Signaling in Larval Zebrafish, Front Cell Neurosci 12(2018)348.

[0137] Sequence information

[0138] SEQ ID NO:1 Nucleotide sequence of zebrafish microRNA-2184

[0139] AACAGUAAGAGUUUAUGUGCU

[0140] SEQ ID NO:2 Nucleotide sequence of CMV promoter

[0141] TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTAT

[0142] SEQ ID NO:3 Nucleotide sequence of GAL4

[0143] CGTGAGAACGGATATGAATGGGCAATGAGCCATCCCATTGACGTCAATGGTGGGTGGTCCTATTGACGTCAATGGGCATTGAGCCAGGCGGGCCATTTACCGTAATTGACGTCAATGGGGGAGGCGCCATATACGTCAATAGGACCGCCCATATGACGTCAATAGGAAAGACCATATATAGAGACCATTGACGTCAATGGGGGAGTGGCTATGGGCGGTATTAGGAAGCCCCATATATGGTATATGGGACCGCCCATTGGGAGGGGCTATCTACGTCAATAGGAAAACCCATATATGGAATACTATATGGCATAGGGCCAATACATAGTATTGAACCTGGCCAATAGCCATATTGGCATAGGGCCATATTGGATATTGCCTATATATTGATCCTGGCATATAGCCAATATGGCCGCCATTATTGGCACCATGCCAATTCAATATGGCGGACCTGGCACTGTGCCAACTGGGGAGGGGTCTACTTGGCACGGTGCCAAGTTTGAGGAGGGGTCTTGGCCCTGTGCCAAGTCCGCCATATTGAATTGGCATGGTGCCAAGTCCGCCATATTGAATTGGCWSRGGTCCAGATCCACCATATTGAATTGGCAYGAGTCCATATACGCCATATTGAATTGGCACAGGTCCAGATCCACCATAT

[0144] SEQ ID NO:4 Nucleotide sequence of UAS

[0145] ATCAGGATGGCGGAGTACTGTCCTCCGGCAAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCAAGGCGGAGTACTGTCCTCCGGGCTGCGGAGTACTGTCCTCCGGCAAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCAAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCAAGGTCGGAGTACTGTCCTCCGACACTAGAGGTCGGAGTACTGTCCTCCGACGCAAGGCGGAGTACTGTCCTCCGGGCTGGCGGAG TACTGTCCTCCGGCAAGGGTCGACTCTAGAGGGTATATAATGGATCCCATCGCGTCTCAGCCTCACTTTGAGCTCCTCCACACGAATTC

[0146] Precursor nucleotide sequence of zebrafish microRNA-2184 molecule, SEQ ID NO.5

[0147] CTGAATGATGCCCTAAGCCCTAAACAGTAAGAGTTTATGTGCTGAGGTTAAAAATTCAGCACATTGTCTCTTACTTGTAGGGAAAAGGGTTTCTATCGGCCTGTCACATT

[0148] Nucleotide sequence of mCherry, SEQ ID NO:6

[0149] ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACAAGCTGTACAAGTAG

[0150] SEQ ID NO:7 Nucleotide sequence of sponge 2184:

[0151] CGCGAGCACATATGACTTACTGTTCGCGAGCACATATGACTTACTGTTCGCGAGCACATATGACTTACTGTTCGCGAGCACATATGACTTACTGTTCGCGAGCACATATGACTTACTGTTCGCGAGCACATATGACTTACTGTTCGCG

[0152] The specific embodiments described above further elaborate on the objective, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only for the specific embodiments of the present invention and is not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a reagent for promoting the expression of microRNA-2184 in the manufacture of a drug for promoting the regeneration and recovery of the central nervous system in vivo.

2. The use according to claim 1, wherein, the reagent comprises a system for overexpressing microRNA-2184.

3. The use according to claim 2, wherein, the GAL4 / UAS molecular system is used to overexpress microRNA-2184, the GAL4 gene and the UAS gene are located in two expression vectors respectively, the nucleotide sequence of the microRNA-2184 is ligated to the rear end of the UAS gene, the CMV promoter is ligated to the front end of the GAL4 gene, and the expression of the microRNA-2184 is initiated after the GAL4 gene binds to the UAS gene.

4. The use according to claim 3, wherein, the nucleotide sequence of the CMV promoter is as shown in SEQ ID NO:

2.

5. The use according to claim 3, wherein, the nucleotide sequence of the GAL4 gene is as shown in SEQ ID NO:

3.

6. The use according to claim 3, wherein, the nucleotide sequence of the UAS gene is as shown in SEQ ID NO:

4.

7. A pharmaceutical composition for promoting axonal regeneration and recovery of the central nervous system, wherein, the composition comprises a reagent for promoting the expression of microRNA-2184.

8. The pharmaceutical composition according to claim 7, wherein, the reagent is a system for overexpressing microRNA-2184 as defined in any one of claims 2-6.

9. A method for screening a drug for promoting the regeneration and recovery of central nerve axons, wherein, the method comprises detecting the expression level of microRNA-2184.

10. The use according to any one of claims 1-6, or the pharmaceutical composition according to claim 7 or 8, or the method according to claim 9, wherein, the mature microRNA-2184 comprises a sequence as shown in SEQ ID NO:1, and the precursor nucleotide sequence of the microRNA-2184 molecule is a sequence as shown in SEQ ID NO:5.

Images