Application of activity of histone succinylation modification enzyme of NCOA family protein as drug target in preparation of drugs for preventing / treating / diagnosing tumors

Abstract

The invention discloses application of the activity of a histone succinylation modification enzyme of NCOA family protein as a drug target in a drug for preventing / treating / diagnosing tumors, and belongs to the technical field of tumor biology. The level of the NCOA family protein catalyzed histone succinylation modification is obviously higher in various tumor tissues than the level of the NCOA family protein catalyzed histone succinylation modification in para-tumor tissues, which suggests that the NCOA family protein catalyzed histone succinylation modification can be used as a biomarker for occurrence and development of tumors. A cell model research result shows that the activity of the NCOA family protein catalyzed histone succinylation modification enzyme plays an important role in proliferation of various tumor cells. A mouse model shows that the activity of the histone succinylation modification enzyme of the NCOA family protein NCOA3 plays an important role in occurrence and development of breast tumors and pulmonary metastasis.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor biology. The present invention relates to the application of the histone succinylation modification enzyme activity catalyzed by the Nuclear Receptor Coactivator (NCOA) family proteins as a drug target in the preparation of drugs for preventing / treating / diagnosing tumors. Specifically, it relates to the application of the histone succinylation modification enzyme activity of the NCOA family proteins in the diagnosis of the occurrence and development of breast tumors, prostate tumors, lung tumors, kidney tumors, etc. The change in the histone succinylation level catalyzed by the NCOA family proteins can be used as a biomarker for tumor occurrence and development, and the histone succinylation modification enzyme activity of the NCOA family proteins can be used as a drug target for preventing and / or treating tumors. Background Art

[0002] Nuclear receptor coactivator 1 (NCOA1) was cloned in 1995 and became the first true nuclear hormone receptor transcriptional coactivator. It interacts with steroid receptors in a hormone-dependent manner and increases the transcriptional activity of steroid receptors. Subsequently, two other homologous proteins, NCOA2 and NCOA3, were also discovered successively. The most widely studied aspect of NCOA family proteins is their role as transcriptional coactivators that bind to nuclear hormone receptors and regulate gene transcription. Current studies have shown that they recruit transcriptional coactivators such as CBP / p300, CARM1, and PRMT1 as "scaffold" proteins to promote gene transcription. In addition, there are also studies showing that NCOA family proteins bind to other transcription factors such as NF-κB, SMADs, E2F1, STATs, HIF1, p53, etc., and play a very important role in gene transcriptional regulation. In addition, there are also studies showing that NCOA family proteins are related to the occurrence and development of tumors, but it is currently unclear whether the histone succinylation modification they catalyze plays an important role in the occurrence and development of tumors, and there has been no report on whether histone succinylation modification can be used as a biomarker for tumor occurrence and development. Therefore, it is urgent to study whether the histone succinylation modification enzyme activity of NCOA family proteins can become a better drug target for treating tumors. Summary of the Invention

[0003] In order to overcome the defects of the prior art, the present invention provides the application of the histone succinylation modification enzyme activity of NCOA family proteins as a drug target in the preparation of drugs for preventing and / or treating tumors.

[0004] In the research of the present invention, it is proposed that the NCOA family proteins are a new class of lysine succinylation modifying enzymes. Research shows that the NCOA family proteins are not only related to the occurrence and development of breast tumors, but also related to the occurrence and development of other tumors, such as prostate tumors, cervical tumors, endometrial tumors, lung tumors, liver tumors, etc. The present invention further studies: (1) The relationship between the NCOA family proteins and the occurrence and development of various tumors depends on the histone succinylation modification catalyzed by them; (2) The histone succinylation modification catalyzed by the NCOA family proteins can be used as a biomarker for the occurrence and development of tumors; (3) The histone succinylation modifying enzyme activity of the NCOA family proteins can become a better drug target for treating tumors.

[0005] The present invention takes the NCOA family protein succinylation modifying enzyme activity and the histone succinylation modification catalyzed by it as targets to provide new ideas for the prevention / treatment / diagnosis of tumors.

[0006] The present invention provides the following technical solutions:

[0007] (1) The present invention provides the histone succinylation modification catalyzed by the NCOA family proteins, including the succinylation modification at sites such as H3K14, H3K23, H3K27, H4K16, and H4K31.

[0008] (2) The present invention provides that the succinylation modifications at sites such as H3K14, H3K23, and H4K31 catalyzed by the NCOA family proteins are significantly higher in various tumors than in the adjacent tumor tissues. As biomarkers for the occurrence and development of tumors, among them, the tumors include breast tumors, prostate tumors, lung tumors, kidney tumors, etc.

[0009] (3) The present invention provides the application of the enzyme activity of the NCOA family proteins catalyzing histone succinylation modification as a new target in the prevention / treatment / diagnosis of tumors.

[0010] (4) The present invention also provides the application of the histone succinylation modification catalyzed by the NCOA family proteins in the preparation of tumor diagnostic reagents or kits.

[0011] (5) The present invention also provides the application of the histone succinylation modification catalyzed by the NCOA family proteins in the preparation of drugs for the prevention / treatment / diagnosis of tumors.

[0012] (6) The present invention uses a cell model to prove that the histone succinylation modifying enzyme activity of the NCOA family proteins plays an important role in the proliferation of tumor cells. The mechanism is that the histone succinylation modification catalyzed by NCOA can promote the expression of genes related to the PI3K-AKT signaling pathway, thereby promoting cell proliferation.

[0013] (7) The present invention also proves the role of histone succinylation modification of NCOA family proteins in the occurrence and development of breast tumors using a mouse model, and proposes that the succinylation modification enzyme activity of NCOA family proteins plays an important role in the occurrence and development of breast tumors. Moreover, histone succinylation modification has a good correlation with lung tumors, prostate tumors, and kidney tumors. Therefore, taking the succinylation modification enzyme activity of NCOA family proteins as a new treatment strategy for preventing / treating / diagnosing breast tumors, prostate tumors, lung tumors, kidney tumors, etc. has great clinical application value.

[0014] The present invention provides the application of the histone succinylation modification enzyme activity of NCOA family proteins as a drug target in the preparation of drugs for preventing / treating / diagnosing tumors, and the histone succinylation modification includes succinylation modification of any one or more of the sites such as H3K14, H3K23, H3K27, H4K16, H4K31, etc.

[0015] Specifically, the succinylation modifications at sites such as H3K14, H3K23, and H4K31 have relatively high levels in breast tumors, prostate tumors, kidney tumors, lung tumors, etc.

[0016] Specifically, the succinylation modification catalyzed by NCOA family proteins plays an important role in the proliferation of tumor cells. The mechanism is that the histone succinylation modification catalyzed by NCOA family proteins can promote the expression of genes related to the PI3K-AKT signaling pathway, thereby promoting cell proliferation.

[0017] The present invention also provides a tumor-related biomarker, and the biomarker is the change in the level of histone succinylation modification catalyzed by NCOA family proteins, which can predict / diagnose the occurrence and development of tumors.

[0018] The present invention also provides a reagent / kit for detecting the histone succinylation modification enzyme activity of NCOA family proteins as described in claim 1.

[0019] The present invention also provides a product, and the active ingredient of the product includes the histone succinylation modification enzyme activity of NCOA family proteins as described in claim 1. The product has at least one of the following functions (1)-(4):

[0020] (1) Predict the risk of tumor occurrence and development progress;

[0021] (2) Increase the indication of poor prognosis of tumors;

[0022] (3) Promote and maintain the survival and growth of tumor cells;

[0023] (4) The histone succinylation-modifying enzyme activity of the NCOA family proteins serves as a drug target for the prevention / treatment / diagnosis of tumors.

[0024] The present invention also provides an inhibitor / antagonist / modulator that can inhibit / antagonize / regulate the histone succinylation-modifying enzyme activity of the NCOA family proteins as described above.

[0025] Specifically, the inhibitor / antagonist / modulator includes SI-2, etc.

[0026] The present invention also provides a drug / drug composition that contains the inhibitor / antagonist / modulator as described above. Further, it further includes a pharmaceutically acceptable carrier.

[0027] Specifically, the drug / drug composition includes liquid dosage forms, gas dosage forms, solid dosage forms, semi-solid dosage forms, etc.

[0028] Specifically, the drug / drug composition is administered orally, by injection, intranasally, transdermally, or mucosally, etc.

[0029] Preferably, the pharmaceutically acceptable carrier means that when the drug is properly administered to animals or humans, they do not produce adverse, allergic, or other adverse reactions. Pharmaceutically acceptable carriers can include, but are not limited to: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethyl cellulose, and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerol, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; coloring agents; flavoring agents; tabletting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solutions; and phosphate buffer solutions, etc. These substances are used as needed to help the stability of the formulation or to improve the activity or its bioavailability or to produce an acceptable taste or odor in the case of oral administration.

[0030] Specifically, in the drug / drug composition, it can also contain physiologically compatible excipients, and the excipients include buffering agents, diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers, lubricants, etc.

[0031] Specifically, the drug / drug composition can be made into injections, sterile powders for injection, tablets, pills, capsules, lozenges, spirits, powders, granules, syrups, solutions, tinctures, aerosols, powder inhalations, or suppositories, etc. The drug / drug composition in various dosage forms above can be prepared according to the conventional methods in the pharmaceutical field.

[0032] Specifically, the drug / drug composition can be introduced into the body such as muscle, intradermal, subcutaneous, intravenous, mucosal tissue by injection, spraying, nasal dropping, eye dropping, osmosis, absorption, physical or chemical mediated methods; or be introduced into the body after being mixed or wrapped by other substances. Preferably, it is administered by injection. The drug / drug composition can also be used in combination with other treatment means, and the other means include surgery, radiotherapy, chemotherapy, targeted therapy.

[0033] The dosage level of the drug / drug composition of the present invention can be adjusted according to the amount of the composition required to achieve the desired diagnostic or therapeutic result. The administration regimen can also be a single injection or multiple injections, or be adjusted. The selected dosage level and regimen are reasonably adjusted depending on various factors including the activity and stability (i.e., half-life) of the cell drug / drug composition, the formulation, the administration route, the combination with other drugs or treatments, the disease or disorder to be detected and / or treated, and the health condition and previous medical history of the subject to be treated.

[0034] The therapeutically effective dose of the drug / drug composition of the present invention can be initially estimated in cell culture experiments or animal models such as rodents, rabbits, dogs, pigs, and / or primates. Animal models can also be used to determine the appropriate range of administration concentrations and routes. Subsequently, it can be used to determine the useful dose and route for administration in humans. Generally, the determination and adjustment of the effective amount or dose to be administered and the evaluation of when and how to make such adjustments are known to those skilled in the art.

[0035] For additional guidance on formulations, dosages, administration regimens, and measurable therapeutic outcomes, see Berkow et al. (2000) The Merck Manual of Medical Information (Merck Medical Information Handbook) and Merck & Co., Inc., Whitehouse Station, New Jersey; Ebadi (1998) CRC Desk Reference of Clinical Pharmacology (Clinical Pharmacology Handbook), etc.

[0036] The present invention also provides a method, which includes:

[0037] (1) A method for screening candidate drugs for preventing / inhibiting / alleviating / reducing / treating tumors, the method comprising detecting the effect of the candidate drug on the biological effect of the histone succinylation modifying enzyme activity of the NCOA family protein in a sample of an object or the object itself as described above;

[0038] (2) A method for evaluating the degree of tumor development / metastasis in a tumor patient, or a method for predicting or prognosticating whether the patient is suitable for treatment targeting the histone succinylation modifying enzyme activity of the NCOA family protein, the method comprising: determining the histone succinylation modifying enzyme activity of the NCOA family protein from a tumor tissue sample of the patient or subject, wherein the degree of tumor development / metastasis of the patient is evaluated by the enzyme activity, or whether the patient is suitable for treatment targeting the histone succinylation modifying enzyme activity of the NCOA family protein as described above is predicted or prognosed.

[0039] The present invention also provides an application, the application comprising:

[0040] (1) The application of the histone succinylation modifying enzyme activity of the NCOA family protein as described above in the preparation of tumor diagnostic reagents or kits;

[0041] (2) The application of the histone succinylation modifying enzyme activity of the NCOA family protein as described above in the preparation of products for monitoring the development of breast tumors;

[0042] (3) The application of the tumor-related biomarker as described above, or the reagent / kit as described above, or the product as described above, or the inhibitor / antagonist / regulator as described above, or the drug / pharmaceutical composition as described above, or the method as described above in the preparation of tumor diagnostic reagents or kits, products for monitoring the development of tumors, and drugs for preventing / treating / diagnosing tumors.

[0043] The present invention further provides a method for preventing / inhibiting / alleviating / reducing / treating tumors, the method comprising administering an effective amount of the inhibitor / antagonist / regulator as described above, and / or the drug / pharmaceutical composition as described above, to a subject in need (such as a mammal). The method can also be in vitro or non-therapeutic.

[0044] Specifically, the subject or individual for therapeutic or prophylactic treatment is preferably a mammal, including but not limited to humans, primates, livestock (such as sheep, cattle, horses, donkeys, pigs), pets (such as dogs, cats), laboratory test animals (such as mice, rabbits, rats, guinea pigs, hamsters), or captured wild animals (such as foxes, deer). Preferably, the subject is a primate. Most preferably, the subject is a human.

[0045] Specifically, the subject may be a cancer patient or an individual expecting to prevent cancer. The inhibitor and / or drug / drug composition may be administered to the subject before, during, or after cancer treatment.

[0046] In the applications, cancer-related biomarkers, reagents / kits, products, inhibitors / antagonists / modulators, drugs / drug compositions, and methods as described above, the NCOA family proteins include NCOA1, NCOA2, and NCOA3; and / or,

[0047] The histone succinylation modification includes succinylation modification at any one or more of the sites such as H3K14, H3K23, H3K27, H4K16, H4K31; and / or,

[0048] The cancers include breast cancer, prostate cancer, lung cancer, ovarian cancer, kidney cancer, liver cancer, pancreatic cancer, colorectal cancer, cervical cancer, esophageal cancer, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those skilled in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0050] Figure 1The NCOA family proteins have the enzymatic activity of catalyzing histone succinylation modification: (A) Immunofluorescence experiments show that the NCOA family proteins have the enzymatic activity of catalyzing histone succinylation modification, but do not have the enzymatic activity of catalyzing histone acetylation modification; (B) Immunofluorescence experiments show that NCOA3 has the enzymatic activity of catalyzing the succinylation modification of histone H3K14, H4K16, and H4K31 sites; (C) Western blot experiments show that the NCOA family proteins have the enzymatic activity of catalyzing histone succinylation modification at multiple sites, such as histone H3K14, H3K23, H4K16, and H4K31 sites, and do not have the enzymatic activity of catalyzing other acyl modifications of histones. Among them, Vec: pCDNA 3.1 empty vector; Myc-NCOA1: NCOA1 with Myc tag; Myc-NCOA2: NCOA2 with Myc tag; Myc-NCOA3: NCOA3 with Myc tag; Ksu: Succinylation modification; Kac: Acetylation modification; H3K14su: Succinylation modification of histone H3 lysine 14 site; H4K16su: Succinylation modification of histone H4 lysine 16 site; H4K31su: Succinylation modification of histone H4 lysine 31 site; H3K23su: Succinylation modification of histone H3 lysine 14 site; H3K14ac: Acetylation modification of histone H3 lysine 9 site; Kpr: Propionylation modification; Kcr: Crotonylation modification: H3K18cr: Crotonylation modification of histone H3 lysine 18 site; Kbu: Butyrylation modification; Actin: Actin; DAPI: 4',6-diamidino-2-phenylindole.

[0051] Figure 2 The succinylation modification of histone H4K31 site is significantly higher in tumor tissues than in adjacent tissues: (A) Western blot analysis of the levels of succinylation modification of histone H4K31 site and histone acetylation modification in human breast tumor samples compared with adjacent tissues; (B) Western blot analysis of the levels of succinylation modification of histone H4K31 site and histone acetylation modification in human prostate tumor samples compared with adjacent tissues; (C) Western blot analysis of the levels of succinylation modification of histone H4K31 site and histone acetylation modification in human kidney tumor samples compared with adjacent tissues; (D) Western blot analysis of the levels of succinylation modification of histone H4K31 site and histone acetylation modification in human lung tumor samples compared with adjacent tissues; (E) Western blot analysis of the levels of succinylation modification of histone H4K31 site and histone acetylation modification in mouse lung tumor samples compared with normal tissues; Among them, N: Adjacent tissues; T: Tumor tissues.

[0052] Figure 3 The correlation between NCOA3-catalyzed histone H4K31 succinylation modification and breast tumors: (A) Analyze the correlation between the expression of NCOA3 and histone H4K31 succinylation modification in human breast tumor samples by immunohistochemistry; (B) Analyze the correlation between NCOA3 expression and H4K31 site succinylation modification using a tissue microarray of human breast tumor samples.

[0053] Figure 4 Inhibitors of NCOA family proteins can inhibit the proliferation of various tumor cells, such as breast tumor, ovarian tumor, renal tumor, liver tumor, pancreatic tumor, colorectal tumor, cervical tumor, and esophageal tumor cells.

[0054] Figure 5 NCOA3 histone succinylase activity promotes the proliferation of breast tumor cells: (A) Use CRISPR-Cas9 technology to construct a breast tumor cell line with NCOA3 knockout. Complement wild-type NCOA3 and mutants lacking histone succinylation modification enzyme activity in the NCOA3 knockout cells, and detect the levels of histone succinylation modification, histone acetylation modification, and other histone acylation modifications by Western blot; (B) Detect the proliferation of four types of cell lines: wild-type cells (WT), NCOA3 knockout cells (NCOA3KO), NCOA3 knockout cells complemented with wild-type NCOA3 (NCOA3KO+NCOA3), and NCOA3 knockout cells complemented with mutant NCOA3 (NCOA3KO+NCOA3m) by CCK8 assay. Among them, ns: no significant difference, p value > 0.05; ***: significant difference, p value < 0.001.

[0055] Figure 6 NCOA3 succinylase activity promotes the growth of breast tumor xenografts: (A-C) Use a nude mouse model to implant 5x10 5 cells of four types (SUM159PT-WT, SUM159PT-NCOA3-KO, SUM159PT-NCOA3-KO+NCOA-3, and SUM159PT-NCOA3-KO+NCOA3m) in the fourth pair of mammary fat pads and then detect tumor proliferation and size; (D) Detect the levels of histone succinylation modification and histone acetylation modification in the generated tumors by Western blot; among them, wild-type cells: WT, NCOA3 knockout cells: NCOA3KO, NCOA3 knockout cells complemented with wild-type NCOA3: NCOA3KO+NCOA3, NCOA3 knockout cells complemented with mutant NCOA3: NCOA3KO+NCOA3m; *: significant difference, p value < 0.005; ***: significant difference, p value < 0.001.

[0056] Figure 7 In the present invention, the NCOA-3 point mutant mice lacking histone succinylation modification enzyme activity significantly inhibit the proliferation and lung metastasis of breast tumors: (A) Female wild-type PyMT:Ncoa3 prepared in Example 6 of the present invention + / + , heterozygous PyMT:Ncoa3 + / ki and homozygous PyMT:Ncoa3 ki / ki mice's tumor onset time; (B) Female wild-type PyMT:Ncoa3 prepared in Example 6 of the present invention + / + , heterozygous PyMT:Ncoa3 + / ki and homozygous PyMT:Ncoa3 ki / ki mice's tumor volume; (C) Female wild-type PyMT:Ncoa3 prepared in Example 6 of the present invention + / + , heterozygous PyMT:Ncoa3 + / ki and homozygous PyMT:Ncoa3 ki / ki mice's tumor number; (D, E) Female wild-type PyMT:Ncoa3 prepared in Example 6 of the present invention + / + , heterozygous PyMT:Ncoa3 + / ki and homozygous PyMT:Ncoa3 ki / ki mice's tumor lung metastasis. Among them, ns: no significant difference, p value > 0.05; **: significant difference, p value < 0.01; ***: significant difference, p value < 0.001; ****: significant difference, p value < 0.0001. Detailed implementation manners

[0057] Combined with the following specific embodiments and drawings, the present invention will be further described in detail. The protection scope of the present invention is not limited to the following embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that those skilled in the art can think of are included in the present invention, and the scope of protection is defined by the appended claims. The processes, conditions, reagents, experimental methods, etc. for implementing the present invention, except for the specifically mentioned content below, are all common knowledge and well-known common sense in the art, and the present invention has no special limitations.

[0058] The following description of at least one exemplary embodiment is merely illustrative in nature and in no way limits the present invention and its application or use. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0059] In all the examples shown and discussed here, any specific values should be construed as merely exemplary and not as a limitation. Thus, other examples of the exemplary embodiments may have different values.

[0060] The present invention discloses the application of the histone succinylation modification enzyme activity of the NCOA family proteins as a drug target in drugs for preventing / treating / diagnosing tumors, belonging to the technical field of tumor biology. The level of histone succinylation modification catalyzed by the NCOA family proteins in various tumor tissues is significantly higher than that in adjacent tissues, suggesting that the histone succinylation modification catalyzed by the NCOA family proteins can be used as a biomarker for tumorigenesis and development. The results of the cell model study of the present invention show that the histone succinylation modification enzyme activity catalyzed by the NCOA family proteins plays an important role in the proliferation of various tumor cells. The present invention also shows through a mouse model that the histone succinylation modification enzyme activity of the NCOA family protein NCOA3 plays an important role in the occurrence, development and lung metastasis of breast tumors.

[0061] The test materials used in the examples are all conventional biochemical reagents unless otherwise specified.

[0062] Example 1 The NCOA family proteins have the enzyme activity of catalyzing histone succinylation modification

[0063] The present invention screens members of the histone acetyltransferase family and uses pan-palmitoylation modification and histone site-specific histone palmitoylation modification antibodies for immunofluorescence and Western blot experiments. The specific method is as follows: Overexpress the Myc-tagged NCOA family protein plasmid in HeLa cells (from ATCC: CCL-2). The specific method for constructing the NCOA family protein plasmid is as follows: 5 micrograms of the pcDNA3.1-3xMyc vector (addgene, catalog number: V790-20) is digested with EcoRⅠ (NEB, #R3101) and XhoⅠ (NEB, #R0146) at 37°C for 2 hours. The digested product is recovered using a gel recovery kit (BIOMIGA, #DC3511) with 1% agarose (ACMEC, #A82090) gel, and the concentration of the recovered product is measured. Specific primers for NCOA1 (NM_003743.5), NCOA2 (NM_001321703.2), and NCOA3 (NM_181659.3) are used for PCR amplification of the target gene fragments. The primers are as follows: NCOA1-F: CAGTGTGGTGGAATTCTGATGAGTGGCCTCGGGGAC (SEQ ID NO.1), NCOA1-R: GCCCTCTAGACTCGAGCTTATTCAGTCAGTAGCTGCTGAAGG (SEQ ID NO.2); NCOA2-F: CAGTGTGGTGGAATTCTGATGAGTGGGATGGGAGAAAATAC (SEQ ID NO.3), NCOA2-R: GCCCTCTAGACTCGAGCTCAGCAATATTTCCGTGTTGTGTC (SEQ ID NO.4); NCOA3-F: CAGTGTGGTGGAATTCTGATGAGTGGATTAGGAGAAAACTTGG (SEQ ID NO.5), NCOA3-R: GCCCTCTAGACTCGAGCTCAGCAGTATTTCTGATCAGGACC (SEQ ID NO.6). After PCR, the PCR product is recovered using a gel recovery kit and the concentration of the recovered product is measured. Subsequently, the digested vector and the target gene fragment are homologously recombined using a homologous recombination kit (Vazyme, #C116) at 50°C for 20 minutes. 90 microliters of competent cells are added to the recombined product, gently mixed, and then placed on ice for 30 minutes, heat shocked at 42°C for 90 seconds, 700 microliters of antibiotic-free LB liquid medium is added, and the cells are cultured at 37°C on a shaker for 2 hours for resuscitation. Then the cultured product is spread on a solid LB plate containing ampicillin and cultured upside down in a 37°C incubator for 24 hours. Single colonies are selected and sequenced for verification.), After 48 hours of transfection, immunofluorescence staining experiments were carried out to analyze its enzyme activities for catalyzing histone succinylation modification and acetylation modification. The results are shown in Figure 1 Figures 2A and 2B. The results showed that the NCOA family proteins had the enzyme activity for catalyzing the succinylation modification of histone H3K14, H4K16 and H4K31 sites. In addition, the plasmid of the NCOA family protein with Myc tag was overexpressed in HeLa cells. After 48 hours of transfection, histones were prepared for Western blot experiments to analyze its enzyme activities for catalyzing histone succinylation modification, acetylation modification and other acylation modifications. The results are shown in Figure 1 Figure 2C. The results showed that the NCOA family proteins had the enzyme activity for catalyzing the histone succinylation modification at multiple sites, such as histone H3K23 and H4K31 sites, and did not have the enzyme activity for catalyzing other acylation modifications of histones. Based on the above results, it was illustrated that the NCOA family proteins had the enzyme activity for catalyzing the histone succinylation modification at multiple sites.

[0064] Example 2 The succinylation modification of histone H4K31 site was significantly higher in tumor tissues than that in adjacent tissues

[0065] Previous studies have shown that NCOA3 is correlated with the occurrence and development of various tumors. In this invention, it was found in the previous research that the NCOA family proteins, as a novel histone succinylation modifying enzyme and the main intracellular succinylation modifying enzyme, thus this invention firstly revealed that the histone succinylation modification catalyzed by the NCOA family proteins had a good correlation with various tumors. In this invention, histones of human breast tumors, prostate tumors, lung tumors, kidney tumors and mouse lung tumor tissue samples were prepared. The specific method for preparing histones was as follows: (1) Add 800 μL of hypotonic buffer (10 mM Tris–Cl pH 8.0, 1 mM KCl, 1.5 mM MgCl 2 , 1 mM DTT) to about 200 mg of tumor tissue samples and grind for 3 cycles, 3 minutes each time, and then rotate at 4 °C for 1 hour; (2) Centrifuge at 10000 g for 10 min at 4 °C to discard the supernatant, and then add 400 μL of 0.4 N H 2 SO 4 to resuspend the precipitate and rotate at 4 °C for 1 hour; (3) Centrifuge at 16000 g for 10 min at 4 °C to collect the supernatant, add 132 μL of the prepared 100% trichloroacetic acid to the supernatant, invert and mix well and place on ice for 30 minutes; (4) Centrifuge at 16000 g for 10 min at 4 °C to discard the supernatant, wash the precipitate twice with pre-cooled acetone solution, dry it and add an appropriate amount of water. After the histones were dissolved, measure the protein concentration for Western blot. The Western blot results (see Figure 2)It is shown that the levels of histone H4K31 and H3K14 site succinylation modifications catalyzed by NCOA family proteins are significantly increased in tumor tissues compared to adjacent tissues, such as breast tumors ( Figure 2 A), prostate tumors ( Figure 2 B), kidney tumors ( Figure 2 C), lung tumors ( Figure 2 D and 2E), revealing that the histone succinylation modification catalyzed by NCOA family proteins has a good correlation with breast tumors, suggesting that the histone succinylation modification catalyzed by NCOA family proteins can be used as a potential biomarker for tumorigenesis and development.

[0066] Example 3 Correlation between histone H4K31 site succinylation modification catalyzed by NCOA3 and breast tumors

[0067] Previous research reports have shown that NCOA3 is highly amplified in breast tumors, and the high expression of NCOA3 has a good correlation with breast tumors. The present invention analyzed the correlation between the NCOA3 protein level and the histone H4K31 succinylation modification at specific sites catalyzed by NCOA family proteins in breast tumor tissue microarrays, and analyzed the correlation between the protein level of NCOA3 and the succinylation modification at the histone H4K31 site in breast tumor samples through histochemical experiments. The specific experimental methods are as follows: The specific methods are as follows: (1) Deparaffinization: Immerse the paraffin sections in xylene 1 solution for 5 - 10 minutes, xylene 2 solution for 5 - 10 minutes, pure alcohol:xylene = 1:1 solution for 5 minutes, 100% absolute ethanol solution for 3 - 5 minutes, 95% ethanol solution for 3 - 5 minutes, 85% ethanol solution for 3 - 5 minutes, 75% ethanol solution for 3 - 5 minutes, and soak and wash with pure water; (2) Antigen repair (thoroughly expose antigens): Prepare 200 ml of repair solution (20 ml of repair solution + 180 ml of distilled water) and pour it into the repair box. Insert the sections into the box one by one, paying attention to the direction. Close the lid tightly and place it in a water bath at 100 °C for 20 minutes, then cool naturally at room temperature; (3) Remove catalase: Use 3% H 2 O 2 (Accurately measure 45 ml of methanol, add 30% H 2 O 2(5 mL) was poured into the soaking bottle and placed in the dark for 10 minutes, then rinsed 2 - 3 times with PBS; (4) Rinse 2 times, 3 minutes each time; (5) Blocking: Take the blocking solution, dry the liquid around the sections with filter paper, draw an oil circle, drop 1 - 2 drops of the blocking solution, and let it stand in a wet box for 30 minutes for reaction; (6) Incubate with primary antibody: Directly discard the blocking solution, dry the liquid remaining on the oil circle with filter paper, add 50 μL of the antibody, place it flat in a wet box at 4°C overnight, then wash 3 times with PBST, 5 minutes each time (pay attention to keeping the sections moist); (7) Incubate with secondary antibody: Drop the secondary antibody for 30 minutes, discard the secondary antibody, and wash 3 times with PBST, 3 minutes each time; (8) Add streptavidin - HRP, under light - avoiding conditions, after reacting for 30 minutes, wash 3 times with PBST, 3 minutes each time; (9) Chromogenic reaction: Preparation of chromogenic solution: Under light - avoiding conditions, mix the three liquids (60x) in the kit and dilute with pure water. Add the chromogenic solution (about 50 μL per slide) for chromogenic reaction. Observe the chromogenic degree under a microscope, and terminate the reaction with tap water after chromogenic reaction is completed; (10) Nuclear staining: Counterstain the cell nuclei with hematoxylin for 5 minutes, wash clean with tap water, differentiate with hydrochloric acid - alcohol for several seconds, wash clean with distilled water, and blue - return in tap water for 20 minutes; (11) Sealing: Place the tissue sections successively into 75% alcohol (3 minutes), 85% alcohol (3 minutes), 95% alcohol (3 minutes), 100% alcohol (5 minutes), alcohol:xylene 1:1 (5 minutes), xylene (5 minutes), xylene (10 minutes). Meanwhile, prepare a cover glass (cleaned with lens paper), take out the sections, dry the back, drop a drop of resin glue, cover with the cover glass, and let it stand flat at room temperature. Experimental results (see Figure 3 A and 3B) showed that the level of histone succinylation modification in cells with high expression of NCOA3 in breast tumor tissues was also at a relatively high level, revealing a good correlation between the succinylation modification of histone H4K31 site catalyzed by NCOA family proteins and breast tumors.

[0068] Example 4 Inhibitors of NCOA family proteins can inhibit the proliferation of various tumor cells

[0069] The CCK - 8 assay is widely used for the detection of cell proliferation based on WST - 8 (2 - (2 - methoxy - 4 - nitrophenyl) - 3 - (4 - nitrophenyl) - 5 - (2,4 - disulfophenyl) - 2H - tetrazolium monosodium salt). WST - 8 is a compound similar to MTT (3 - (4,5 - dimethylthiazol - 2 - yl) - 2,5 - diphenyltetrazolium bromide). In the presence of an electron - coupling reagent, it can be reduced by some dehydrogenases in mitochondria to generate orange - yellow triphenylmethanol. The more and faster the cell proliferation, the deeper the color; the greater the cytotoxicity, the lighter the color. For the same cells, the depth of color is linearly related to the number of cells.

[0070] The present invention first clarified that a small molecule inhibitor (SI-2, Sigma, SML1762) of the NCOA family proteins can significantly inhibit the histone succinylation modification enzyme activity catalyzed by them. Subsequently, the inhibitory effect of the small molecule inhibitor on the proliferation of tumor cells was detected in a variety of tumor cells, including breast tumors, ovarian tumors, kidney tumors, liver tumors, pancreatic tumors, colorectal tumors, cervical tumors, and esophageal tumor cells. Specific experimental method: First, inoculate a cell suspension (about 2000 tumor cells) in a 96-well plate and culture for 24 hours. Culture with a medium containing 100 nanomoles of the NCOA family protein inhibitor for different times. Subsequently, add 10 microliters of CCK-8 solution to each well, place the culture plate in an incubator and incubate for 1 hour. Then, measure the absorbance at 450 nanometers with an enzyme-labeled instrument. As Figure 4 shown, the results indicate that the inhibition of the NCOA family proteins can significantly inhibit the proliferation of breast tumors, ovarian tumors, kidney tumors, liver tumors, pancreatic tumors, colorectal tumors, cervical tumors, and esophageal tumor cells.

[0071] Example 5 NCOA3 histone succinylase activity promotes the proliferation of breast tumor cells

[0072] Subsequently, a cell line with NCOA3 knockout was constructed in the breast tumor cell line SUM159PT. The specific method is as follows: Use the CRISPR-cas9 technology to construct cells with NCOA3 knockout, and reconstitute wild-type NCOA3 and mutant NCOA3 in the NCOA3 knockout cells. The specific method for constructing knockout cells is as follows: Design the gRNA of NCOA3 through the website (https: / / zlab.squarespace.com / guide-design-resources), construct 2-3 gRNA plasmids, and then transfer them into SUM159PT. After screening with puromycin for 48 hours, pick monoclonal cells. Wait until there are an appropriate amount of cells in the monoclonal cells to detect whether the NCOA3 protein is knocked out. After determining the knocked-out cells, stably express wild-type NCOA3 and the NCOA3 protein lacking succinylation modification enzyme activity in the NCOA3 knockout cells by means of lentivirus. Western blot was used to detect the levels of histone succinylation modification, histone acetylation modification, and other histone acylation modifications. The results showed ( Figure 5 A) Knocking out NCOA3 can reduce the level of histone succinylation modification. Reconstituting wild-type NCOA3 can restore the level of histone succinylation modification, but the mutant cannot. The proliferation of four types of cell lines, namely wild-type cells, NCOA3 knockout cells, wild-type NCOA3 reconstituted after NCOA3 knockout, and mutant NCOA3 reconstituted after NCOA3 knockout, was detected by the CCK8 experiment. The results showed ( Figure 5B) After knocking out NCOA3, the proliferation rate of cells can be significantly reduced. The proliferation rate of cells supplemented with wild-type NCOA3 is significantly increased, but the proliferation rate cannot be increased after supplementing with mutant NCOA3, revealing that the histone succinylation modification catalyzed by NCOA3 is necessary for cell proliferation and has important biological significance during the process of cell proliferation.

[0073] Example 6: The succinylase activity of NCOA3 promotes the growth of mammary tumor xenografts

[0074] Subsequently, the present invention used the BALB / c nude mouse model (purchased from Jiangsu Huachuang Xinnuo Medical Technology Co., Ltd.) to implant 5×10 5 cells of four types successfully constructed in Example 5 (SUM159PT-WT, SUM159PT-NCOA3-KO, SUM159PT-NCOA3-KO+NCOA3, and SUM159PT-NCOA3-KO+NCOA3m) into the fourth pair of mammary fat pads (the experimental schematic diagram is as Figure 6 shown in A). Two weeks later, the size of the mammary tumors was measured. The results showed that knocking out NCOA3 could significantly inhibit the size of the mammary tumors, supplementing wild-type NCOA3 could promote the proliferation of the mammary tumors, but supplementing the mutant lacking succinylation modification enzyme activity could significantly inhibit the proliferation of the tumors ( Figure 6 shown in B and 6C).

[0075] Example 7: The point mutant mice lacking histone succinylation modification enzyme activity of Ncoa3 significantly inhibit the proliferation and lung metastasis of mammary tumors

[0076] The cells and the nude mouse xenograft models in Example 5 and Example 6 of the present invention proved that the histone succinylation modification catalyzed by NCOA3 plays an important role in cell proliferation. The present invention constructed a point mutant mouse model lacking succinylation modification enzyme activity of Ncoa3 (Ncoa3 ki / ki )(purchased from Cyagen Biosciences (Suzhou) Inc.). The histone succinylation modification levels in the lung and spleen tissues of Ncoa3 ki / ki mice were detected by Western blot. The results showed that the histone succinylation modification levels in the lung and spleen tissues of Ncoa3 ki / ki mice were significantly decreased, indicating that the Ncoa3 ki / ki mouse model was successfully constructed. The present invention mated the Ncoa3 ki / ki mice with the spontaneous mammary tumor mouse model (PyMT-MMTV) to obtain wild-type PyMT:Ncoa3 + / + , heterozygous PyMT:Ncoa3 + / ki and homozygous PyMT:Ncoa3 ki / kiMice, and then the occurrence time, number, and volume of tumors were monitored. The results showed that the occurrence time of tumors in mice with loss of succinylation modification enzyme activity was delayed ( Figure 7 as shown in Figure 7 Figure 2A), the number and volume of tumors were significantly reduced ( Figure 7 as shown in Figures 2B and 2C), and the lung metastasis of mouse mammary tumors was significantly reduced (

[0077] as shown in Figures 2D and 2E), revealing that the succinylation modification enzyme activity of NCOA3 can be used as a potential target for the future treatment of mammary tumors.

[0078] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs. The terms used in the description of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0079] As used in the present invention, the terms "comprising" and "including" are open-ended expressions, that is, including the content specified in the present invention, but not excluding other aspects.

[0080] The protection scope of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be conceived by those skilled in the art are included in the present invention, and the scope of protection is defined by the appended claims.

Claims

1. The use of histone succinylation modification enzyme activity of NCOA family proteins as a drug target in the preparation of drugs for preventing / treating / diagnosing tumors, characterized in that: The histone succinylation modification includes any one or more succinylation modifications of the H3K14, H3K23, H3K27, H4K16, and H4K31 sites.

2. The use according to claim 1, characterized in that The succinylation modification of the H4K31, H3K14, and H3K23 sites has a higher level in breast tumors, prostate tumors, kidney tumors, and lung tumors; and / or, The succinylation modification catalyzed by the NCOA family protein plays an important role in the proliferation of tumor cells. Its mechanism of action is that the histone succinylation modification catalyzed by the NCOA family protein can promote the expression of genes related to the PI3K-AKT signaling pathway, thereby promoting cell proliferation.

3. A tumor-related biomarker, characterized in that: The biomarker is a change in the level of histone succinylation modification catalyzed by NCOA family proteins, which can predict / diagnose the occurrence and development of tumors.

4. A reagent / kit, characterized in that: The reagent / kit is used to detect the histone succinylation modification enzyme activity of the NCOA family protein as described in claim 1.

5. A product, characterized in that: The active ingredients of the product include the histone succinylation modification enzyme activity of the NCOA family protein as described in claim 1, and the product has at least one of the following functions (1)-(4): (1) Predict the risk of tumor occurrence and progression; (2) Increased risk indicates a poor prognosis for the tumor; (3) Promote and maintain tumor cell survival and growth; (4) The histone succinylation modification enzyme activity of NCOA family proteins serves as a drug target for the prevention / treatment / diagnosis of tumors.

6. An inhibitor / antagonist / modulator, characterized in that The inhibitor / antagonist / modulator can inhibit / antagonize / modulate the histone succinylating enzyme activity of the NCOA family protein as described in claim 1.

7. A drug / drug composition, characterized in that: The drug / pharmaceutical composition comprises the inhibitor / antagonist / modulator as claimed in claim 6, and further comprises a pharmaceutically acceptable carrier.

8. A method, characterized in that The method comprises: (1) A method for screening candidate drugs for preventing / inhibiting / alleviating / mitigating / treating tumors, the method comprising detecting the biological effect of the candidate drug on the histone succinylating enzyme activity of the NCOA family protein as described in claim 1 in a subject or a sample obtained from the subject; (2) A method for evaluating the extent of tumor occurrence, development / metastasis in a tumor patient, or a method for predicting or prognosticating whether the patient is suitable for treatment targeting the histone succinylation modification enzyme activity of NCOA family proteins, the method comprising: determining the histone succinylation modification enzyme activity of the NCOA family proteins in a tumor tissue sample from the patient or subject, wherein the extent of tumor occurrence, development / metastasis in the patient is evaluated by the enzyme activity, or whether the patient is suitable for treatment targeting the histone succinylation modification enzyme activity of the NCOA family proteins as described in claim 1 is predicted or prognosticated.

9. An application, characterized in that, The applications include: (1) Use of the histone succinylation modification enzyme activity of the NCOA family protein as described in claim 1 in the preparation of a tumor diagnostic reagent or kit; (2) Use of the histone succinylation modification enzyme activity of the NCOA family protein as described in claim 1 in the preparation of a product for monitoring the occurrence and development of breast tumors; (3) Use of the tumor-related biomarker as claimed in claim 3, or the reagent / kit as claimed in claim 4, or the product as claimed in claim 5, or the inhibitor / antagonist / modulator as claimed in claim 6, or the drug / drug composition as claimed in claim 7, or the method as claimed in claim 8 in the preparation of tumor diagnostic reagents or kits, products for monitoring the occurrence and development of tumors, and drugs for preventing / treating / diagnosing tumors.

10. The use, tumor-related biomarker, reagent / kit, product, inhibitor / antagonist / modulator, drug / drug composition, method according to any one of claims 1 to 9, characterized in that: The NCOA family proteins include NCOA1, NCOA2 and NCOA3; and / or, The histone succinylation modification includes succinylation modification of any one or more of the H3K14, H3K23, H3K27, H4K16, and H4K31 sites; and / or, The tumors include breast tumors, prostate tumors, lung tumors, ovarian tumors, kidney tumors, liver tumors, pancreatic tumors, colorectal tumors, cervical tumors, and esophageal tumors.

Images