Conjugates and uses thereof

Abstract

The present disclosure relates to a conjugate comprising a target site and a proteolytic site. In accordance with certain embodiments of the present disclosure, a target site comprises a nucleic acid of sequence number: 1 and a first conjugated group; the proteolysis site comprises an E3 ubiquitin ligase ligand and a second conjugated group. The target site is linked to the proteolytic site by a click reaction occurring between the first and second conjugated groups. The present disclosure also discloses a method of treating disease using the conjugates of the present disclosure.

Description

Technical Field

[0001] The present disclosure relates to the field of pharmaceuticals. Specifically, the present disclosure relates to novel conjugates and their use in treating diseases, for example, treating Alzheimer's disease (AD). Background Art

[0002] Ribonucleic acid (RNA) achieves diversity and selectivity by folding into complex dynamic structures to interact with proteins in cells and perform special functions. RNA G-Quadruplex (rG4) is assembled from multiple G-tetrads and is an important secondary structure of nucleic acids. Each G-quadruplex is formed by arranging four guanines in a cyclic Hoogsteen hydrogen bond manner, and is further stabilized by the cooperation of a central cation (K + >Na + >Li + ) with the stacking plane of the G-quadruplex. A typical G-tetrad sequence is composed of 4 consecutive guanine sequences separated by sequences of 1-7 nucleotides. In recent years, rG4 has become the focus of how nucleic acid secondary structures affect cellular processes. Research has shown that rG4 plays an important role in genomic regulation such as maintaining telomeres, post-transcriptional regulation of messenger RNA (mRNA), and the maturation process of non-coding RNA.

[0003] Notably, the G4 binding protein (G4BP) is very important for rG4-mediated gene regulation and can be one of the potential targets for drug development. For example, DEAH-Box helicase 36 (DHX36) is known to bind to and unwind rG4 in vitro. DHX36 is one of the helicases specific to G4, and its crystal structure indicates that DHX36 can specifically bind to the parallel-structured G4. Reports have shown that DHX36 is closely related to various human diseases. The Human Protein Atlas indicates that DHX36 is overexpressed in various cancer cells, including lung cancer and cervical cancer. In addition, DHX36 binds to the G4 containing the long non-coding RNA FLJ39051, resulting in enhanced metastatic ability of colon cancer cells. Nucleolin (NCL) is another binding protein with a G4 structure. Its binding to the lncRNA LUCAT1 of rG4 regulates MYC expression, thereby regulating and stimulating the proliferation of colon cancer cells. According to previous studies, the rG4 motif exists in the 3'-untranslated region (3'-UTR) of the amyloid precursor protein (APP) transcript, and the expression of the native APP protein is controlled by targeting the APP 3'-UTR rG4 motif with an L-RNA aptamer. Recently, DHX36 was found to unwind the 5'-untranslated region (5'-UTR) of rG4 and specifically regulate the translation of the guanine-binding protein G(i) subunit alpha-2 (Gnai2) mRNA, which is crucial for the regenerative ability of skeletal muscle stem cells (SCs). Therefore, the rG4-G4BP complex has become a drug target for interfering with rG4-mediated gene control under pathological conditions.

[0004] In view of this, there is still a need in the art to continuously develop a novel reagent that can specifically target and / or block the formation of the rG4-G4BP complex to treat rG4 / G4BP-related diseases, such as Alzheimer's disease (AD) and cancer. Summary of the Invention

[0005] The Summary of the Invention aims to provide a simplified abstract of the present disclosure to enable readers to have a basic understanding of the present disclosure. This Summary of the Invention is not a complete overview of the present disclosure, and its intention is not to point out the important / critical components of the embodiments of the present invention or to define the scope of the present invention.

[0006] As specifically implemented and widely described herein, a first aspect of the present disclosure relates to a conjugate comprising a target moiety and a proteolytic moiety. According to certain embodiments of the present disclosure, the target moiety comprises a nucleic acid and a first conjugate group linked to the nucleic acid, wherein the nucleic acid comprises the nucleotide sequence of "GGGUUGCGGAGGGUGGGCCU" (SEQ ID NO: 1); and the proteolytic moiety comprises an E3 ubiquitin ligase ligand and a second conjugate group linked to the E3 ubiquitin ligase ligand. In these embodiments, the first and second conjugate groups are each independently selected from the group consisting of azide, alkyne, tetrazine, cyclooctene, and cyclooctyne groups; and the target moiety is linked to the proteolytic moiety through a reaction between the first conjugate group of the target moiety and the second conjugate group of the proteolytic moiety, which reaction is a copper catalyzed azide-alkyne cycloaddition (CuAAC) reaction, a strained-promoted azide-alkyne click chemistry (SPAAC) reaction, or an inverse-electron demand Diels-Alder reaction (IEDDA).

[0007] Optionally, the proteolytic moiety further comprises a linker for linking the second conjugate group and the E3 ubiquitin ligase ligand. Preferably, the linker comprises 1-5 repeating ethylene glycol (EG) units.

[0008] According to certain exemplary embodiments of the present disclosure, the E3 ubiquitin ligase ligand is (2S,4R)-1-((S)-2-Amino-3,3-dimethylbutanoyl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide (AHPC) or pomalidomide. In certain embodiments, the proteolytic moiety has the structure of formula (I) or formula (II).

[0009] According to certain exemplary embodiments, the first conjugate group is a hexynyl group and is linked to the 5'-end of the nucleic acid.

[0010] In one embodiment, the conjugate has the structure of formula (III), wherein X is the nucleic acid.

[0011] In another embodiment, the conjugate has the structure of formula (IV), wherein X is the nucleic acid.

[0012] The present disclosure also discloses a method of treating a disease (particularly, an rG4 / G4BP-related disease) in an individual using the conjugate of the present disclosure. According to certain embodiments of the present disclosure, the method includes administering to an individual an effective amount of the conjugate of the present disclosure to alleviate or relieve symptoms associated with the disease. In one embodiment, the disease is AD. In another embodiment, the disease is cancer.

[0013] The individual that can be treated with the conjugate and / or method of the present disclosure is a mammal; preferably, the individual is a human.

[0014] After referring to the following embodiments, those of ordinary skill in the art to which the present invention pertains can readily understand the basic spirit and other inventive purposes of the present invention, as well as the technical means and implementation aspects adopted by the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] To make the above and other purposes, features, advantages, and embodiments of the present invention more apparent and understandable, the description of the accompanying drawings is as follows.

[0016] Figure 1A is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) of Example 1 of the present disclosure, which describes the click efficiency of specific conjugates. 5-Hexynyl_rG4: The rG4 oligonucleotide having the nucleotide sequence of SEQ ID NO: 1 (hTERC rG4 WT) is modified with a 5'-hexynyl group. 5-Hexynyl_rG4 mut: The rG4 oligonucleotide having the nucleotide sequence of SEQ ID NO: 2 (hTERC rG4 Mut) is modified with a 5'-hexynyl group. rG4_A: The conjugate formed by linking the 5'-hexynyl-modified hTERC rG4 WT to the azide-modified AHPC. rG4 mut_A: The conjugate formed by linking the 5'-hexynyl-modified hTERC rG4 Mut to the azide-modified AHPC. rG4_P: The conjugate formed by linking the 5'-hexynyl-modified hTERC rG4 WT to the azide-modified pomalidomide. rG4 mut_P: The conjugate formed by linking the 5'-hexynyl-modified hTERC rG4 Mut to the azide-modified pomalidomide.

[0017] Figure 1B is a histogram shown according to Example 1 of the present disclosure, which describes the efficacy of specific conjugates for degrading DHX36 protein. *P<0.05, **P<0.01. The normalized DHX36 protein expression was obtained in biological triplicates, and the standard deviation was used as the error bar.

[0018] Figure 2A is a line graph shown according to Example 2 of the present disclosure, which describes the binding curve of A_rG4_FAM and RHAU53 peptide. The data was obtained in biological triplicates, and the standard deviation was used as the error bar.

[0019] Figure 2B is a line graph shown according to Example 2 of the present disclosure, which describes the binding curve of A_dG4_FAM and RHAU53 peptide. The data was obtained in biological triplicates, and the standard deviation was used as the error bar.

[0020] Figure 2C is a line graph shown according to Example 2 of the present disclosure, which describes the binding curve of A_rG4_FAM and DHX36 protein. The data was obtained in biological triplicates, and the standard deviation was used as the error bar.

[0021] Figure 2D is a line graph shown according to Example 2 of the present disclosure, which describes the binding curve of A_dG4_FAM and DHX36 protein. The data was obtained in biological triplicates, and the standard deviation was used as the error bar.

[0022] Figure 3A is a histogram drawn according to Example 3 of the present disclosure, which depicts the efficacy of rG4_A in degrading the DHX36 protein. UTC: Untreated control group. ETC: Empty transfection control group. The normalized DH36 expression levels were obtained in biological triplicates, and the standard deviation was used as the error bar.

[0023] Figure 3B is a photograph of a Western blot of Example 3 of the present disclosure, which depicts the effect of rG4_A or rG4 mut_A on DHX36 after transfection for 0 - 48 hours. β-actin: Internal loading control

[0024] Figure 3C is a histogram drawn according to Example 3 of the present disclosure, which depicts the effect of MG132 on blocking rG4_A-induced DHX36 degradation. The normalized DHX36 expression levels were obtained in biological triplicates, and the standard deviation was used as the error bar.

[0025] Figure 3D is a histogram drawn according to Example 3 of the present disclosure, which depicts the effect of rG4_A or rG4 mut_A on DHX36 degradation in specific cells. The normalized DHX36 expression levels were obtained in biological triplicates, and the standard deviation was used as the error bar.

[0026] Figure 4A is a schematic diagram of the design of a dual luciferase reporter plasmid drawn according to Example 4 of the present disclosure, in which the APP rG4 WT sequence (SEQ ID NO: 3) or the APP rG4 Mut sequence (SEQ ID NO: 4) was inserted into the 3’UTR of renilla luciferase.

[0027] Figures 4B and 4C are histograms drawn according to Example 4 of the present disclosure, which respectively depict the normalized luciferase activities in cells transfected with the APP rG4 WT plasmid (Figure 4B) or the APP rG4 Mut plasmid (Figure 4C) in the presence of rG4_A or rG4 mut_A. The luciferase activities were obtained in biological triplicates, and the standard deviation was used as the error bar. *P<0.05, **P<0.01, NS: Not significant.

[0028] Figures 4D and 4E are histograms drawn according to Example 4 of the present disclosure, which respectively depict the relative expression levels of luciferase mRNA in cells transfected with the APP rG4 WT plasmid (Figure 4D) or the APP rG4 Mut plasmid (Figure 4E) in the presence of rG4_A or rG4 mut_A. The relative expression levels of luciferase mRNA were obtained in biological triplicates, and the standard deviation was used as the error bar. NS: Not significant.

[0029] FIG. 5A is a schematic design diagram of the APP native WT or APP native Mut plasmid according to Example 5 of the present disclosure, in which the APP rG4 WT sequence (SEQ ID NO: 3) or the APP rG4 Mut sequence (SEQ ID NO: 4) is inserted into the 3'UTR of the plasmid.

[0030] FIGS. 5B and 5C are photographs of Western blotting of Example 5 of the present disclosure, which respectively depict the expression levels of specific proteins in cells treated with 0, 25, 50, or 100 nM of rG4_A (FIG. 5B) or rG4 mut_A (FIG. 5C). β-actin: internal loading control group. Control group: blank transfection control group.

[0031] FIGS. 6A to 6C are photographs of Western blotting of Example 6 of the present disclosure, which respectively depict the effects of rG4_A or rG4 mut_A on the expression levels of DHX36 (FIGS. 6A and 6B) and Gnai2 (FIG. 6C) in the presence or absence of MG132.

[0032] FIGS. 6D and 6E are histograms drawn according to Example 6 of the present disclosure, which respectively depict the effects of rG4_A or rG4 mut_A on the proliferation of C2C12 myoblasts (FIG. 6D) and satellite cells (SC; FIG. 6E). The relative EdU incorporation percentage was obtained with biological triplicates, and the standard deviation was used as the error bar. *P<0.05, ***P<0.001.

[0033] According to the usual operating mode, various features and components in the figures are not drawn to scale, and they are drawn in a way to best present the specific features and components related to the present novelty. Detailed Description of the Embodiments

[0034] In order to make the description of the present disclosure more detailed and complete, the following provides an illustrative description of the implementation aspects and specific embodiments of the present invention; however, this is not the only form for implementing or applying the specific embodiments of the present invention. The embodiments cover the features of multiple specific embodiments and the method steps and their sequences for constructing and operating these specific embodiments. However, other specific embodiments can also be used to achieve the same or equivalent functions and step sequences.

[0035] I. Definitions

[0036] For convenience, the specific technical terms used in this specification, the embodiments, and the appended claims are grouped here. Unless otherwise defined in this specification, the meanings of the scientific and technical terms used herein are the same as those understood and commonly used by those of ordinary skill in the technical field to which the present invention pertains. Also, in cases where there is no conflict with the context, the singular nouns used in this specification cover the plural forms of those nouns, and the plural nouns used also cover the singular forms of those nouns. Specifically, in this specification and the claims, the singular forms "a" and "an" include plural reference values, unless otherwise indicated by the context. In addition, in this specification and the claims, the expressions "at least one" and "one or more" have the same meaning, both representing the inclusion of one, two, three, or more.

[0037] Although the numerical ranges and parameters used to define the broader scope of the present invention are approximate values, the relevant numerical values in the specific embodiments have been presented as precisely as possible herein. However, any numerical value inherently and inevitably contains standard deviations resulting from individual testing methods. Here, "about" generally refers to the actual value being within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range. Alternatively, the term "about" represents that the actual value falls within the acceptable standard error of the average value, depending on the considerations of those of ordinary skill in the technical field to which the present invention pertains. Except for experimental examples, or unless otherwise clearly stated, it is understood that all ranges, amounts, numerical values, and percentages (such as those used to describe material amounts, time durations, temperatures, operating conditions, quantity ratios, and others similar) used herein are modified by "about". Therefore, unless otherwise stated to the contrary, the numerical parameters disclosed in this specification and the accompanying claims are approximate values and can be varied as needed. At the very least, these numerical parameters should be understood as the values obtained by indicating the significant digits and applying the general rounding method. Here, a numerical range is expressed as from one endpoint to the other endpoint or between two endpoints; unless otherwise stated, the numerical ranges described herein include the endpoints.

[0038] In the present disclosure, the term "G-quadruplex structure" (G4 structure) refers to a four-stranded helical nucleotide structure that includes multiple stacked G-quartets, each of which is composed of four guanine bases, linked by cyclic Hoogsteen hydrogen bonds and further stabilized by coordination of cations to its center. The body of the stacked G-quartets has 2-8 layers in total, collectively referred to as the G-quartet core. Each four-guanine column that makes up the G-quartet core can be formed by one (consecutive guanine column), two, or four (non-consecutive guanine columns) different stretches of consecutive guanines. Herein, the term "parallel G-quadruplex" refers to a G-quadruplex structure in which all four strands point in the same direction.

[0039] In the present disclosure, the term "ligand" refers to a molecule that is recognized and / or capable of binding to a specific target protein (e.g., an E3 ubiquitin ligase). Depending on the purpose to be achieved, the ligand can be a natural ligand of the target protein or a synthetic molecule that can bind or conjugate to the target protein. The ligand can bind to the target protein through any affinity (i.e., through high or low affinity), as long as the binding of the ligand to the target protein can induce the desired activity or function (e.g., ubiquitin / proteasome-mediated degradation).

[0040] In the present disclosure, the term "targeting moiety" refers to the region in the conjugate that binds to the target of interest (e.g., G4BP of the present disclosure) to facilitate delivery of the conjugate of the present disclosure to the target of interest.

[0041] Herein, the term "proteolytic moiety" refers to the region in the conjugate that binds to the E3 ubiquitin ligase, enabling the target of interest (i.e., G4BP) to be degraded through the ubiquitin-proteasome system (UPS).

[0042] The term "link" herein refers to any method of connecting two substances by direct or indirect bonding.

[0043] The term "administered" (administered, administering, or administration) herein refers to a mode of delivery that includes, but is not limited to, intrathecal, intracerebellar, intratumoral, intravenous, intraarterial, intraperitoneal, or subcutaneous injection of the reagent of the present disclosure (e.g., conjugate).

[0044] In the present disclosure, "treatment" (treatment or treating) includes partially or completely preventing, alleviating, slowing down, and / or managing symptoms, secondary diseases, or disorders associated with a disease (e.g., cancer or AD). As used herein, the term "treatment" refers to the application or administration of a conjugate of the present disclosure to an individual suffering from symptoms, secondary diseases, or disorders associated with a disease (e.g., cancer or AD), with the expectation of partially or completely alleviating, ameliorating, relieving, delaying the onset, inhibiting the progression, reducing the severity, and / or reducing the incidence of one or more disease-related symptoms, secondary diseases, or disorders. As defined herein, treatment is generally considered "effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" if the progression of a symptom, disease, or disorder is reduced or stopped.

[0045] In the present disclosure, the term "effective amount" refers to an amount sufficient to produce the desired therapeutic result. For therapeutic purposes, an effective amount may also refer to an amount in which any toxic or harmful effects of a component are outweighed by the therapeutically beneficial effects. An effective amount of a reagent need not cure a disease or disorder but can be used to treat a disease or disorder, e.g., to delay, impede, or prevent the onset of a disease or disorder, or to ameliorate the symptoms of a disease or disorder. The effective amount may be divided into one, two, or more doses in a suitable form and administered one, two, or more times over a specified period. The specific effective or sufficient amount will vary depending on a variety of factors, such as the particular disorder to be treated, the physical condition of the patient (e.g., the patient's weight, age, or gender), the species of mammal or animal to be treated, the duration of the treatment, the nature of concurrent therapies (if any), and the structure of the specific formulation and compound or its derivative employed.

[0046] The term "subject" refers to a mammal, including a human, that can be treated with a conjugate and / or method of the present disclosure. Unless a gender is specifically indicated, the term "subject" refers to both males and females.

[0047] II. Embodiments

[0048] A first aspect of the present disclosure relates to a conjugate comprising a target site and a proteolytic site. According to certain embodiments of the present disclosure, the target site comprises a nucleotide and a first conjugate group linked to the 5'-end or 3'-end of the nucleotide. The proteolytic site comprises an E3 ubiquitin ligase ligand and a second conjugate group linked thereto.

[0049] Preferably, the first and second conjugate groups are each independently selected from the group consisting of azide, alkyne, tetrazine, cyclooctene, and cyclooctyne groups. In this case, the target site is linked to the proteolytic site through a reaction between the first conjugate group at the target site and the second conjugate group at the proteolytic site, which reaction is a copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction, a strain-promoted azide-alkyne click chemistry (SPAAC) reaction, or an inverse electron demand Diels-Alder reaction (IEDDA). According to one embodiment, one of the first and second conjugate groups is an alkyne group and the other is an azide group; in this embodiment, the target site and the proteolytic site are linked to each other by a CuAAC reaction. According to another embodiment of the present disclosure, one of the first and second conjugate groups is a tetrazine group and the other is a cyclooctyne group (e.g., trans-cyclooctene (TCO)); in this embodiment, the target site and the proteolytic site are linked to each other by an IEDDA reaction. According to yet another embodiment of the present disclosure, one of the first and second conjugate groups is an azide group and the other is a cyclooctyne group (e.g., dibenzoazacyclooctyne (DBCO)); in this embodiment, the target site and the proteolytic site are linked to each other by a SPAAC reaction.

[0050] According to certain embodiments of the present disclosure, the nucleic acid comprises the nucleotide sequence of "GGGUUGCGGAGGGUGGGCCU" (SEQ ID NO: 1). In an exemplary embodiment, the first conjugate group is linked to the 5'-end of the nucleotide.

[0051] According to certain exemplary embodiments of the present disclosure, the target site is in the form of a nucleic acid modified with an alkyne group, i.e., a nucleic acid having a hexynyl group linked to the 5'-end (e.g., SEQ ID NO: 1); and the proteolytic site is in the form of an E3 ligase ligand modified with an azide group, i.e., an E3 ligase having an azide group linked thereto. In these embodiments, the target site is linked to the proteolytic site through a CuAAC reaction.

[0052] It is understood that the ligand of the E3 ligase can be any molecule that has a binding affinity with the E3 ligase and can transfer ubiquitin to the target protein. Non-limiting examples of the E3 ligase ligand applicable to the present disclosure include lenalidomide, lenalidomide hemihydrate, pomalidomide, CC-885, eragidomide, thalidomide, thalidomide 4-fluoride, thalidomide 5-fluoride, PT-179, iberdomide, cemsidomide, golcadomide, AHPC (also known as (S,R,S)-AHPC), AHPC hydrochloride (also known as (S,R,S)-AHPC hydrochloride), and AHPC-Me hydrochloride (also known as (S,R,S)-AHPC-Me hydrochloride). In one embodiment, the E3 ligase ligand is AHPC, which has the structure. In another embodiment, the E3 ligase ligand is pomalidomide, which has the structure.

[0053] Optionally, the proteolytic site further comprises a linker (e.g., 1-5 repeated EG units) for linking the second conjugate group to the E3 ubiquitin ligase.

[0054] According to certain embodiments of the present disclosure, the proteolytic site has the structure of formula (I), In these embodiments, the E3 ligase ligand is AHPC, which is linked to the azide group through a linker having 2 repeated EG units.

[0055] According to one embodiment, the conjugate of the present disclosure has the structure of formula (III), wherein X is a nucleic acid (e.g., SEQ ID NO: 1). In this embodiment, the proteolytic site has the structure of formula (I), which is linked to the 5'-hexynyl modified nucleic acid through the CuAAC reaction.

[0056] According to certain embodiments of the present disclosure, the proteolytic site has the structure of formula (II), In these embodiments, the E3 ligase ligand is pomalidomide, which is linked to the azide group through a linker comprising one EG unit.

[0057] According to one embodiment, the conjugate of the present disclosure has the structure of formula (IV), wherein X is a nucleic acid (e.g., SEQ ID NO: 1). In the embodiment, the proteolytic moiety has the structure of formula (II), which is linked to the 5'-hexynyl modified nucleic acid through a CuAAC reaction.

[0058] Preferably, the conjugate of the present disclosure is encapsulated by a lipid nanoparticle (LNP) to facilitate the delivery of the conjugate into cells. As is well known in the art, LNP is a biocompatible carrier for phospholipid monolayer structures, which encapsulates nucleic acids in a lipid core to avoid degradation. LNP generally has four components, including ionizable cationic phospholipids, neutral helper phospholipids, cholesterol, and polyethylene glycol-modified phospholipids. The LNP is prepared by methods well known in the art, for example, microfluidic preparation, or using a microfluidic device. Therefore, for the sake of brevity, it will not be elaborated here. Alternatively, the conjugate of the present disclosure can be encapsulated / delivered through other delivery systems, for example, liposomes, lipid polymer complexes, polymeric materials, micelles, peptides, protamine, or electroporation. For example, see Mingyuan Li et al., European Journal of Medicinal Chemistry (2022), 227:113910.

[0059] According to certain embodiments, when the conjugate of the present disclosure enters the cell, the target moiety directly binds to G4BP, and the proteolytic moiety attracts the E3 ligase to promote ubiquitination and subsequent degradation of G4BP, thereby downregulating or inhibiting the gene expression mediated by G4BP / rG4.

[0060] According to certain embodiments, the conjugate of the present disclosure inhibits the expression of APP. According to certain embodiments, the conjugate of the present disclosure inhibits the expression of Gnai2.

[0061] The second aspect of the present disclosure relates to a method of treating a disease (especially a disease associated with and / or caused by overexpression of rG4 and / or G4BP) using the conjugate of the present disclosure. The method includes administering an effective amount of the conjugate of the present disclosure to an individual in need to alleviate or relieve the symptoms associated with the disease. In certain embodiments of the present disclosure, the disease is AD.

[0062] Exemplary cancers treatable by the conjugates and / or methods of the present disclosure include, but are not limited to, gastric cancer, lung cancer, bladder cancer, breast cancer, pancreatic cancer, kidney cancer, colorectal cancer, cervical cancer, ovarian cancer, brain tumors, prostate cancer, hepatocellular carcinoma, melanoma, esophageal cancer, multiple myeloma, head and neck squamous cell carcinoma, or combinations thereof.

[0063] As described above, the conjugates of the present disclosure are preferably encapsulated by LNP. Alternatively, the conjugates of the present disclosure can be delivered into cells by liposomes, lipid-polymer complexes, polymeric materials, micelles, peptides, protamine, or electroporation.

[0064] Depending on the desired objective, the conjugates of the present disclosure can be administered to an individual by an appropriate route, for example, by mucosal, intravenous, intra-arterial, intramuscular, subcutaneous, intrathecal, intraperitoneal, or intracerebellar injection.

[0065] Basically, individuals treatable by the methods of the present disclosure are mammals, such as: humans, mice, rats, guinea pigs, hamsters, monkeys, pigs, dogs, cats, horses, sheep, goats, cows, and rabbits. Preferably, the individual is a human.

[0066] The following presents several examples to illustrate certain aspects of the present invention to facilitate those of ordinary skill in the art to practice the present invention, and these examples should not be regarded as limiting the scope of the present invention. It is believed that those skilled in the art can fully utilize and practice the present invention without excessive interpretation after reading the description presented herein. Examples

[0067] Materials and Methods

[0068] Click reaction between 5'-hexynyl oligonucleotide and azide-modified E3 ligase ligand

[0069] The following procedure is for the reaction of alkynyl-modified oligonucleotides and azide-containing compounds in a 20 μL reaction mixture containing dimethyl sulfoxide (DMSO) and nuclease-free water. Before the reaction, 1.6 μL of 5'-hexynyl oligonucleotide (from a 1 mM stock solution in nuclease-free water) was denatured by treatment at 95 °C for 5 minutes and then cooled on ice for 10 minutes. Triethylammonium acetate buffer (2 μL from a 2 M stock solution in nuclease-free water (pH 7.0)) was added to the denatured product to a final concentration of 0.2 M. Then, 2 μL of DMSO was added to the mixture and mixed by shaking. Azide compound stock solution (6.4 μL from a 1 mM DMSO stock solution, final concentration 320 μM) was added to the mixture and mixed by shaking. 1 μL of freshly prepared ascorbic acid (from a 10 mM stock solution in nuclease-free water) and 1 μL of Cu(II)-TBTA (from a 10 mM DMSO stock solution) were added to the mixture and briefly mixed by shaking. An appropriate amount of DMSO and nuclease-free water (about 50:50 ratio in the final reaction mixture) was added to completely dissolve all the reagents used in the reaction mixture. Nitrogen was bubbled through the solution for 30 seconds and sealed for degassing. At 40 °C, the click reaction was placed on an oscillator and shaken at 1000 rpm for 6 hours. The rG4 conjugate was purified using a spin column. Alcohol precipitation was further performed to purify the dG4 conjugate (oligonucleotide length less than 20 nt).

[0070] After gold staining, the efficiency of the click reaction was analyzed using a 10% denaturing polyacrylamide gel, and the yield was determined using software. The synthesized conjugate was confirmed using a matrix-assisted laser desorption / ionization time-of-flight (MALDI TOF / TOF) analyzer.

[0071] Electrophoretic mobility shift assay (EMSA)

[0072] All oligonucleotides were heated at 75 °C for 5 minutes and then cooled on ice for 10 minutes. Different concentrations of RHAU53 peptide (0 - 2 μM) were mixed with 5-carboxyfluorescein (FAM)-labeled oligonucleotides or G4-compound conjugates (30 nM) in Tris-HCl buffer (25 mM Tris-HCl, 150 mM KCl, and 1 mM MgCl 2 ) at pH 7.5. The mixture was incubated at 37 °C for 30 minutes, and 5% glycerol was added to each sample. At 4 °C, the bound and unbound RNAs were separated on a 10% non-denaturing polyacrylamide gel in 0.5× Tris / Borate / EDTA (TBE) at 150 V. The gel was scanned at 500 V using a scanner and quantified using software.

[0073] Microscale thermophoresis (MST)

[0074] Before the reaction, the FAM-labeled G4-compound conjugate was heat-treated at 75 °C for 5 minutes and then cooled on ice for 10 minutes. The DHX36 protein was serially diluted from a sample with a maximum concentration of 1 μM into 16 samples, and FAM-labeled oligonucleotide (40 nM) was added to each sample. The samples were incubated in Tris-HCl buffer (25 mM Tris-HCl, 150 mM KCl, and 1 mM MgCl 2 ) at 37 °C for 30 minutes. The binding affinity assay was performed on a capillary using an MST machine. Curve fitting and K d determination were performed by software.

[0075] Detection of the degradation efficacy of rG4-protein hydrolysis targeting chimeras (rG4-PROTACs) against DHX36 by Western blotting

[0076] 1×10 5 HeLa cells were seeded in a 12-well plate and cultured overnight. rG4-PROTACs or rG4 mut-PROTAC were transfected into the cells for 24 hours using LIPOFECTAMINE TM 2000 reagent. The cells were lysed with radioimmunoprecipitation assay (RIPA) buffer supplemented with 1× protease inhibitor. Total protein was obtained by centrifugation at 13,000 rpm for 15 minutes at 4 °C. 30 ng of cell lysate from each sample was analyzed by 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) at 100 V for 15 minutes and then at 120 V for 40 minutes. At 4 °C, the protein blot was transferred to a polyvinylidene difluoride (PVDF) membrane at 100 V for 90 minutes. The membrane was blocked with 5% skim milk at room temperature for 1 hour. Subsequently, the membrane was co-incubated with the DHX36 primary antibody (1:1000) overnight at 4 °C. After washing 5 times with TBST buffer (containing 20 Tris-buffered salts), the membrane was co-incubated with the secondary antibody (1:1000) for 1 hour at room temperature, and then washed 5 times with TBST buffer. Finally, the membrane was detected using an imaging system and analyzed using software.

[0077] Immunofluorescence staining

[0078] Seed 2×10 4 HeLa cells in a 35-mm diameter confocal dish and culture overnight. Transfect FAM-labeled rG4-PROTACs (3 pmol) or FAM-labeled rG4mut-PROTACs (3 pmol) into the cells for 4 hours using LIPOFECTAMINE TM 2000. Fix the cells with 4% paraformaldehyde (PFA) for 15 minutes and wash them 3 times with nuclease-free phosphate-buffered saline (PBS). Then, permeabilize the cells with 1 mL of 0.3% TRITON TM X-100 at room temperature for 20 minutes. After washing 3 times with nuclease-free PBS, incubate the cells in 1% bovine serum albumin (BSA) in PBS for 30 minutes to block non-specific binding of antibodies. Then, wash the cells 3 times with PBS and incubate them overnight at 4°C with diluted DHX36 antibody (1:500) in 1% BSA. Wash the cells 3 times with PBS and incubate them with ALEXA FLUOR TM 647 secondary antibody (1:500) in the dark for 1 hour at room temperature. After washing 3 times with PBS, stain the HeLa cells with 4’,6-diamidino-2-phenylindole (DAPI) for 15 minutes. Image the cells using a confocal microscope.

[0079] Dual-luciferase reporter assay

[0080] Separate DNA sequences encoding APP rG4 WT and APP rG4 Mut are introduced into the 5’ UTR of the Renilla luciferase gene in the psiCHECK-2 vector. Seed 2×10 4 HeLa cells in a 96-well black plate. Co-transfect 10 ng of WT or Mut plasmid with rG4_A and rG4 mut_A (0, 50 nM, 100 nM, 200 nM) into the cells for 48 hours using LIPOFECTAMINE TM 2000. Confirm the luciferase activity using a microplate analyzer. The activity of Renilla luciferase is normalized relative to the activity of firefly luciferase for data analysis.

[0081] Detect the dual-luciferase reporter gene by quantitative real-time PCR (RT-PCR)

[0082] Extract the total RNA from 1×10 5 HeLa cells using an RNA extraction kit. Reverse transcribe 100 ng of total RNA with random primers. For the PCR amplification procedure, mix the primers of the reporter gene and cDNA with SYBR Green quantitative PCR mix. Perform RT-PCR using a real-time PCR detection system.

[0083] Effect of rG4-PROTAC on the expression of native APP protein

[0084] Clone the DNA sequences encoding the full-length coding region of APP, Myc tag, and APP rG4 WT or rG4 Mut into the pEGFPN1 vector respectively. Seed 1×10 5 HEK 293T cells in a 24-well plate and culture overnight. Transfect 500 ng of APP native WT or Mut plasmids with rG4_A and rG4mut_A (0, 25 nM, 50 nM, 100 nM) into the cells using LIPOFECTAMINE TM 2000 and culture for 24 hours. Analyze the expression of DHX36, APP, and Myc proteins using the Western blotting procedure described above. Incubate the PVDF membrane with APP primary antibody (1:1000) and Myc primary antibody (1:1000).

[0085] Translation of Gnai2 is downregulated by rG4-PROTACs

[0086] Culture mouse C2C12 myoblasts (CRL-1772) in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (complete medium) at 37 °C in an environment containing 5% CO 2 . Seed 5×10 4 C2C12 cells in a 24-well plate and culture overnight. Transfect rG4-PROTAC or rG4 mut-PROTAC (0, 50 nM, 100 nM, 150 nM, 200 nM) into the cells using LIPOFECTAMINE TM 2000 reagent for 24 hours. Analyze the expression of DHX36 and Gnai2 proteins using the Western blotting procedure described above. Use Gnai2 primary antibody (1:5000) in this experiment.

[0087] 5-Ethynyl-2'-deoxyuridine (EdU) Cell Proliferation Assay

[0088] In this experiment, C2C12 myoblasts and satellite cells were used. Satellite cells (SCs) were isolated from skeletal muscle tissue and cultured in Ham's F10 medium (growth medium) supplemented with 20% FBS and basic fibroblast growth factor (bFGF; 0.025 μg / ml). EdU staining was performed according to the manufacturer's protocol. Briefly, 5×10 4 C2C12 or SC cells were seeded on coverslips and cultured overnight. rG4-PROTAC or rG4 mut-PROTAC (200 nM) was transfected into the cells for 24 hours using LIPOFECTAMINE TM 2000 reagent. A 10 mM stock solution of EdU was diluted with complete medium to a final concentration of 20 μM. The coverslips were transferred to 6-well plates. Then, an equal volume of 20 μM EdU was added to obtain a final solution with a concentration of 10 μM, and the cells were cultured for 60 minutes. The medium was removed, and the cells were fixed with 1 ml of 3.7% PFA for 15 minutes at room temperature. The cells were washed twice with 3% BSA in PBS. 1 ml of 0.5% Triton TM X-100 was added to the cells and cultured for another 20 minutes. The cells were washed twice with 3% BSA in PBS. Freshly prepared ALEXA 488 azide reaction mixture was added to each well and incubated in the dark for 30 minutes. The cells were washed twice with 3% BSA in PBS and stained with DAPI for 15 minutes. Cell imaging was performed using a confocal microscope.

[0089] Example 1 Design and Synthesis of rG4-PROTAC Targeting G4BP

[0090] The RNA component of human telomerase (hTERC) rG4 (5’-GGGUUGCGGAGGGUGGGCCU-3’; SEQ ID NO: 1) can strongly bind to the RHAU-specific motif containing 53 amino acids (RHAU53) with nanomolar affinity. Accordingly, hTERC rG4 (hTERC rG4 WT; SEQ ID NO: 1) was selected as the warhead targeting G4BP; and the control sequence (hTERC rG4 Mut; GAAUUGCGGAGAAUGAACCU; SEQ ID NO: 2) was designed to mutate G to A at the key bases to prevent rG4 formation. Meanwhile, two widely validated E3 attractors, AHPC (VHL ligand) and pomalidomide (cereblon ligand), were used to link to the rG4 motif respectively. An alkyne was linked to the 5’ end of rG4, and azides were introduced into the derivatives of AHPC and pomalidomide. RNA oligomers modified with 5’-hexyne and compounds modified with azides were successfully synthesized into four rG4-PROTACs (rG4_A, rG4mut_A, rG4_P, and rG4 mut_P) (Table 1) through copper(I)-catalyzed click reaction.

[0091] Table 1 rG4-PROTACs of the present disclosure

[0092] The click reaction efficiency was detected by denaturing PAGE, and the conjugates reached a yield of more than 90% (Figure 1A), and were confirmed by mass spectrometry analysis (data not shown). Compared with the rG4 mut_ligand conjugate, treatment with 50 nM of rG4_A for 24 hours could result in 93% degradation of DHX36 in Hela cells (Figure 1B), while rG4_P showed relatively weak efficacy (42% degradation).

[0093] The results showed that each of rG4-A and rG4-P could be used to degrade G4BP (DHX36). Since rG4-A had better efficacy than rG4-P, rG4-A was selected for subsequent experiments.

[0094] Example 2 Binding Affinities of rG4-PROTAC to RHAU53 and DHX36

[0095] To visualize the targeting efficacy of rG4-PROTAC, the 3'-end of the fluorescein-labeled 5'-hexynyl_hTERC rG4 WT or Mut sequence (SEQ ID NO: 1 or 2) was conjugated with AHPC for recruiting the E3 ligase, hereinafter referred to as A_rG4_FAM and A_rG4 mut_FAM. Recently, alkyne-functionalized T95-2T dG4 and mutant sequences have been linked to an E3 ligase-binding small molecule (dG4-PROTAC), demonstrating effective degradation of RHAU by the proteasome complex. To compare the binding affinities of rG4-PROTAC and dG4-PROTAC, A_dG4_FAM and A_dG4 mut_FAM conjugates were synthesized by the click reaction procedure as described for the synthesis of rG4-PROTAC. The products were verified by mass spectrometry analysis.

[0096] To evaluate the targeting recognition ability of rG4-PROTAC, the binding assay of A_rG4_FAM to the RHAU53 peptide was performed by EMSA. The RHAU53 peptide (truncated DHX36 fragment) is the most important core protein region required for the rG4-RHA interaction. According to the results of FIGS. 2A and 2B, the dissociation constant (K d ) of A_rG4_FAM was 139.7±6.1 nM (FIG. 2A), which was about 2.4-fold lower than that of A_dG4_FAM (330.6±3.7 nM; FIG. 2B).

[0097] Using the full-length DHX36 protein, the efficacy of rG4-PROTAC of the present disclosure in recognizing G4BP was further confirmed by MST binding assay. According to the results of FIG. 2C, the K d (126±41 nM) of A_rG4_FAM was confirmed by MST binding assay, which was consistent with the EMSA results in FIG. 2A, indicating a strong interaction between A_rG4_FAM and DHX36. As described above, the affinity of A_dG4_FAM for RHAU53 (K d = 330.6±3.7) was about 2.4-fold higher than that of A_rG4_FAM for RHAU53 (FIG. 2B). The interaction between A_dG4_FAM and the DHX36 protein was quantified by MST (K d = 303±55; FIG. 2D) and the results were confirmed, indicating a relatively weak interaction with DHX36.

[0098] To study the binding specificity of G4-PROTAC, EMSA assays were performed using non-G4 motifs (A_rG4 mut_FAM and A_dG4 mut_FAM), and no binding was observed (data not shown), indicating that G4-PROTAC targets DHX36 through rG4 formation.

[0099] Overall, rG4-PROTAC showed almost 3-fold higher binding affinity for DHX36 compared to dG4-PROTAC, making it an effective tool for degrading rG4-binding proteins.

[0100] Example 3 Degradation of DHX36 induced by rG4-PROTAC in a ubiquitination-dependent manner

[0101] To confirm whether rG4-PROTAC can enter cells, confocal microscopy was used for verification. The results showed that FAM-labeled rG4-PROTAC (A_rG4_FAM and A_rG4 mut_FAM) could be successfully transfected into Hela cells (data not shown). At the same time, strong fluorescence focus co-localization was observed between the cells treated with A_rG4_FAM and endogenous DHX36, while almost no merged foci were observed in the cells transfected with A_rG4 mut_FAM (data not shown), indicating that only the transfected rG4 motif degrader can interact with the DHX36 protein. To detect the protein degradation profile characteristics of rG4-PROTAC, different concentrations of rG4_A were transfected into Hela cells. The results of Western blotting showed that the protein level of DHX36 decreased significantly with the increase in the concentration of rG4_A. The highest degradation of DHX36 (more than 90%) was observed at a concentration of 62.5 nM (Figure 3A). Once the concentration exceeded 62.5 nM, protein degradation weakened with the increase in the rG4-A dose (Figure 3A), which confirmed the results of the aforementioned PROTAC. The weaker effect at concentrations higher than 62.5 nM may be due to the hook effect of the cells, in which the binary interaction of DHX36-rG4_A / rG4_A_E3 ligase competes effectively with the ternary interaction of DHX36-rG4_A_E3 ligase. As a negative control group, neither the untreated control (UTC), the empty transfection control (ETC), nor the rG4 mutant (rG4mut_A) had a significant effect on the protein level of DHX36 (Figure 3A). In addition, the time-dependence of rG4-A on DHX36 showed that treating cells with 50 nM of rG4_A resulted in a reduction of more than 50% of DHX36 within 6 hours and a maximum degradation of 95% at 48 hours (Figure 3B).

[0102] In addition, the degradation of DHX36 induced by rG4_A was blocked by the proteasome inhibitor MG132 (1 μM), indicating that rG4PROTAC mediates the degradation of DHX36 in a proteasome-dependent manner (Figure 3C). Similarly, transfection of HEK 293T and MCF-7 cell lines with 50 nM of rG4_A also resulted in proteasome-dependent degradation of approximately 70% of the DHX36 protein within 24 hours (Figure 3D). Notably, when the concentration of dG4_A increased, the expression of the DHX36 protein was not significantly inhibited (data not shown). These data are consistent with the results of the EMSA experiment (Figure 2), indicating that the targeting efficacy and degradation efficiency of dG4-PROTAC are weaker compared to rG4-PROTAC.

[0103] Furthermore, the efficacy of rG4-PROTAC was compared with that of traditional DHX36 gene-silencing siRNA. No significant degradation of DHX36 was observed 24 hours after treatment with siRNA, as compared with samples treated with control siRNA (siNC), and an 85% reduction in DHX36 protein was observed only after 48 hours of treatment (data not shown). Accordingly, compared with the siRNA method, rG4-PROTAC has a shorter action time (more than 50% reduction was achieved in 6 hours, and DHX36 was almost completely depleted in 24 hours) (Figure 3B), so it is an effective G4BP degradation tool.

[0104] In summary, the foregoing findings support the view that rG4 motifs can be used to construct G4BP-targeting predators, including through the ubiquitin-proteasome system (UPS).

[0105] Example 4 Using rG4-PROTAC to Control APP Gene Expression

[0106] It is known that the rG4 motif exists in the 3’UTR of APP mRNA. DHX36 is a widely studied member of the DEAD / H-BOX helicase family, which participates in various biological processes by binding to and unwinding G4 structures. EMSA results indicate that APP rG4 has a strong binding affinity for DHX36 (data not shown). In this example, it was confirmed that regardless of whether DHX36 shows an unwinding effect on APP 3’UTR rG4 and rG4-PROTAC, it can trigger the formation of APP rG4 and inhibit its gene expression by degrading DHX36. To explore the above argument, a FAM-labeled APPWT_unwind oligomer containing the rG4 motif with APP in the 3’UTR and a polyadenylate tail was synthesized for the DHX36 unwinding assay. According to the analysis results, after thermal denaturation in the absence of DHX36, culturing the APP WT_unwind and APP WT_Trap RNA constructs formed stronger duplex bands and lighter rG4 bands (as the positive control group of the experiment; data not shown). Notably, in the presence of ATP, after DHX36 binds to and unfolds APP rG4, the APP WT_Trap RNA sequence pairs complementarily with the APP WT_unwind construct, thus forming duplex and rG4 bands with a concentration comparable to that of the positive control group (data not shown). Duplexes could not be formed in the absence of DHX36 or ATP, or when ATP was replaced with AMP-PNP (a non-hydrolyzable ATP analogue) (data not shown). Taken together, the data show that DHX36 can bind to and unfold APP 3’UTR rG4 in vitro.

[0107] To investigate the effect of rG4-PROTAC on APP gene regulation in cells, luciferase reporter plasmids were constructed by introducing the APP rG4 WT motif (5'-CGGGGCGGGTGGGGAGGGGT-3'; SEQ ID NO: 3) or the APP rG4 Mut motif (5'-CGAAGCGAGTGAAGAGAAGT-3'; SEQ ID NO: 4) into the 3'UTR of the Renilla gene, designated as APP rG4 WT or APP rG4 Mut. The luciferase signal in the same plasmid was normalized to the firefly luciferase signal (Figure 4A). Compared to the APP rG4 Mut construct, the normalized luciferase activity was decreased by 36.03 ± 1.02% in the APP rG4 WT construct group (Figure 4B and Figure 4C; column 1), indicating that the APP rG4 motif negatively regulates gene expression. Importantly, rG4_A inhibited the luciferase activity of the APP rG4 WT construct in a concentration-dependent manner (Figure 4B and Figure 4C; columns 1-4), but did not inhibit the luciferase activity of the APP rG4 Mut construct (Figure 4B and Figure 4C; columns 5-7). As a negative control, rG4_A did not regulate the luciferase activity in the APP rG4 WT and APP rG4 Mut constructs (Figure 4B and Figure 4C). Finally, the mRNA levels of the dual-luciferase genes were confirmed by RT-qPCR assays, and the data showed no significant changes in the mRNA levels (Figure 4D and Figure 4E), indicating that rG4_A affects the translation of the target protein but not transcription.

[0108] Example 5 rG4-PROTAC Inhibits the Expression of Native APP Protein

[0109] To further confirm the aforementioned rG4-PROTAC-mediated rG4 gene regulation, APP native WT and APP native Mut were created by constructs containing the full-length APP coding sequence (CDS), Myc tag, and either the rG4 wild-type or mutant motif in the 3'UTR to confirm the expression levels of native APP proteins (Figure 5A). The APP native WT plasmid was co-transfected with different concentrations of rG4_A or rG4 mut_A. The data showed that the expression level of native APP protein decreased with increasing doses of rG4_A (Figure 5B). In contrast, in the presence of rG4 mut_A, the normalized APP expression levels in the APP native WT group did not show a similar protein inhibitory effect (Figure 5C). Additionally, the effect of rG4_A on gene expression in the native APP Mut construct was also examined, and no difference was observed upon treatment with rG4_A (data not shown), confirming that rG4-PROTAC only interferes with rG4-mediated gene regulation.

[0110] In summary, the above data show that rG4_A can negatively regulate rG4-mediated APP gene translation by reducing the formation of rG4 motifs induced by DHX36 protein, resulting in a decrease in APP protein.

[0111] Example 6 rG4-PROTAC reduces Gnai2 protein expression and affects the proliferation ability of myoblasts and muscle stem cells

[0112] It is known that DHX36 specifically regulates Gnai2 mRNA translation by unwinding the rG4 motif located in the 5’UTR, and Gnai2 mRNA translation is extremely important for the regenerative ability of SCs. In this example, it was confirmed that Gnai2 rG4 has a strong binding affinity for DHX36 protein (data not shown), and the ability of rG4-PROTAC to regulate Gnai2 gene expression was tested by depleting DHX36 protein in cells. After increasing the treatment concentration of rG4_A, DHX36 showed dose-dependent degradation, but rG4 mut_A could not degrade DHX36 (Figure 6A). In addition, the degradation effect of rG4_A on DHX36 was blocked by the proteasome inhibitor MG132 (Figure 6B). Meanwhile, the downstream effector gene Gnai2 also showed concentration-dependent downregulation in C2C12 myoblasts (Figure 6C), indicating that rG4_A promotes the formation of rG4 at the 5’UTR of Gnai2 by degrading DHX36 protein, triggering the inhibition of Gnai2 protein translation.

[0113] To evaluate the effect of rG4_A on cell proliferation ability, EdU incorporation was measured in C2C12 myoblasts cultured for 2 days. The results showed that in the rG4 mut_A treatment group, 55.06% ± 2.94 of C2C12 myoblasts were EdU+, while in the rG4_A treatment group, only 44.33% ± 3.08 of C2C12 myoblasts were EdU+ (Figure 6D). The inhibitory effect of rG4 on proliferation was verified in SCs, where in the rG4 mut_A treatment group, 3.70% ± 0.44 of SCs were EdU+, while in the rG4_A treatment group, only 2.47% ± 0.72% of SCs were EdU+ (Figure 6E). The EdU assay showed that after rG4_A treatment, the proliferation ability of SCs and C2C12 was inhibited due to the absence of DHX36.

[0114] In summary, the present disclosure provides two exemplary rG4-based proteolysis-targeting chimeras (rG4-PROTACs), namely "rG4_A" and "rG4_P". According to the embodiments of the present disclosure, each rG4-PROTAC of the present disclosure can effectively degrade G4BP and regulate the translation of rG4-containing transcripts in cells. Specifically, DHX36 (an rG4 helicase that can be degraded by the rG4-PROTAC (rG4_A) that has been widely studied) significantly reduces the protein expression of APP and Gnai2. Therefore, the rG4-PROAC of the present disclosure provides a potential method for treating different diseases (such as cancer and / or AD) by targeting abnormal rG4-G4BP complexes.

[0115] It should be understood that the foregoing description of the embodiments is given only by way of example, and those of ordinary skill in the art can make various modifications. The above specification, examples and experimental results provide a complete description of the structure and use of the exemplary embodiments of the present invention. Although various specific embodiments of the present invention are disclosed in the above embodiments, they are not intended to limit the present invention. Those of ordinary skill in the art to which the present invention pertains can make various changes and modifications without departing from the principles and spirit of the present invention. Therefore, the scope of protection of the present invention shall be defined by the appended patent application scope.

Claims

1. A conjugate comprising: A target site comprising a nucleic acid; and a first conjugated group connected to the nucleic acid, wherein the nucleic acid comprises a nucleotide sequence of GGGUUGCGGAGGGUGGGCCU (SEQ ID NO: 1); and a proteolytic site comprising an E3 ubiquitin ligase ligand; and a second conjugated group connected to the E3 ubiquitin ligase ligand; in The first and second conjugated groups are respectively selected from the group consisting of azide, alkyne, tetrazine, cyclooctene and cyclooctyne groups; and The target site is linked to the proteolytic site via a reaction between a first conjugated group of the target site and a second conjugated group of the proteolytic site, wherein the reaction is a copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction, a strained-promoted azide-alkyne click chemistry (SPAAC) reaction, or an inverse-electron demand Diels-Alder reaction (IEDDA).

2. The conjugate of claim 1, wherein the first conjugated group is a hexyne group connected to the 5' end of the nucleic acid.

3. The conjugate of claim 1, wherein the proteolytic site further comprises a linker for connecting the second conjugated group to the E3 ubiquitin ligase ligand.

4. The conjugate of claim 3, wherein the linker comprises 1 to 5 repeating ethylene glycol (EG) units.

5. The conjugate of claim 1, wherein the E3 ubiquitin ligase ligand is (2S,4R)-1-((S)-2-amino-3,3-dimethylbutyryl)-4-hydroxy-N-(4-(4-methylthiazol-5-yl)benzyl)pyrrolidine-2-carboxamide or pomalidomide.

6. The conjugate of claim 5, wherein the proteolytic site has a structure of formula (I) or formula (II), 7. The conjugate of claim 6, wherein the conjugate has a structure of formula (III) or formula (IV), wherein X is the nucleic acid.

8. Use of the conjugate as claimed in claim 1 for preparing a drug for treating Alzheimer's disease (AD) to reduce or alleviate symptoms associated with AD.

9. Use of the conjugate as claimed in claim 1 for preparing a drug for treating cancer, so as to alleviate or relieve symptoms associated with cancer.

Images