Carbon quantum dot, preparation method thereof and application of carbon quantum dot in delivery of nucleic acid molecules

Abstract

The invention belongs to the technical field of gene delivery vectors, and particularly relates to a carbon quantum dot as well as a preparation method and application thereof in delivery of nucleic acid molecules. The preparation method of the carbon quantum dots comprises the following steps: S1, heating and melting a carbohydrate compound at 120-155 DEG C, then adding a dimethyl diallyl ammonium chloride aqueous solution according to the mass ratio of the carbohydrate compound to dimethyl diallyl ammonium chloride of 1: (0.129-1.291), and carrying out heat preservation at 150-180 DEG C for 30-240 minutes; and S2, cooling the reaction product to room temperature, adding deionized water for dissolving, centrifuging, collecting supernate, and filtering, dialyzing and freeze-drying to obtain the carbon quantum dots. The carbon quantum dot is good in water solubility and dispersity, carries positive charges, can be efficiently combined with RNA molecules and protect the RNA molecules from being degraded by nuclease, is beneficial to greatly improving the stability and effectiveness of nucleic acid molecules, has excellent nucleic acid delivery capacity and has wide application prospects in the fields of nucleic acid delivery and gene therapy.

Description

Technical Field

[0001] The present invention relates to the technical field of gene delivery vectors, and particularly relates to a carbon quantum dot, a preparation method thereof, and an application thereof in delivering nucleic acid molecules. Background Art

[0002] In the fields of gene transfection and gene therapy, safely and effectively delivering exogenous genetic materials, such as nucleic acid molecules like deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), to specific cells is crucial for the realization of the functions of genetic materials. Currently, the mainstream gene delivery vectors mainly include viral vectors such as adeno-associated virus (AAV) vectors and lentivirus (LV) vectors, and non-viral vectors such as lipid nanoparticles (LNP), cationic polymers, etc. Viral vectors package exogenous genes into the outer shells of natural viruses and introduce the exogenous genes into cells by utilizing the infectivity of the viruses to host cells; viral vectors are widely used due to their high transduction efficiency and expression efficiency, but the antigenicity and potential tumorigenic risks of viral vectors limit their extensive application. Non-viral gene delivery vectors not only have the safety and stability that viral vectors do not have, but also have advantages such as being easy to prepare and having a high ability to carry target genes. For example, polymers can effectively condense DNA through strong electrostatic interactions to form relatively stable polyelectrolyte complexes (PECs), and these PECs are easy to internalize by cells and can effectively protect DNA from degradation by DNase. As another approach for delivering exogenous genetic materials, non-viral vectors have received increasing attention from researchers.

[0003] Short non-coding RNA is a type of RNA that is no longer than 40 nt and does not participate in protein coding. Although short non-coding RNA molecules are small, they are involved in the regulation and control of almost all life activities, including cell proliferation, differentiation, apoptosis, cell metabolism, and body immunity, and play a vital role in living organisms. Common short non-coding RNAs include microRNA (miRNA) and small interfering RNA (siRNA), which can regulate target genes in cells. For example, siRNA specifically degrades mRNA synthesized by specific proteins, thereby accurately inhibiting or shutting down specific gene expression, making siRNA extremely promising in the field of life science research and clinical treatment of diseases such as cancer. However, since miRNA and siRNA are negatively charged, they cannot directly enter the target cell through the cell membrane to function, and their structural stability is poor, making them more easily degraded by nucleases that are widely present in organisms. In order to improve the stability of siRNA, siRNA is usually chemically modified at multiple sites, but chemically modified siRNA has disadvantages such as metabolic instability and increased toxic side effects. At present, delivery systems based on non-viral vectors have shown very broad application prospects in small molecule RNA delivery. Among them, nanoparticle materials have attracted great attention due to their unique characteristics such as small size (particle size is usually 0.1-100nm), strong chemical inertness, low toxicity, good biocompatibility and easy functionalization. However, due to the lack of gene packaging ability, nanoparticle materials are difficult to be directly used in gene carriers. Therefore, it is of great significance to develop new small molecule RNA nanoparticle delivery carriers to achieve efficient RNA loading and transport it into cells while improving RNA stability and extending half-life. Summary of the invention

[0004] In view of the above problems of the prior art, the present invention provides a carbon quantum dot and a method for preparing the same, and provides the use of the aforementioned carbon quantum dots as a carrier in the delivery of nucleic acid molecules. The carbon quantum dots provided by the present invention have good water solubility and dispersibility, carry positive charges, can efficiently bind to RNA molecules and protect RNA molecules from being degraded by nucleases, which is beneficial to greatly improve the stability and effectiveness of nucleic acid molecules, and have excellent nucleic acid delivery capabilities, and have broad application prospects in the fields of nucleic acid delivery and gene therapy. To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:

[0005] The first aspect of the present invention provides a method for preparing carbon quantum dots, comprising the following steps:

[0006] S1. Heat the saccharide compound to 120 - 155 °C to melt the saccharide compound, then add an aqueous solution of dimethyldiallylammonium chloride, and keep it at 150 - 180 °C for 30 - 240 min. The mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.129 - 1.291;

[0007] S2. Cool the reaction product of step S1 to room temperature, add deionized water to dissolve the reaction product, then centrifuge to collect the supernatant, and the supernatant is filtered, dialyzed and freeze-dried to obtain the carbon quantum dots.

[0008] Further, in step S1, the mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.645.

[0009] Further, in step S1, the mixed reaction system of the saccharide compound and the aqueous solution of dimethyldiallylammonium chloride is kept at 150 °C for 180 min.

[0010] Further, the saccharide compound is selected from at least one of glucose, xylose, arabinose, fructose and mannose.

[0011] Further, the saccharide compound is selected from glucose, and the glucose is heated and melted at 150 °C for 30 min.

[0012] Furthermore, heat glucose at 150 °C for 30 min to melt it, then add an aqueous solution of dimethyldiallylammonium chloride, and keep it at 150 °C for 180 min. The mass ratio of the glucose to the dimethyldiallylammonium chloride is 1:0.645.

[0013] The second aspect of the present invention provides carbon quantum dots prepared by the preparation method of the carbon quantum dots as described above.

[0014] The third aspect of the present invention provides the application of the carbon quantum dots as described above as a carrier in delivering nucleic acid molecules.

[0015] Further, the nucleic acid molecule is a small molecule RNA; furthermore, it is siRNA.

[0016] Further, the combination of the carbon quantum dots and the nucleic acid molecule includes the following steps: dissolve the carbon quantum dots in nuclease-free water, ultrasonically disperse to obtain a carbon quantum dot solution; add the nucleic acid molecule to the carbon quantum dot solution, mix well and let it stand at room temperature to form a carbon quantum dot-nucleic acid complex.

[0017] Further, the mass ratio of the nucleic acid molecule to the carbon quantum dots is 1:1.

[0018] Furthermore, the concentration of the carbon quantum dot solution is 0.5 - 2 mg / mL.

[0019] The advantages and positive effects of the present invention are as follows:

[0020] 1. The carbon quantum dots prepared by the present invention have good water solubility and dispersibility, carry a positive charge after synthesis, can efficiently bind to RNA molecules to form stable complexes, can effectively resist nuclease degradation when incubated with nucleases at a concentration of 10 - 100 μg / mL for 60 min, realize the protection of RNA molecules, maintain their structural integrity, significantly improve the stability of nucleic acid molecules, and can achieve efficient delivery of nucleic acid molecules. Moreover, they have low cytotoxicity and can desorb in the cellular physiological environment to exert the specific functions of RNA; they have broad application prospects in the fields of nucleic acid delivery and gene therapy.

[0021] 2. The method for preparing carbon quantum dots in the present invention is simple, and a large amount of carbon quantum dots can be obtained in a single time only through steps such as melting and heating the reaction substrate, washing with water, and dialysis. Description of the Drawings

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0023] Figure 1 It is the transmission electron microscope inspection image of the carbon quantum dots prepared in the embodiment of the present invention, and the scale bar in the figure is 20 nm;

[0024] Figure 2 It is the particle size distribution diagram of the carbon quantum dots prepared in the embodiment of the present invention;

[0025] Figure 3 It is the infrared spectrum diagram of the carbon quantum dots prepared in the embodiment of the present invention;

[0026] Figure 4 It is the diagram of the color change of the reaction product solution and the precipitation situation after centrifuging the reaction product solution at 12000 rpm for 10 min under different addition amounts of dimethyldiallylammonium chloride in the embodiment of the present invention;

[0027] Figure 5 It is the yield diagram of the carbon quantum dots under different addition amounts of dimethyldiallylammonium chloride in the embodiment of the present invention;

[0028] Figure 6This is the siRNA electrophoresis map of the embodiments of the present invention incubated with different concentrations of nuclease RNase A for different times. Among them, Figure A is incubated with 10 μg / mL RNase A for 10 min, Figure B is incubated with 10 μg / mL RNase A for 60 min, Figure C is incubated with 100 μg / mL RNase A for 10 min, and Figure D is incubated with 100 μg / mL RNase A for 60 min;

[0029] Figure 7 This is the relative expression level map of the green fluorescent protein gene after the embodiments of the present invention target and deliver siRNA into cells through carbon quantum dots. Detailed implementation manners

[0030] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further details the present invention with reference to embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0031] Based on the information included in the present invention, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only used to illustrate specific aspects of the present invention schematically. In fact, various changes that those skilled in the art or related fields can obviously make to the embodiments of the present invention are all covered within the scope of the appended claims.

[0032] In order to better understand the present invention rather than limit its scope, all numbers representing amounts, percentages and other numerical values used in the present invention should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to different desired properties. Each numerical parameter should be regarded as at least obtained according to the reported significant figures and by the conventional rounding method.

[0033] In addition, it should be noted that unless otherwise defined, the scientific and technical terms used in the context of the present invention should have the meanings commonly understood by those of ordinary skill in the art. The meanings of terms such as "comprising", "including", "containing", "having" and the like are non-restrictive, that is, other steps and other components can be added without affecting the results.

[0034] To make the above objectives, features and advantages of the present invention more obvious and understandable, the following provides a detailed description of the present invention.

[0035] As a new type of zero-dimensional nanomaterial, carbon quantum dots have the characteristics of high water solubility, excellent biocompatibility, and easy functionalization, and are applied in the fields of bioimaging, energy storage, photocatalysis, biochemistry, etc. Preparing carbon quantum dots with low-cost and renewable biomass resources as precursors helps to reduce costs and increase efficiency. Carbohydrates are a rich, readily available, and low-cost biomass carbon source. The C=C formed by the dehydration of its molecules is the basic structural unit of graphene. Preparing carbon quantum dots with it as a precursor has great economic advantages. However, the existing carbon quantum dots are usually negatively charged after synthesis and cannot directly and effectively load nucleic acid molecules, which restricts their application in the field of nucleic acid delivery. They need to be modified with PEI, amino groups, etc. to bind to nucleic acid molecules such as siRNA. However, the modification process of carbon quantum dots is complex, difficult to prepare and produce, and is likely to have an adverse impact on the structure and cytotoxicity of quantum dots.

[0036] Based on this, the present invention provides a new type of carbon quantum dot that specifically solves the above-mentioned drawbacks. Its preparation method includes the following steps:

[0037] S1. Heat the carbohydrate compound to 120-155 °C to melt the carbohydrate compound, and then add an aqueous solution of dimethyldiallylammonium chloride. Keep it at 150-180 °C for 30-240 min. The mass ratio of the carbohydrate compound to the dimethyldiallylammonium chloride is 1:0.129-1.291;

[0038] S2. Cool the reaction product of step S1 to room temperature, add deionized water to dissolve the reaction product, and then centrifuge to collect the supernatant. The supernatant is filtered, dialyzed, and freeze-dried to obtain the carbon quantum dots.

[0039] The present invention uses a saccharide compound as a carbon source precursor, heats it to melt into a homogeneous phase, and then adds dimethyldiallylammonium chloride. It is kept warm at the melting temperature for a period of time. Dimethyldiallylammonium chloride is a strong cationic polyelectrolyte, and each molecule carries a positive charge. It has excellent solubility and the solution is weakly acidic (pH is about 4 - 7). The weak acidity can play an acidic catalytic role to accelerate the carbonization of the saccharide compound, and at the same time, a relatively high density of positive charges can be modified on the surface of the carbon quantum dots. After the insulation is completed, the product is dispersed in deionized water, the precipitate and the supernatant are separated, and the supernatant is filtered and dialyzed to obtain positively charged carbon quantum dots. The carbon quantum dots have good dispersibility and can quickly form a complex with negatively charged small molecule RNA through electrostatic adsorption, playing a role in protecting the RNA molecule, effectively avoiding the rapid degradation of the RNA molecule in a high-concentration nuclease environment, improving its stability and effectiveness in a complex environment, and greatly extending the half-life. Moreover, after the carbon quantum dots of the present invention are loaded with RNA molecules, they can be efficiently delivered into cells without affecting the biological activity of the RNA. Taking siRNA as an example, after the siRNA is delivered by the carbon quantum dots of the present invention, it can be effectively desorbed and exert RNA interference activity in the biological environment. In short, the carbon quantum dots prepared by the present invention have good water solubility and dispersibility, carry positive charges after synthesis, and can efficiently bind RNA molecules and form stable complexes without the need for additional chemical modification, realizing the protection of RNA molecules, maintaining their structural integrity, and can efficiently deliver RNA molecules, and have low cytotoxicity, have little impact on the normal physiological characteristics of cells, and can be efficiently desorbed in the cell physiological environment to exert the specific function of RNA; it has broad application prospects in the fields of nucleic acid delivery and gene therapy. In addition, the method for preparing carbon quantum dots in the present invention is simple, and a large amount of carbon quantum dots can be obtained at one time.

[0040] Optionally, the saccharide substances described above include but are not limited to glucose, xylose, arabinose, fructose, and mannose. The heating and melting temperature is adaptively selected according to the type of the saccharide compound, as long as the saccharide compound reaches the molten state. For example, the melting point of glucose is about 146°C, the melting point of xylose is about 153°C, the melting point of arabinose is about 155°C, the melting point of fructose is about 110°C, and the melting point of mannose is about 133°C. The heating and melting temperature is in the range of 120°C - 155°C. Preferably, the melting temperature in step S1 is close to or equal to the melting point temperature of each saccharide compound.

[0041] The present invention first melts the saccharide compound into a homogeneous phase, which is beneficial to improving the consistency of the reaction and enables it to undergo reactions such as decomposition, condensation, and carbonization more uniformly. With the catalytic action of dimethyldiallylammonium chloride, carbon quantum dots can be prepared at 150-180 °C in an open system under atmospheric pressure, thereby increasing the yield of quantum dots. When the melting temperature is relatively low, the time for the saccharide compound to melt into a homogeneous phase is relatively long. Increasing the temperature can significantly shorten the melting time. However, when the temperature is much higher than the melting temperature, under continuous magnetic stirring, the saccharide compound closest to the heating medium first melts rapidly, and then mixes with the unmolten saccharide compound far from the heating medium to form large lumps. This leads to slow heat transfer inside and may locally form carbon blocks. Therefore, increasing the temperature does not significantly shorten the complete melting time. In addition, when the temperature is too high, under the catalysis of dimethyldiallylammonium chloride, the rate of saccharide condensation and carbonization is too fast, and the reaction products are easily polymerized into large solid insoluble substances, affecting the acquisition of carbon quantum dots.

[0042] Generally, the prices of xylose, arabinose, fructose, and mannose are much higher than that of glucose. Considering the ease of obtaining raw materials and economy, the present invention preferably uses glucose as the carbon source for preparing carbon quantum dots, and preferably heats and melts glucose at 150 °C for 30 min.

[0043] In a preferred embodiment, in step S1, the mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.645. The addition amount of dimethyldiallylammonium chloride is controlled according to the concentration and addition volume of the dimethyldiallylammonium chloride aqueous solution. Generally, the mass concentration (wt) of the dimethyldiallylammonium chloride aqueous solution is 60-65%. For example, a dimethyldiallylammonium chloride aqueous solution with a mass percentage of 62.05 (wt)% is prepared. At this time, 1 g of the saccharide compound corresponds to the addition of 1 mL of 62.05 (wt) dimethyldiallylammonium chloride aqueous solution.

[0044] In the present invention, dimethyldiallyl ammonium chloride is used to catalyze the synthesis of carbon quantum dots on the one hand, and to modify the surface of carbon quantum dots with positive charges on the other hand. The present invention explores the generation and performance of carbon quantum dots in the range of 1:0.129-1.291 of the mass ratio of sugar to dimethyldiallyl ammonium chloride and finds that when the amount of the catalyst dimethyldiallyl ammonium chloride is low (for example, no catalyst is added or the amount of the catalyst is less than 1:0.129), when the reaction is carried out under normal pressure, even if the reaction time is extended to more than 240 minutes, it is difficult for the sugar compound to be carbonized to form carbon quantum dots, which will lead to a low reaction rate for the preparation of carbon quantum dots, and the synthesized carbon quantum dots have less positive charges on the surface, which may reduce the binding stability with negatively charged nucleic acid molecules; but when the amount of dimethyldiallyl ammonium chloride is increased, the reaction rate will be too fast, and it is easy to polymerize to form large solid particles that are insoluble in water, resulting in a decrease in the yield of carbon quantum dots. In addition, the zeta potential of the obtained carbon quantum dots is too high, making it difficult for the nucleic acids bound to them to dissociate, affecting the biological activity of RNA molecules. Therefore, considering the carbon quantum dot generation efficiency and chargeability, the preferred mass ratio of the sugar compound to dimethyldiallylammonium chloride in the present invention is 1:0.645.

[0045] It should be noted that the aqueous solution of dimethyldiallylammonium chloride needs to be slowly added to the molten glucose to avoid violent boiling and spraying of the mixed solution in an open atmospheric pressure reaction system.

[0046] Preferably, in step S1, the mixed reaction system of the saccharide compound and the dimethyldiallylammonium chloride aqueous solution is kept at 150° C. for 180 min.

[0047] More preferably, the present invention comprises: heating glucose to melt at 150°C for 30 min, then adding dimethyldiallyl ammonium chloride aqueous solution, and keeping at 150°C for 180 min, wherein the mass ratio of the glucose to the dimethyldiallyl ammonium chloride is 1:0.645. The glucose-based carbon quantum dots (NGCDs) prepared in this way have a higher carbon quantum dot yield and better ability to protect RNA molecules from nuclease degradation, and can achieve long-term protection of siRNA in a high-concentration nuclease environment.

[0048] Optionally, in step S2, the dissolved reaction product is centrifuged at 12000 rpm for 10 min, the supernatant is collected, and filtered with a 0.22 μm water filter membrane. The filtrate is dialyzed and purified for 48 hours using a dialysis bag with a molecular retention capacity of 1000 Da. During this period, the dialysate is replaced every 4 hours. The dialysate can be selected from deionized water. After the dialysis is completed, the retentate in the dialysis bag is collected and freeze-dried to obtain the carbon quantum dots.

[0049] Another embodiment of the present invention provides carbon quantum dots prepared by the method for preparing carbon quantum dots as described above.

[0050] The carbon quantum dots prepared based on the above method have good water solubility and dispersibility, and can achieve long-term protection of siRNA in a high-concentration nuclease environment. When incubated with 10-100 μg / mL nuclease for 60 minutes, they can effectively resist nuclease degradation, maintain the integrity of the nucleic acid structure, improve the stability and effectiveness of nucleic acid molecules, greatly extend the half-life, and have excellent nucleic acid delivery capabilities.

[0051] Another embodiment of the present invention provides the use of the carbon quantum dots as described above as carriers in delivering nucleic acid molecules, especially in delivering small molecule RNA, where the small molecule RNA can be siRNA, and the siRNA can be in double-stranded or single-stranded form.

[0052] The use of the carbon quantum dots as carriers in delivering nucleic acid molecules has the same advantages as those of the carbon quantum dots over the prior art as described above, and will not be repeated here.

[0053] Specifically, the carbon quantum dots are combined with the nucleic acid molecules, including the following steps: dissolving the carbon quantum dots in nuclease-free water, ultrasonically dispersing, and obtaining a carbon quantum dot solution; adding the nucleic acid molecule to the carbon quantum dot solution, mixing well, and standing at room temperature to form a carbon quantum dot-nucleic acid complex.

[0054] Optionally, the mass ratio of the nucleic acid molecules to the carbon quantum dots is 1:1.

[0055] Optionally, the concentration of the carbon quantum dot solution is 0.5-2 mg / mL. The carbon quantum dots are dissolved in nuclease-free water and ultrasonically dispersed at room temperature for 10-30 min to form a uniform carbon quantum dot solution.

[0056] Optionally, the standing time at room temperature generally needs to be greater than 30 min to ensure sufficient binding of the nucleic acid molecules to the carbon quantum dots.

[0057] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples without specifying specific conditions are generally carried out according to the conditions recommended by the manufacturer.

[0058] In the following examples, the carbon source used to prepare carbon quantum dots was selected from glucose, and the aqueous solution of dimethyldiallylammonium chloride was purchased from Aladdin.

[0059] The small interfering RNA (siRNA) used to verify carbon quantum dots as a nucleic acid molecule delivery vector has a length of 21 base pairs. It is obtained by in vitro transcription to form a double-stranded structure. During in vitro transcription, the sense strand template of the siRNA molecule transcribes a sense RNA single-stranded molecule, and the antisense strand template transcribes an antisense RNA single-stranded molecule. The sense and antisense RNA transcripts are mixed and annealed to form a double-stranded siRNA molecule. The relevant sequence information is as follows:

[0060] Sense strand template (5’-3’):

[0061] TAATACGACTCACTATAGGGGGTGATGCAACATACGGAATT (see SEQ ID NO.1);

[0062] AATTCCGTATGTTGCATCACCCCCTATAGTGAGTCGTATTA (see SEQ ID NO.2);

[0063] Antisense strand template (5’-3’):

[0064] TAATACGACTCACTATAGGGTTCCGTATGTTGCATCACCTT (see SEQ ID NO.3);

[0065] AAGGTGATGCAACATACGGAACCCTATAGTGAGTCGTATTA (see SEQ ID NO.4);

[0066] The siRNA sequence is:

[0067] Sense strand: GGUGAUGCAACAUACGGAAUU (see SEQ ID NO.5);

[0068] Antisense strand: UUCCGUAUGUUGCAUCACCUU (see SEQ ID NO.6).

[0069] Example 1 Glucosylated carbon quantum dots and their preparation

[0070] A method for preparing glucosylated carbon quantum dots, comprising the following steps:

[0071] S1. Weigh 5 g of glucose and place it in a flask. Heat it to melt at 150 °C for 30 min, and then add 5 mL of an aqueous solution of dimethyldiallylammonium chloride (obtained commercially, with a batch quality percentage of 62.05% (wt)). React at 150 °C for 180 min. The mass ratio of glucose to dimethyldiallylammonium chloride is 1:0.645;

[0072] S2. Cool the reaction product of step S1 to room temperature, add 50 mL of deionized water to dissolve the reaction product, centrifuge at 12000 rpm for 10 min, collect the supernatant, then filter the supernatant with a 0.22 μm aqueous filter membrane, and purify the filtrate by dialysis with a dialysis bag with a molecular cut-off of 1000 Da for 48 h. During this period, change the deionized water every 4 h. Take out the retained matter in the dialysis bag, freeze-dry it to obtain glucosyl carbon quantum dots (NGCDs).

[0073] Dissolve the freeze-dried NGCDs in deionized water to prepare an NGCDs solution with a concentration of 0.5 mg / mL, and ultrasonically disperse it for 10 min. When preparing the sample, drop the NGCDs solution on a copper grid, let it dry naturally, and then put the copper grid with NGCDs attached into a transmission electron microscope (TEM) to observe the morphology of the glucosyl carbon quantum dots (NGCDs) prepared in the above example. The microscopy results are as Figure 1 (The scale bar is 20 nm) shown. According to the microscopy results, use Image J software to count the particle size. Count no less than 100 NGCDs, and use the true scale of the TEM as the reference length for calculating the particle size to obtain the particle size distribution of NGCDs, and finally obtain the percentage of NGCDs with different particle sizes, as Figure 2 shown. The abscissa is the percentage of particles with different particle sizes (%), and the ordinate is the particle size (nm). It can be seen that the NGCDs of the present invention have a small particle size, are distributed in the range of 3 - 5 nm, and are evenly dispersed in the solution.

[0074] In addition, measure the infrared spectrum of the freeze-dried powder of NGCDs, and the results are shown in Figure 2 . The infrared spectrum shows that a carbon-carbon double bond structure (1641 cm -1 represents C = C) that does not exist in the glucose precursor is formed in the glucosyl carbon quantum dots, which may be the structure retained from the carbonization and condensation of glucose and dimethyldiallylammonium chloride, or both, and a quaternary ammonium group (1473 cm -1 ) is formed, which is the reason for its positive charge.

[0075] Further, by adjusting the amount of dimethyldiallylammonium chloride used, explore the influence of the change in the mass ratio of dimethyldiallylammonium chloride to glucose on the synthesis of carbon quantum dots. Add 1, 5, or 10 mL of dimethyldiallylammonium chloride aqueous solution (60% wt) to the reaction system, and adjust the mass ratio of dimethyldiallylammonium chloride to glucose to 1:0.129, 1:0.645, 1:1.291 respectively. React at 150 °C for 180 min, and observe the changes in the reaction products.

[0076] Figure 4The color change of the reaction product solution at different addition amounts of dimethyldiallylammonium chloride (upper figure) and the precipitation situation of the reaction product solution after centrifugation at 12,000 rpm for 10 min (lower figure) are shown. From left to right, they are 1, 5, and 10 mL in sequence. Figure 5 The yields of glucosyl carbon quantum dots (NGCDs) at different addition amounts of dimethyldiallylammonium chloride are shown. The yield is the mass of NGCDs obtained based on 5 g of glucose substrate. The specific operation is as follows: The NGCDs solution after dialysis purification through a 1000 Da dialysis bag for 48 h is freeze-dried, and then the mass is weighed. Each group of preparation experiments is repeated no less than 5 times, and the average mass of NGCDs obtained in 6 times is statistically analyzed. It can be seen from the figure that the degree of carbonization of the 1 mL glucose group is relatively low, and fewer carbon dots are generated. While in the 10 mL group, the carbonization reaction is intense, and it is easy to polymerize to form large solid particles insoluble in water, which are centrifuged down, resulting in a significant reduction in the yield of carbon quantum dots.

[0077] Example 2 Application analysis of the anti-nuclease degradation of glucosyl carbon quantum dots loaded with siRNA

[0078] Dissolve NGCDs in nuclease-free water and ultrasonicate in a water bath at room temperature for 10 min to obtain a light yellow carbon quantum dot solution; add siRNA to the carbon quantum dot solution at a mass ratio of siRNA to NGCDs of 1:1, pipette 10 times, and let it stand at room temperature for 30 min to form an NGCDs-siRNA complex. Add 10 - 100 μg / mL of nuclease RNase A to the above NGCDs-siRNA complex, incubate for 10 - 60 min, and then add proteinase K to terminate the degradation reaction of RNase A. The terminated product is reacted at 95 °C for 1 h under the conditions of 2% SDS and 1.5 M NaCl to desorb the siRNA on NGCDs, and then agarose gel electrophoresis is carried out to detect the molecular size of siRNA and clarify the protective effect of NGCDs on siRNA.

[0079] Figure 6The electrophoresis diagrams of siRNA incubated with different concentrations of nuclease RNase A for different times are shown. Among them, Figure A is for incubation with 10 μg / mL RNase A for 10 min, Figure B is for incubation with 10 μg / mL RNase A for 60 min, Figure C is for incubation with 100 μg / mL RNase A for 10 min, and Figure D is for incubation with 100 μg / mL RNase A for 60 min. In the figures, lane "Marker" represents the molecular marker, lane "naked siRNA" represents the siRNA without RNase A incubation, serving as the control group, lane "siRNA+RNase A" represents the siRNA incubated with RNase A, and lane "siRNA on NGCDs+RNase A" represents the siRNA loaded on NGCDs incubated with RNase A. It can be seen from the figures that after 10 - 60 min of treatment with low and high concentrations of RNase A, the electrophoresis bands of siRNA protected by NGCDs remain intact, while the naked siRNA without NGCDs protection is completely degraded after 10 min of treatment with low concentration of RNase A. The results show that NGCDs can effectively protect the loaded siRNA from external damage and degradation by nucleases, and can achieve long-term protection of siRNA in a high-concentration nuclease environment. It should be noted that the weakening of the brightness of some lanes of NGCDs loaded with siRNA may be due to the influence of the high-salt environment of the 2% SDS and 1.5 M NaCl desorption treatment and incomplete desorption of siRNA.

[0080] Example 3 Application analysis of glucosyl carbon quantum dots as carriers for delivering siRNA

[0081] The siRNA used was obtained by in vitro transcription as described above, and the target of siRNA was the leaves of GFP transgenic Nicotiana benthamiana. The siRNA solution was dropped into NGCDs with a mass ratio of 1:1, and the siRNA concentration was 100 nM. After standing at room temperature for 30 min, the NGCDs-siRNA complex was formed. 100 μL of the above-mentioned NGCDs-siRNA complex was gently injected into the leaves of GFP transgenic Nicotiana benthamiana cultured in the greenhouse for 28 - 32 days (culture temperature 22 - 26°C, light for 16 hours, darkness for 8 hours) using a 1 mL needleless syringe. The concentration of free siRNA was also 100 nM, and the injection volume was 100 μL. The injection method was the same as described above. After injection, the Nicotiana benthamiana was returned to the greenhouse and cultured for another 24 hours.

[0082] The mechanism of action of siRNA lies in its induction of the degradation of target gene mRNA. Therefore, the mRNA level of the GFP gene in Nicotiana benthamiana is a direct proof of the action of siRNA. By detecting the expression level of GFP gene mRNA, the silencing effect of siRNA can be reflected. Specifically: The total RNA of Nicotiana benthamiana leaves was extracted using the GREENspin Ultra-fast Plant RNA Extraction Kit (purchased from Zhuangmeng Biotech, product number ZP432). The RNA was reverse transcribed into cDNA using the highly efficient second-generation full-length cDNA first-strand synthesis kit (genome-free) (purchased from Novizan, product number R212). Using the cDNA as a template, quantitative PCR was performed using the Universal High-Sensitivity Dye Method Quantitative PCR Detection Kit (purchased from Novizan, product number Q711), with the Actin gene as an internal reference.

[0083] The specific primer pairs for detecting the target gene GFP and the internal reference gene Actin are as follows. F represents the upstream primer and R represents the downstream primer:

[0084] GFP-F: AGTGGAGAGGGTGAAGGTGATG (see SEQ ID NO.7);

[0085] GFP-R: GCATTGAACACCATAAGAGAAAGTAGTG (see SEQ ID NO.8);

[0086] Actin-F: GCCGAGCGGGAAATTGTTAG (see SEQ ID NO.9);

[0087] Actin-R: GGCAGCTCGTAGCTCTTCTC (see SEQ ID NO.10).

[0088] The 2 -ΔΔCt method was used to calculate the relative expression level of the target gene GFP, and the normalized GFP gene expression fold change relative to the Actin internal reference gene and the control sample was obtained. Figure 7 The effect diagram of the expression level of the green fluorescent protein (GFP) gene after NGCDs targeted delivery of siRNA into Nicotiana benthamiana leaf cells is shown. It can be seen from the figure that free siRNA (Free siRNA) cannot effectively exert its RNA interference (RNAi) effect in the plant system, and its GFP gene expression level is the same as that of the non-treated group (Non-treated). However, through the NGCDs of the present invention, which act as both a vector and a protector, the delivery of siRNA can protect siRNA from degradation in the complex plant system, enable siRNA to efficiently enter cells, and effectively exert the RNAi effect of siRNA in intact plant cells, thereby leading to gene silencing, specifically manifested as a significant decrease in the expression level of the GFP gene.

[0089] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for preparing carbon quantum dots, characterized in that: The following steps are involved: S1. Heat the sugar compound to 120-155° C. to melt the sugar compound, then add a dimethyldiallyl ammonium chloride aqueous solution, and keep the temperature at 150-180° C. for 30-240 min, wherein the mass ratio of the sugar compound to the dimethyldiallyl ammonium chloride is 1:0.129-1.291; S2. Cool the reaction product of step S1 to room temperature, add deionized water to dissolve the reaction product, then collect the supernatant by centrifugation, and obtain the carbon quantum dots by filtering, dialyzing and freeze-drying the supernatant.

2. The method for preparing carbon quantum dots according to claim 1, characterized in that: In step S1, the mass ratio of the saccharide compound to the dimethyldiallylammonium chloride is 1:0.

645.

3. The method for preparing carbon quantum dots according to claim 1, characterized in that: In step S1, the mixed reaction system of the saccharide compound and the dimethyldiallylammonium chloride aqueous solution is kept at 150° C. for 180 min.

4. The method for preparing carbon quantum dots according to claim 1, characterized in that: The sugar compound is selected from at least one of glucose, xylose, arabinose, fructose and mannose.

5. The method for preparing carbon quantum dots according to claim 4, characterized in that: The sugar compound is selected from glucose, and the glucose is heated to melt at 150° C. for 30 min.

6. The method for preparing carbon quantum dots according to claim 1, characterized in that: Glucose was heated to melt at 150°C for 30 min, and then a dimethyldiallylammonium chloride aqueous solution was added and kept at 150°C for 180 min. The mass ratio of the glucose to the dimethyldiallylammonium chloride was 1:0.

645.

7. A carbon quantum dot, characterized in that The carbon quantum dots are prepared by the method for preparing the carbon quantum dots according to any one of claims 1 to 6.

8. Use of the carbon quantum dots as claimed in claim 7 as carriers in delivering nucleic acid molecules.

9. The use of carbon quantum dots as carriers in delivering nucleic acid molecules according to claim 8, characterized in that: The nucleic acid molecule is siRNA.

10. The use of carbon quantum dots as a carrier in delivering nucleic acid molecules according to claim 8, characterized in that: The carbon quantum dots bind to the nucleic acid molecules and include the following steps: Dissolving the carbon quantum dots in nuclease-free water and performing ultrasonic dispersion to obtain a carbon quantum dot solution; adding the nucleic acid molecules to the carbon quantum dot solution, mixing well and standing at room temperature to form a carbon quantum dot-nucleic acid complex; The mass ratio of the nucleic acid molecules to the carbon quantum dots is 1:1, and the concentration of the carbon quantum dot solution is 0.5-2 mg / mL.

Images