Preparation method and application of swertiamarin

Abstract

The invention discloses a preparation method and application of swertiamarin. The enrichment and purification preparation method of the swertiamarin, which is high in purity and suitable for mass production, is developed, and the method for preparing the swertiamarin has the advantages of high product purity, short purification steps, easiness in large-scale production, less time consumption and the like. It is found for the first time that the swertiamarin has remarkable inhibitory activity on a TRPV1 ion channel, can be used as a TRPV1 ion channel inhibitor, has anti-inflammatory activity and has an important application prospect in development of drugs for treating chronic pain, inflammation, hyperlipidemia and the like. The swertiamarin is used as an active ingredient for preparing cosmetics with anti-inflammatory, analgesic and soothing effects, and also has important application value in cosmetic development.

Description

Technical Field

[0001] The present invention belongs to the technical fields of pharmaceuticals and cosmetics, and particularly relates to a preparation method and application of swertiamarin. Background Art

[0002] Chronic pain is a major problem that urgently needs to be solved clinically at present. However, there are very few analgesic drugs that only target the peripheral and / or spinal cord levels and have good effects. Transient receptor potential vanilloid 1 (TRPV1) is a ligand-gated ion channel mainly distributed in the sensory neurons of the peripheral nervous system. It can be activated by physical and chemical stimuli such as high temperature (>43 °C), low pH (<5.9), as well as endogenous lipid molecules and exogenous ligands, and is involved in various physiological and pathological processes such as pain perception, temperature regulation, and inflammatory response. It has been confirmed as a therapeutic target for various preclinical models of chronic pain. TRPV1 belongs to the TRPV subfamily of the transient receptor potential (TRP) family. Activation of TRPV1 in the nervous system leads to cation influx, which in turn depolarizes thermosensory and nociceptive afferent neurons and generates action potentials. Capsaicin, the active ingredient in chili peppers, can activate TRPV1, so TRPV1 is also called the capsaicin receptor. TRPV1 is mainly distributed in the sensory neurons of the peripheral nervous system. In addition, it is also expressed in non-neuronal tissues and cells such as the central nervous system, cardiovascular system, liver, skin epidermis, gastrointestinal epithelial cells, bladder urothelial cells, and smooth muscle cells. It is involved in many physiological processes such as body temperature regulation, circadian rhythm, energy intake, and lipid metabolism. Activation of TRPV1 located in the endoplasmic reticulum leads to endoplasmic reticulum stress and activation of the pro-apoptotic pathway. At the same time, activation of TRPV1 in mitochondria is involved in the uptake of mitochondrial Ca 2 +, leading to mitochondrial depolarization and contributing to cell migration. The presence of TRPV1 in the Golgi apparatus indicates that it is also involved in protein transport in the secretory pathway. Therefore, TRPV1 has been widely studied as a potential target for the treatment of pain, inflammation, and hyperlipidemia.

[0003] Swertiamarin is the main and characteristic component of plants in the genus Swertia, with a wide range of sources. The main source plants include Swertia bimaculata, Swertia mileensis, Swertia mussotii, Swertia davidii, and Swertia punicea, etc. Swertia bimaculata is an annual herbaceous plant of the Gentianaceae family and the Swertia genus. Its whole herb is used as medicine and contains chemical components such as swertiamarin, isovitexin, vitexin, isoorientin, erythrocentaurin, and oleanolic acid, mainly chemical components of types such as iridoids, xanthones, triterpenes, and alkaloids. The extract of Swertia has the effects of clearing heat and detoxifying, promoting diuresis, and soothing the liver and gallbladder, and is commonly used to treat heatstroke, diarrhea, and diseases caused by damp-heat such as acute and chronic hepatitis, cholecystitis, common cold fever, sore throat, gingival swelling and pain, urinary tract infection, gastroenteritis, dysentery, conjunctivitis, and infantile malnutrition. Modern pharmacological studies have shown that the extract of Swertia has effects such as strengthening the heart, lowering blood sugar, promoting blood circulation, inhibiting testicular steroid 5α-reductase, anti-inflammatory, and analgesic effects. Existing patents mainly focus on the anti-wrinkle effects of Swertia extracts and their compounds (preparations for treating fine lines and wrinkles and their uses, CN118765193A; an anti-aging and anti-wrinkle composition and its application, CN109602668A), anti-inflammatory effects (a Tibetan medicine composition for treating icterohepatitis and its preparation method, CN113599441A; an active substance and its preparation and anti-inflammatory application, CN112870246A; a Mongolian medicine composition for treating chronic cholecystitis and biliary colic and its method, CN1954859A), and the purification method of swertiamarin (a method for extracting effective components from Swertia mussotii plants, CN102503996A). The purity of swertiamarin (2.32%) is not high; moreover, there is no patent on the purification method of high-purity swertiamarin and no report on the inhibitory activity of swertiamarin on TRPV1. Summary of the Invention

[0004] Aiming at the problems of the existing technology, mainly the purification method of swertiamarin has disadvantages such as low purity, complex steps, time-consuming and laborious, etc. The present invention has developed a method for enriching, purifying and preparing high-purity swertiamarin. First, ultrasonic-assisted extraction technology is used to extract a crude extract from Swertia or Swertia mileensis. The crude extract is separated and purified by normal-phase / reverse-phase column chromatography technology to obtain high-purity swertiamarin, and it is first discovered that swertiamarin has significant inhibitory activity and anti-inflammatory activity on the TRPV1 ion channel.

[0005] The first object of the present invention is to provide a preparation method of swertiamarin, including the following steps:

[0006] S1. Take dry plant materials containing swertiamarin, crush them to obtain a powder of the material to be extracted;

[0007] S2. Add the powder of the material to be extracted into an aqueous ethanol solution with a volume fraction of 30%, extract it thoroughly in an ultrasonic extraction tank, filter, recover the extract, concentrate it to obtain a crude extract;

[0008] S3. Mix the crude extract with macroporous resin, evaporate to remove the solvent and then load it into a column, elute with an aqueous ethanol solution with a volume fraction of 20%, collect the eluate and concentrate it to remove the solvent to obtain Sample 1-1;

[0009] S4. Dissolve Sample 1-1 in an aqueous ethanol solution with a volume fraction of 95%, mix it with silica gel of 100-200 mesh, load it into a column, elute with a solvent with a volume ratio of dichloromethane:ethanol of 25:1 to remove impurities, and then change to a solvent with a volume ratio of dichloromethane:methanol of 15:1 for elution, collect the eluate and concentrate it to remove the solvent to obtain Sample 1-2;

[0010] S5. Dissolve Sample 1-2 in an aqueous ethanol solution with a volume fraction of 95%, mix it with silica gel of 200-300 mesh, load it into a column, elute with a solvent with a volume ratio of ethyl acetate:ethanol of 20:1 to remove impurities, and then change to a solvent with a volume ratio of ethyl acetate:ethanol of 10:1 for elution, collect the eluate and concentrate it to remove the solvent to obtain swertiamarin.

[0011] The second object of the present invention is to provide another preparation method of swertiamarin, comprising the following steps:

[0012] S1. Take the dried plant material containing swertiamarin, crush it to obtain the powder of the material to be extracted;

[0013] S2. Add the powder of the material to be extracted into an aqueous ethanol solution with a volume fraction of 30%, extract it thoroughly in an ultrasonic extraction tank, filter, recover the extract, concentrate it to obtain a crude extract;

[0014] S3. Mix the crude extract with silica gel of 100-200 mesh, load it into a column, elute with a solvent with a volume ratio of dichloromethane:ethanol of 25:1 to remove impurities, and then change to a solvent with a volume ratio of dichloromethane:methanol of 15:1 for elution, collect the eluate and concentrate it to remove the solvent to obtain Sample 2-1;

[0015] S4. Mix Sample 2-1 with macroporous resin, evaporate to remove the solvent and then load it into a column, elute with an aqueous ethanol solution with a volume fraction of 20%, collect the eluate and concentrate it to remove the solvent to obtain Sample 2-2;

[0016] S5. Evaporate and concentrate Sample 2-2 to remove water, mix it with silica gel of 200-300 mesh, load it into a column, elute with a solvent with a volume ratio of ethyl acetate:ethanol of 20:1 to remove impurities, and then change to a solvent with a volume ratio of ethyl acetate:ethanol of 10:1 for elution, collect the eluate and concentrate it to remove the solvent to obtain swertiamarin.

[0017] Preferably, step S2 is as follows: Add 1 part by mass of the powder of the material to be extracted into 8 parts by mass of an ethanol aqueous solution with a volume fraction of 30%, extract at 25°C for 24 h in an ultrasonic extraction tank, filter, and recover the extract; repeat the extraction for the residue once, filter, recover the extract, combine the extracts of the two times, and concentrate to obtain a crude extract.

[0018] The macroporous resin is the macroporous resin of model D101 produced by Emmagen Biopharmaceuticals (China) Co., Ltd., and the silica gels of 100-200 mesh and 200-300 mesh are the silica gels of 100-200 mesh and 200-300 mesh produced by Qingdao Ocean Chemical Co., Ltd.

[0019] Preferably, the plant material containing swertiamarin is a plant material of the genus Swertia containing swertiamarin.

[0020] Preferably, the plants of the genus Swertia are Swertia bimaculata, Swertia mileensis, Swertia mussotii, Swertia davidii, and Swertia purpurea.

[0021] Swertiamarin has a wide source, and swertiamarin is the main and characteristic component of plants of the genus Swertia. Adjusting the plant source to other plants containing swertiamarin can also achieve the preparation of swertiamarin. Among them, the plants containing swertiamarin are Swertia bimaculata, Swertia mileensis, Swertia mussotii, Swertia davidii, Swertia purpurea, etc.

[0022] The third object of the present invention is to provide the application of swertiamarin (or an extract containing swertiamarin) in the preparation of a drug for inhibiting TRPV1 ion channel.

[0023] Preferably, the drug for inhibiting TRPV1 ion channel is a drug that inhibits the mRNA expression of TRPV1.

[0024] The fourth object of the present invention is to provide the application of swertiamarin (or an extract containing swertiamarin) in the preparation of a drug for treating or preventing chronic pain, inflammation, or hyperlipidemia.

[0025] The described drug can be a composition containing swertiamarin and can be in any suitable form, such as solid, semi-solid, liquid or aerosol form. Generally, the drug contains swertiamarin or the swertiamarin-containing extract prepared by the present invention as an active ingredient, and is mixed with an organic or inorganic carrier or excipient suitable for external, enteral or parenteral administration. The active ingredient can be compound, for example, made into tablets, pills, capsules, etc. and other suitable forms of use with conventional non-toxic pharmaceutically acceptable carriers and / or excipients. Pharmaceutically acceptable carriers used in the composition include, for example, water, glucose, lactose, gum arabic, etc. and other carriers suitable for use in the preparation of solid, semi-solid, liquid or aerosol forms of preparations. The composition can additionally contain stabilizers, thickeners and / or colorants and fragrances.

[0026] Swertiamarin and its pharmaceutically acceptable salts and glycosides can be administered orally, transdermally or parenterally, and the dosage varies depending on the drug. For adults, 1100 mg per day is more appropriate. When administered orally, swertiamarin is first mixed with conventional pharmaceutical adjuvants such as excipients, disintegrants, binders, lubricants, antioxidants, coating agents, colorants, fragrances, surfactants, etc., and made into forms such as granules, capsules, tablets, etc. for administration. When administered transdermally, swertiamarin is first mixed with conventional pharmaceutical adjuvants such as excipients, disintegrants, binders, lubricants, antioxidants, coating agents, colorants, fragrances, surfactants, etc., and made into forms such as gels, solutions, tinctures, lotions, emulsions, oils, creams, ointments, plasters, etc. for administration. When administered parenterally, it can be administered in the form of injections, infusions or suppositories, etc. When preparing the above preparations, conventional preparation techniques can be used.

[0027] The fifth object of the present invention is to provide the application of swertiamarin (or swertiamarin-containing extract) in the preparation of cosmetics having anti-inflammatory, analgesic and soothing effects.

[0028] For example, swertiamarin (or swertiamarin-containing extract) can be added to cosmetics at a concentration of 1% by mass fraction to obtain cosmetics having anti-inflammatory, analgesic and soothing effects.

[0029] The sixth object of the present invention is to provide a cosmetic containing swertiamarin (or swertiamarin-containing extract) as an active ingredient having anti-inflammatory, analgesic and soothing effects.

[0030] The present invention has the following advantages:

[0031] The present invention has developed a method for enriching, purifying and preparing swertiamarin with high purity (purity greater than 95.6%) suitable for mass production. Using this method to prepare swertiamarin has the advantages of high product purity, short purification steps, easy scale-up production and less time consumption. The overall process route is simple and suitable for scale-up production. It can extract 20 kg of plant raw materials such as Swertia bimaculata and Swertia mileensis at one time, and obtain about 1.3 kg of swertiamarin, which can be used for the mass preparation of swertiamarin.

[0032] The present invention has first discovered that swertiamarin has significant inhibitory activity on the TRPV1 ion channel and can be used as an inhibitor of the TRPV1 ion channel. Moreover, swertiamarin has anti-inflammatory activity and has important application prospects for the development of drugs for treating chronic pain, inflammation and hyperlipidemia. Using swertiamarin as an active ingredient to prepare cosmetics with anti-inflammatory, analgesic and soothing effects also has important application value in the development of cosmetics. Description of the Drawings

[0033] Figure 1 It is the HPLC chart for detecting the purity of swertiamarin in the product prepared in Example 1.

[0034] Figure 2 It is the inhibition result of swertiamarin on the release amount of TRPV1 mRNA. Among them, 1% and 5% of swertiamarin respectively represent the sample groups of 1% and 5% of the product mother liquor concentration.

[0035] Figure 3 It is the inhibition rate result of swertiamarin on the release amount of TRPV1 mRNA. Among them, 1% and 5% of swertiamarin respectively represent the sample groups of 1% and 5% of the product mother liquor concentration.

[0036] Figure 4 It is the inhibition rate result of swertiamarin on TNF-α. Among them, 0.1%, 1% and 5% of swertiamarin respectively represent the sample groups of 0.1%, 1% and 5% of the product mother liquor concentration, and 0.01% dexamethasone represents the positive control group.

[0037] Figure 5 It is the inhibition rate result of swertiamarin on IL-1β. Among them, 0.1%, 1% and 5% of swertiamarin respectively represent the sample groups of 0.1%, 1% and 5% of the product mother liquor concentration, and 0.01% dexamethasone represents the positive control group. Detailed Embodiments

[0038] The following examples are further illustrations of the present invention rather than limitations thereof.

[0039] The aerial parts of the Swertia bimaculata plants used in the following examples were harvested from Honghe, Yunnan, and the aerial parts of the Swertia mileensis plants were harvested from Nyingchi, Tibet. The macroporous resin was of the D101 type and was purchased from Emmi Kogen (China) Bio-Medical Co., Ltd.; the glass chromatography column (diameter 13 cm, height 120 cm) was purchased from Chongqing Xinweier Glass Co., Ltd., the 100-200 mesh silica gel and 200-300 mesh silica gel were purchased from Qingdao Ocean Chemical Industry Co., Ltd., and the ultrasonic extraction tank (TS-NS-50, 50 L) was purchased from Shanghai Shunyi Experimental Equipment Co., Ltd.

[0040] Example 1

[0041] (1) Take 1 kg of the aerial parts of the dried Swertia bimaculata plants, crush them with a pulverizer and pass through a 20-mesh sieve to obtain Swertia bimaculata powder.

[0042] (2) Add 1 kg of Swertia bimaculata powder to 8 kg of an ethanol aqueous solution with a volume fraction of 30%, extract at 25 °C for 24 h in an ultrasonic extraction tank, filter, and recover the extract; repeat the extraction once for the filter residue (i.e., add the filter residue to 8 kg of an ethanol aqueous solution with a volume fraction of 30%, extract at 25 °C for 24 h in an ultrasonic extraction tank), filter, recover the extract, combine the extracts from the two extractions, and concentrate to 150 g to obtain a crude extract.

[0043] (3) Mix the crude extract with 400 g of macroporous resin (type D101), remove the solvent by rotary evaporation and drying, then load the sample onto a column pre-packed with macroporous resin (the packing is 2.8 kg of D101 macroporous resin), and press it with absorbent cotton on the top. Elute with an ethanol aqueous solution with a volume fraction of 20% for 3 times the column volume, collect the eluate and concentrate to remove the solvent to obtain the target sample 1-1 mainly rich in swertiamarin.

[0044] Purification was carried out using the method of silica gel column chromatography. Dissolve sample 1-1 with an ethanol aqueous solution with a volume fraction of 95%, and then mix it with 150 g of 100-200 mesh silica gel; first pack a column with 900 g of 100-200 mesh silica gel, then add the 100-200 mesh silica gel with the sample loaded to pack the column, and start eluting with a solvent with a volume ratio of dichloromethane:ethanol of 25:1 (2 kg). The substances eluted by this 2 kg of solvent are not wanted; then change to a solvent with a volume ratio of dichloromethane:methanol of 15:1 (8 kg) for elution, collect the eluate and concentrate to remove the solvent to obtain the target sample 1-2 with a purity of 66%.

[0045] Dissolve Sample 1-2 with an ethanol aqueous solution with a volume fraction of 95%, and then mix the sample with 80 g of silica gel with a mesh size of 200-300; first pack a column with 800 g of silica gel with a mesh size of 200-300, and then add the silica gel with a mesh size of 200-300 that has been mixed with the sample to pack the column. Start eluting with a solvent (1 kg) with an ethyl acetate:ethanol volume ratio of 20:1. The substances eluted by this 1 kg of solvent are other substances and should be discarded; then change to a solvent (8 kg) with an ethyl acetate:ethanol volume ratio of 10:1 to elute, collect the eluate, concentrate it to remove the solvent to obtain the target sample 1-3, which is the purified product. Analyzed by HPLC( Figure 1 ), the mass of the product is 65 g, and the purity of swertiamarin is 95.6%. The compound isolated was identified as swertiamarin by comparing NMR data (Table 1).

[0046] Table 1 NMR spectral data of swertiamarin

[0047] Position <![CDATA 13 C NMR]]> <![CDATA 1 H NMR]]> 1 96.7 5.52 3 152.4 7.61 4 104.8 5 27.1 3.14 6 24.6 1.69；1.77 7 68.4 4.45；4.34 8 132.0 5.52 9 42.2 2.70 10 119.7 5.25 11 167.0 1’ 98.4 4.70 2’ 73.1 3.20 3’ 76.6 3.31 4’ 70.0 3.28 5’ 76.3 3.37 6’ 61.2 3.66；3.90

[0048] The chemical structure of swertiamarin is shown in Formula I:

[0049]

[0050] Example 2

[0051] (1) Take 1 kg of the above-ground part of the dried Swertia mileensis T. N. Ho & W. L. Shi plant, crush it with a pulverizer and pass it through a 20-mesh sieve to obtain Swertia mileensis T. N. Ho & W. L. Shi powder.

[0052] (2) Add 1 kg of Swertia mileensis T. N. Ho & W. L. Shi powder to 8 kg of an ethanol aqueous solution with a volume fraction of 30%, extract it at 25 °C for 24 h in an ultrasonic extraction tank, filter, and recover the extract; repeat the extraction once for the filter residue (i.e., add the filter residue to 8 kg of an ethanol aqueous solution with a volume fraction of 30%, extract it at 25 °C for 24 h in an ultrasonic extraction tank), filter, recover the extract, combine the extracts from the two extractions, and concentrate to 150 g to obtain the crude extract.

[0053] (3) Add 400 g of silica gel with a mesh size of 100-200 to mix with the crude extract; first pack a column with 900 g of silica gel with a mesh size of 100-200, and then add the silica gel with a mesh size of 100-200 that has been mixed with the sample to pack the column; start eluting with a solvent (2 kg) with a dichloromethane:ethanol volume ratio of 25:1. The substances eluted by this 2 kg of solvent are other substances and should be discarded; then change to a solvent (8 kg) with a dichloromethane:methanol volume ratio of 15:1 to elute 3 times the column volume, collect the eluate, concentrate it to remove the solvent to obtain the target sample 2-1 rich in swertiamarin.

[0054] The sample 2-1 was mixed with 200 g of macroporous resin (model D101). After rotary evaporation to dryness to remove the solvent, the sample was loaded onto a column pre-packed with macroporous resin (the packing was 2.0 kg of D101 macroporous resin). Elution was carried out with an aqueous ethanol solution with a volume fraction of 20% (15 kg) for 3 column volumes, and the eluate was collected and concentrated to remove the solvent to obtain the target sample 2-2.

[0055] The sample 2-2 was concentrated by rotary evaporation to remove water, and then mixed with 80 g of silica gel with a mesh size of 200-300. First, 800 g of silica gel with a mesh size of 200-300 was packed into a column, and then the silica gel with the sample already mixed was added to pack the column. Elution was started with a solvent with a volume ratio of ethyl acetate:ethanol of 20:1 (1 kg). The substances eluted by this 1 kg of solvent were not wanted. Then, the solvent was changed to a solvent with a volume ratio of ethyl acetate:ethanol of 10:1 (6 kg) for elution. The eluate was collected and concentrated to remove the solvent to obtain the target sample 2-3, which was the purified product. By HPLC analysis, the mass of the product was 52 g, and the purity of swertiamarin was 96.2%.

[0056] Example 3

[0057] 1. TRPV1 activity test

[0058] The effect of the sample on the expression level of TRPV1 was detected using fluorescence quantitative method (qRT-PCR).

[0059] 1.1 Cell seeding

[0060] When the confluence density of HacaT (human skin keratinocytes) cells reached 80%-90%, the cells were digested for 5-7 min and then seeded into a 24-well plate, with 8×10 4 cells counted per well, with a volume of 500 μL, and cultured for 24 hours.

[0061] 1.2 Sample incubation

[0062] An aqueous solution containing 1% penicillin and 1% streptomycin by mass was prepared as the maintenance solution. The blank control group was the maintenance solution; the negative control group was the maintenance solution containing 1 μmol / L of capsaicin; the positive control group was the maintenance solution containing 1 μmol / L of capsaicin and 3 μmol / L of capsinoid; the sample group was the maintenance solution containing 1 μmol / L of capsaicin and samples with different concentrations. The samples with different concentrations were prepared as follows: The product obtained in Example 1 (where the purity of swertiamarin was 95.6%) was used to prepare a product stock solution at a product concentration of 1% by mass, and then the product stock solution was added to the maintenance solution as the sample group to prepare samples with product stock solution concentrations of 5%, 1%, and 0.1% respectively. Each treatment had 3 replicates, and the samples were collected after 24 hours. Before sample collection, the residual medium was washed away with PBS buffer.

[0063] 1.3 RNA Extraction

[0064] The Total RNA Extraction Kit ER501 from TransGen Biotech was used. The concentration was 30 - 100 ng / μL and the volume was 30 μL. The operation was carried out according to the kit instructions.

[0065] 1.4 Reverse Transcription

[0066] The Reverse Transcription Kit AT311 from TransGen Biotech was used. The reverse transcription system was 20 μL. The operation was carried out according to the kit instructions.

[0067] 1.5 qRT-PCR

[0068] The kit was from TransGen Biotech Green qPCR SuperMix (AQ601), and the primers were TRPV1 and GAPDH. The specific primer sequences were: TRPV1-F: GGCTGTCTTCATCATCCTGCTGCT, TRPV1-R: GTTCTTGCTCTCCTGTGCGATCTTGT; GAPDH-F: TCAAGAAGGTGGTGAAGCAGG, GAPDH-R: AGCGTCAAAGGTGGAGGAGTG. The cDNA obtained by reverse transcription was appropriately diluted before use, and the relative expression level of TRPV1 gene was calculated by the 2-ΔΔCT method.

[0069] Table 2 Expression level of TRPV1 gene

[0070]

[0071]

[0072] Results (Table 2, Figure 2 , Figure 3 ) showed that the content of 5% concentration of the product mother liquor (i.e., 0.05% concentration of the product in Example 1) could cause a decrease in the mRNA level of TRPV1, and the inhibition rate reached 34.65%, which was significantly better than that of the positive control capsaicin (the inhibition rate of 3 μmol / L capsaicin was 28.42%); the content of 1% concentration of the product mother liquor (i.e., 0.01% concentration of the product in Example 1) could cause a decrease in the mRNA level of TRPV1, and the inhibition rate reached 21.31%, and the content of 0.1% concentration of the product mother liquor had no significant effect on the mRNA level of TRPV1. It indicated that swertiamarin had significant inhibitory activity on TRPV1 ion channels.

[0073] 2. Anti-inflammatory Activity Test

[0074] The effects of swertiamarin on TNF-α and IL-1β inflammatory factors were detected by ELISA kit.

[0075] Experimental method: Cell seeding: RAW264.7 (mouse monocyte macrophage leukemia cells) were seeded in a 96-well plate at a concentration of 2×10 5 cells / mL (100 μL per well) and cultured for 24 hours. The solution in the wells was discarded and the cells were washed once with PBS buffer. There were 3 parallel wells for each concentration, with 100 μL in each well. Incubate for 24 hours. The DMEM medium used below was DMEM without serum, containing 1% penicillin and 1% streptomycin by mass fraction. The solutions for each group used to incubate the cells were as follows: The blank group was 100 μL of DMEM medium; the negative control group was 100 μL of DMEM medium containing 1 μg / mL of LPS (Lipopolysaccharide); the positive control group was 100 μL of DMEM medium containing 0.01% dexamethasone and 1 μg / mL of LPS; the sample group was DMEM medium containing different concentrations of the sample and 1 μg / mL of LPS. The different concentrations of the sample were prepared as follows: The product obtained in Example 1 (with the purity of swertiamarin being 95.6%) was used to prepare a stock solution of the product at a concentration of 1% by mass fraction, and then the stock solution was added to the DMEM medium as the sample group to prepare samples with stock solution concentrations of 5%, 1%, and 0.1% respectively.

[0076] Calculation method of inflammatory factor inhibition rate: Inhibition rate = (expression level in the sample group - expression level in the LPS-stimulated group) / expression level in the LPS-stimulated group * 100%; where the unit of the inflammatory factor expression level is pg / mL, and the expression level in the LPS-stimulated group (i.e., the negative control group) is the expression level calculated by subtracting the absorbance value of the blank group detected by the microplate reader.

[0077] The inhibitory activities of swertiamarin on TNF-α and IL-1β are shown in Table 3 and Figure 4 and Table 4 and Figure 5 as shown. The experimental concentrations were 5%, 1%, and 0.1% of the stock solution (i.e., 0.05%, 0.01%, and 0.001% concentrations of the product in Example 1). First, the inhibitory activities of 1% and 5% concentrations of the stock solution on TNF-α (inhibition rates of 58.93% and 88.82%) and IL-1β (inhibition rates of 89.81% and 99.18%) were screened, showing relatively good activities. Subsequently, the 0.1% concentration of the stock solution was rescreened, and it showed moderate inhibitory activities on TNF-α (inhibition rate of 42.30%) and IL-1β (inhibition rate of 45.83%). It indicates that swertiamarin has good anti-inflammatory activity.

[0078] Table 3 Inhibitory rate of swertiamarin on TNF-α

[0079]

[0080] Table 4 Inhibitory rate of swertiamarin on IL-1β

[0081]

Claims

1. A method for preparing swertiamarin, characterized in that: The following steps are involved: S1. Take the dried plant material containing swertiamarin and crush it to obtain a powder of the material to be extracted; S2. The powder of the material to be extracted is added to a 30% volume fraction of ethanol aqueous solution, fully extracted in an ultrasonic extraction tank, filtered, the extract is recovered, and concentrated to obtain a crude extract; S3. The crude extract was added to a macroporous resin and mixed with the sample, the solvent was evaporated and then loaded onto a column, eluted with a 20% volume fraction of ethanol aqueous solution, and the eluate was collected and concentrated to remove the solvent to obtain sample 1-1; S4. The sample 1-1 was dissolved in a 95% ethanol aqueous solution and then mixed with 100-200 mesh silica gel, loaded on a column, eluted with a solvent having a volume ratio of 25:1 of dichloromethane: ethanol to remove impurities, and then eluted with a solvent having a volume ratio of 15:1 of dichloromethane: methanol, and the eluate was collected and concentrated to remove the solvent to obtain a sample 1-2; S5. Dissolve sample 1-2 in 95% ethanol aqueous solution, mix with 200-300 mesh silica gel, load on column, elute with ethyl acetate: ethanol in a volume ratio of 20:1 to remove impurities, then switch to ethyl acetate: ethanol in a volume ratio of 10:1 to elute, collect the eluate, concentrate to remove the solvent and obtain swertiamarin.

2. A method for preparing swertiamarin, characterized in that: The following steps are involved: S1. Take the dried plant material containing swertiamarin and crush it to obtain a powder of the material to be extracted; S2. The powder of the material to be extracted is added to a 30% volume fraction of ethanol aqueous solution, fully extracted in an ultrasonic extraction tank, filtered, the extract is recovered, and concentrated to obtain a crude extract; S3. The crude extract was mixed with 100-200 mesh silica gel, loaded on a column, eluted with a solvent of dichloromethane: ethanol in a volume ratio of 25:1 to remove impurities, and then eluted with a solvent of dichloromethane: methanol in a volume ratio of 15:1, and the eluate was collected and concentrated to remove the solvent to obtain sample 2-1; S4. The sample 2-1 was mixed with a macroporous resin, the solvent was evaporated and loaded onto a column, eluted with a 20% volume fraction of ethanol aqueous solution, and the eluate was collected and concentrated to remove the solvent to obtain a sample 2-2; S5. After evaporating and concentrating sample 2-2 to remove water, mix the sample with 200-300 mesh silica gel, load it into a column, use a solvent with a volume ratio of ethyl acetate: ethanol of 20:1 to elute and remove impurities, then change to a solvent with a volume ratio of ethyl acetate: ethanol of 10:1 to elute, collect the eluate, concentrate and remove the solvent to obtain swertiamarin.

3. The method according to claim 1 or 2, characterized in that: The step S2 is as follows: adding 1 mass part of the powder of the material to be extracted to 8 mass parts of 30% ethanol aqueous solution by volume fraction, extracting at 25° C. for 24 hours in an ultrasonic extraction tank, filtering, and recovering the extract; repeatedly extracting the filter residue once, filtering, recovering the extract, combining the two extracts, and concentrating to obtain a crude extract.

4. The method according to claim 1 or 2, characterized in that: The plant material containing swertiamarin is a plant material of the genus Swertia containing swertiamarin.

5. The method according to claim 4, characterized in that The plants of the genus Swertia include Swertia serrata, green leaf gall, western Sichuan Swertia serrata, eastern Sichuan Swertia serrata and purple flower Swertia serrata.

6. Application of swertiamarin in the preparation of TRPV1 ion channel inhibitor drugs.

7. The use according to claim 6, characterized in that: The TRPV1 ion channel inhibitor drug is a drug that inhibits the expression of TRPV1 mRNA.

8. Use of swertiamarin in the preparation of drugs for treating or preventing chronic pain, inflammation or hyperlipidemia.

9. Application of swertiamarin in the preparation of cosmetics with anti-inflammatory, analgesic and soothing effects.

10. A cosmetic, characterized in that: Contains swertiamarin as an active ingredient with anti-inflammatory, analgesic and soothing effects.

Images