CsECT protein related to plant disease resistance, recombinant vector and application of CsECT protein

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a CsECT protein related to plant disease resistance, a recombinant vector and application of the CsECT protein. The invention provides a CsECT protein related to plant disease resistance, the CsECT protein is synthesized by gene CsECT coding, it is speculated that the gene CsECT is used as an m6A reader, metabolism of target mRNA of the gene CsECT is affected, the stability of disease resistance related target genes is improved, expression of disease resistance genes is promoted, and then the disease resistance of plants is improved. The result of the embodiment shows that after the CsECT gene is cloned, the CsECT transgenic citrus is constructed, the CsECT gene is excessively expressed by the transgenic citrus, the canker resistance of the citrus can be remarkably improved, and then the disease resistance of the citrus is improved. Therefore, the CsECT protein synthesized by the gene CsECT disclosed by the invention can be used for improving the disease resistance of plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a CsECT protein related to plant disease resistance, a recombinant vector thereof, and applications thereof. Background Art

[0002] Canker diseases occur in many plants, such as tomatoes, grapes, pitayas, citrus fruits, kiwifruits, melons, poplars, willows, fast-growing Chinese scholar trees, etc. For example, citrus canker disease is relatively severe. Citrus is the world's largest fruit, planted in more than one hundred countries around the world, and is one of the most important commercial fruit trees in the world. It is also the most widely planted and highest-yielding fruit in China. Citrus is susceptible to different diseases, such as huanglongbing, canker disease, anthracnose, sooty mold, etc. Infected citrus plants show spongy pustules on the leaves in the early stage, and later lead to the death of tree branches and the shedding of fruits, and may even cause the destruction of orchards. These diseases cause significant economic losses.

[0003] The CsECT gene is a key gene encoding an m 6 6A RNA methylation reading protein in Citrus sinensis, and its encoded product belongs to the YTH domain protein family. The full length of the CsECT gene sequence is 2133 bp, and the open reading frame encodes a protein containing 711 amino acids, and its N-terminal has a typical YTH domain. Existing studies have shown that plant ECT homologous proteins play important roles in growth and development. For example, Arabidopsis AtECT2 has been confirmed to regulate leaf polarity development in an m 6 6A-dependent manner, and tomato SlECT3 can affect fruit ripening process. Rice OsECT4 has been reported to be involved in drought stress response, but its mechanism of action is limited to abiotic stress responses. Although the functions of ECT family genes in plant growth and development and abiotic stress have been preliminarily explored, there is no report on their regulatory role in disease resistance (especially bacterial canker disease). There is no report in the prior art on the research between the CsECT gene and plant disease resistance. Summary of the Invention

[0004] The purpose of the present invention is to provide a CsECT protein related to plant disease resistance, and this CsECT protein can improve the disease resistance of plants.

[0005] In order to solve the above technical problems, the following technical solutions are proposed:

[0006] The present invention provides a CsECT protein related to plant disease resistance, and the amino acid sequence of the CsECT protein is as shown in SEQ ID NO: 8.

[0007] The present invention provides a nucleic acid molecule encoding the CsECT protein described in the above technical solution, and the CDS sequence of the nucleic acid molecule is shown in SEQ ID NO: 1.

[0008] The present invention provides a recombinant vector, comprising a starting vector and the nucleic acid molecule described in the above technical solution.

[0009] The present invention provides a recombinant bacterium, comprising a primitive strain and the recombinant vector described in the above technical solution.

[0010] The present invention provides the use of the CsECT protein described in the above technical solution, or the nucleic acid molecule of the CsECT protein described in the above technical solution, or the recombinant vector described in the above technical solution, or the recombinant bacterium described in the above technical solution in improving the disease resistance of plants.

[0011] Preferably, the improvement of the disease resistance of plants includes improving the canker resistance of plants.

[0012] Preferably, the improvement method includes overexpressing the CsECT protein.

[0013] Preferably, the application includes the following steps: transferring the nucleic acid molecule encoding the CsECT protein into a plant to induce overexpression of the CsECT protein.

[0014] The present invention provides a method for improving the disease resistance of plants or creating disease-resistant plants, comprising obtaining a plant with improved disease resistance by transferring a recombinant vector into the plant; the recombinant vector is the recombinant vector described in the above technical solution or the recombinant vector constructed by the construction method described in the above technical solution.

[0015] Preferably, the plant includes citrus.

[0016] The beneficial effects of the present invention: The present invention provides a CsECT protein related to the disease resistance of plants. The CsECT protein of the present invention is encoded and synthesized by the nucleic acid molecule CsECT. It is speculated that the CsECT protein, as an m 6 A reader, affects the metabolism of its target mRNA, including improving the stability of disease resistance-related target genes, promoting the expression of disease resistance genes, and thus improving the disease resistance of plants. The results of the examples show that after cloning the CsECT gene, a CsECT transgenic citrus was constructed. The CsECT gene was overexpressed in citrus, which can significantly improve the canker resistance of citrus and thus improve the disease resistance of citrus. It can be seen that the CsECT protein synthesized by the gene CsECT of the present invention can improve the disease resistance of plants. Description of the Drawings

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0018] Figure 1 Fluorescence spectrometer screening diagrams of wild-type non-transgenic citrus and CsECT transgenic citrus of Example 1;

[0019] Figure 2 Disease-resistant phenotype diagrams of CsECT transgenic citrus (OE) and empty vector control group (Control) of Example 2;

[0020] Figure 3 Phenotype diagrams of CsECT transgenic citrus and empty vector control citrus inoculated with Xanthomonas citri subsp. citri by acupuncture method of Example 2;

[0021] Figure 4 Phenotype diagrams of CsECT transgenic citrus and empty vector control citrus inoculated with Xanthomonas citri subsp. citri by injection method of Example 2. Detailed implementation manners

[0022] The present invention provides a CsECT protein, and the amino acid sequence of the CsECT protein is shown as SEQ ID NO:8.

[0023] The CsECT protein sequence of the present invention has a length of 711 amino acids, and the molecular weight of the protein is 77898.19.

[0024] The present invention also provides a nucleic acid molecule encoding the CsECT protein described in the above technical solution, and the CDS sequence of the nucleic acid molecule is shown as SEQ ID NO:1.

[0025] As an optional implementation manner, the cloning method of the nucleic acid molecule includes: the present invention extracts total RNA from the leaves of Citrus reticulata 'Chachi', performs reverse transcription to obtain cDNA, and designs upstream primer CsECT-F and downstream primer CsECT-R, and uses the Citrus reticulata cDNA as a template for PCR amplification to obtain a PCR amplification product. When the PCR amplification is carried out in a volume of 25 μL, it includes: 12.5 μL 2×PrimeSTAR, 1 μL upstream primer, 1 μL downstream primer, 1 μL of template Citrus reticulata (cDNA), 9.5 μL H 2O. The procedures for PCR amplification include: pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, after 32 cycles; post-extension at 72°C for 10 min. After obtaining the PCR amplification product, the present invention ligates the PCR amplification product to a cloning vector, transfers the ligation product into Escherichia coli for culture to obtain an Escherichia coli bacterial solution with resistance, and through sequencing, obtains the CDS sequence of the nucleic acid molecule CsECT encoding the CsECT protein. The length of the CDS sequence of the nucleic acid molecule CsECT is 2133 bp. As an alternative embodiment, the cloning vector includes a T-vector (pEASY-Blunt Cloning Vector). After cloning, the present invention extracts the plasmid from the Escherichia coli bacterial solution with resistance to obtain a recombinant plasmid. The gene CsECT of the present invention is overexpressed in citrus plants, which can improve the disease resistance of citrus to citrus canker.

[0026] The present invention also provides a recombinant vector, comprising a starting vector and the gene CsECT encoding the CsECT protein as described in the above technical solution.

[0027] As an alternative embodiment, the starting vector described in the present invention includes an overexpression vector; as an alternative embodiment, the overexpression vector includes a 35S overexpression vector.

[0028] The present invention also provides a method for constructing the recombinant vector as described in the above technical solution, comprising the following steps:

[0029] Amplify the gene as described in the above technical solution using amplification primers to obtain an amplification product;

[0030] Ligate the amplification product to the starting vector to obtain the recombinant vector.

[0031] The present invention amplifies the gene as described in the above technical solution using amplification primers to obtain an amplification product; the amplification process of the gene CsECT of the present invention has been described above and will not be elaborated here.

[0032] As an alternative embodiment, before ligating the amplification product to the overexpression vector, preferably ligate the amplification product and the cloning vector to obtain a recombinant plasmid. In the present invention, the cloning vector is a T-vector (pEASY-Blunt Cloning Vector). The preparation process of the recombinant plasmid has been described above and will not be elaborated here.

[0033] After obtaining the recombinant plasmid, the present invention uses the recombinant plasmid as a template for PCR amplification to obtain an amplification product. The primers for PCR amplification using the recombinant plasmid as a template in the present invention include the upstream primer 35S-CsECT-F and the downstream primer 35S-CsECT-R; the nucleotide sequence of the upstream primer 35S-CsECT-F in the present invention is preferably as shown in SEQ ID No.4, and the nucleotide sequence of the downstream primer 35S-CsECT-R in the present invention is preferably as shown in SEQ ID No.5.

[0034] The present invention ligates the obtained amplification product with the starting vector to obtain the recombinant vector. As an alternative embodiment, the starting vector includes an overexpression vector. In a specific embodiment of the present invention, the overexpression vector includes a 35S overexpression vector. As an alternative embodiment, the ligation system includes: 1 μL of the gel-extracted fragment of the PCR amplification product, 1 μL of the pAGM243-35s-GFP plasmid, 1 μL of 10 mM ATP, 1 μL of buffer G, 0.5 μL of T4 DNA ligase, 0.5 μL of BpiI, and 5 μL of ddH 2 O. The ligation reaction program includes: 37 °C for 10 min, 16 °C for 10 min, cycling 3 times; 37 °C for 10 min, 65 °C for 20 min.

[0035] As an alternative embodiment, after ligation is completed, a ligation product is obtained. The present invention transfers the ligation product into Escherichia coli. After culturing and sequencing, a positive strain is obtained. The positive strain is extracted using a plasmid extraction kit to obtain the recombinant vector. In a specific embodiment of the present invention, the present invention transfers the ligation product into DH5α Escherichia coli. After culturing and sequencing, a positive pAGM243-35s-CsECT-GFP strain is obtained. After extraction using a plasmid extraction kit, the pAGM243-35s-CsECT-GFP plasmid is obtained.

[0036] The present invention also provides a recombinant bacterium, including a primitive strain and the recombinant vector described in the above technical solution.

[0037] As an alternative embodiment, the primitive strain in the present invention includes Agrobacterium tumefaciens EHA105.

[0038] As an alternative embodiment, the preparation method of the recombinant vector in the present invention has been discussed above and will not be elaborated here.

[0039] The present invention provides the use of the CsECT protein described in the above technical solution, or the nucleic acid molecule of the CsECT protein described in the above technical solution, or the recombinant vector described in the above technical solution, or the recombinant bacterium described in the above technical solution in improving the disease resistance of plants. The use of the present invention preferably includes the following steps: transferring the nucleic acid molecule encoding the CsECT protein into a plant to induce overexpression of the CsECT protein.

[0040] As an alternative embodiment, the recombinant vector contains the fluorescent protein GFP, and the transgenic plant shows green after fluorescence irradiation, which is convenient for the screening of transgenic plants.

[0041] As an alternative embodiment, the plant of the present invention includes citrus. In a specific embodiment of the present invention, the citrus is verified by using Cleopatra mandarin as an example. In the embodiment of the present invention, the transgenic citrus plants are preferably obtained by the following method: transferring the CsECT gene of Citrus reticulata Blanco cv. Chachiensis into citrus plants to obtain CsECT transgenic citrus plants. The method of transforming into citrus plants described in the present invention is the Agrobacterium transformation method. The Agrobacterium transformation method described in the present invention can adopt conventional methods without special limitations.

[0042] As an alternative embodiment, the improvement of the disease resistance of plants described in the present invention includes improving the resistance of plants to citrus canker. The pathogen of the citrus canker described in the present invention includes Xanthomonas citrisubsp. citri (Xcc).

[0043] The Agrobacterium strain described in the present invention is preferably Agrobacterium EHA105. The transgenic CsECT citrus plants described in the present invention are preferably screened and verified by a fluorometer. The CsECT transgenic citrus with GFP fluorescence label shows green fluorescence on the leaves after irradiation by the fluorometer.

[0044] The present invention provides a method for improving the disease resistance of plants, comprising transferring a recombinant vector into a plant to obtain a CsECT transgenic plant; the recombinant vector is the recombinant vector described in the above technical solution or the recombinant vector constructed by the construction method described in the above technical solution.

[0045] As an alternative embodiment, the plant of the present invention includes citrus. As an alternative embodiment, the transformation method includes the Agrobacterium transformation method. The Agrobacterium of the present invention includes Agrobacterium EHA105. The Agrobacterium transformation method of the present invention includes: mixing the recombinant vector with Agrobacterium competent cells, and sequentially performing freezing, water bath and static standing to obtain a transformation solution, culturing and screening the transformation solution to obtain positive Agrobacterium; culturing the positive Agrobacterium to obtain a culture solution, mixing the culture solution with acetosyringone to obtain an infection solution; infecting the wound of the plant with the infection solution. The freezing, water bath, static standing, culture and screening of the transformation solution of the present invention can adopt conventional parameters without special limitation. The time for infecting the wound of the plant with the infection solution of the present invention is 5 min, and the concentration of acetosyringone in the infection solution is 50 μg / mL. The incidence degree of citrus canker of the CsECT transgenic plant of the present invention is significantly reduced, and the lesion area is significantly decreased.

[0046] The present invention clones the CsECT gene and constructs CsECT transgenic citrus. Through experiments, it is found that overexpression of the CsECT gene in citrus can significantly improve the citrus canker resistance of citrus. The CsECT gene of the present invention has potential application value in plant disease resistance.

[0047] In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0048] The CsECT gene cloned by the present invention is from Citrus reticulata 'Chachi', and the citrus variety used for transgenic is Calamondin.

[0049] Example 1 Cloning of CsECT Gene of Citrus

[0050] 1. Extraction of total RNA from Citrus reticulata 'Chachi' leaves and reverse transcription of cDNA strand

[0051] Take a small amount of leaves of Citrus reticulata 'Chachi', after grinding the leaves, extract the total RNA of Citrus reticulata 'Chachi' leaves according to the instructions of the polysaccharide and polyphenol plant RNA extraction kit FastPure Plant Total RNA Isolation Kit (product number RC401-01) of Nanjing Novoprotein Co., Ltd. Then detect the extraction quality of the total RNA by 1% agarose electrophoresis with a mass concentration, and detect the RNA concentration by the spectrophotometer NanoDrop2000. Use the TAKARA reverse transcription kit PrimeScript TMReverse transcription was performed using the RT reagent Kit with gDNA Eraser (RR047A) to obtain cDNA. Specifically, 2 μg of total RNA was taken as a template, 1.5 μL of 5×gDNA Eraser Buffer and 1 μL of gDNA Eraser were added, and RNase Free dH 2 O was added to make up to 15 μL. After mixing the sample evenly, it was placed in a PCR instrument and incubated at 42 °C for 2 min to remove genomic DNA. Then, 5 μL of 5×PrimeScript Buffer, 1.5 μL of PrimeScript RT Enzyme Mix I, 1.5 μL of RT PrimerMix, and 2 μL of RNase Free dH 2 O were added. After thorough mixing, it was incubated at 37 °C for 15 min, 85 °C for 5 s, and then cooled at 4 °C to obtain cDNA, which was stored at -30 °C.

[0052] 2. Cloning of the CsECT gene

[0053] Using the cDNA obtained in step 1 as a template, and CsECT-F (SEQ ID NO: 2): ATGGCTACTACTGTTGCTCCTGCTG; CsECT-R (SEQ ID NO: 3): ACAACCATTTGCAACCCCATTTGCC as primers, through the following system: 12.5 μL of 2×PrimeSTAR, 1 μL of CsECT-F, 1 μL of CsECT-R, 1 μL of cDNA, 9.5 μL of H 2 O. After thorough mixing, PCR amplification was carried out. The PCR reaction system was as follows: pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 2 min, for 32 cycles; then extension at 72 °C for 10 min. The PCR product was recovered using the Agarose Gel DNA Recovery Kit (product number DP219) from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0054] The PCR gel recovery product was ligated to the T-vector (pEASY-Blunt Cloning Vector) as follows: 1 μL of the T-vector was added to 4 μL of the PCR gel recovery product. After incubation at 37 °C for 5 min, the ligation product was obtained. The ligation product was added to DH5α Escherichia coli competent cells, allowed to stand on ice for 15 min, heat-shocked at 42 °C for 90 s, placed on ice for 2 min, added to LB liquid medium, cultured at 37 °C at 180 r / min, and then spread on an ampicillin-resistant medium and cultured overnight at 37 °C. Single colonies were picked, and the bacterial liquid was subjected to PCR and sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. A 2133-bp sequence was obtained, and after alignment, it was found to be the gene CsECT CDS sequence of citrus as shown in SEQ ID NO: 1.

[0055] The CsECT CDS sequence is as follows:

[0056]

[0057] The amino acid sequence of the CsECT protein encoded by the gene CsECT is shown in SEQ ID NO:8:

[0058] SEQ ID NO:8: MATTVAPAVEKASDLLQKLSLDSQTKSLEISEHTKKPSANQYGSVDSVNAAANGQIPSERSGTPFLNDFMDPNMCYVPNGYPSTAFYYGGYDGNVGEWDDYTRYVSQDGVDMTSGVYGDNGSLMYHHGYGYAPYPPYSPATSPVPTMGTDGQLYGPQHYQYPHYFQPITPTSSPYSPSPVAPTPGDIPTSVAADQKPLPVESTNGKSNGVANAGGVKGNNGSAPFKPTYQPFNSNNTYGRGSLPGRGPASGYQDPRCNLDGMRSPIPWLDGPVISDARPVASNTFNSSISNVNNVASSRNQNYRPNSHYMGLHHPRPMSGMGAAQGFMNMNRMYPNKLYGQYGNTFRSGVGFGSNGYDLRTNGRGWLSVDGKYKSRGRGNGYFGYGNENMDGLNELNRGPRAKGAKNQKGSAPNALPVKEQNVLTNGTAEDENDKISLSPDRDEYNKADFPEEYTDAKFFVIKSYSEDDVHKSIKYSVWASTPNGNKKLDAAYQEAQQKSRSCPVFLLFSVNTSGQFVGLAEMAGPVDFNKNVEYWQQDKWTGCFPVKWHIVKDVPNSLLKHITLENNENKPVTNSRDTQEIKLEQGLKLIKIFKDHPSKTCILDDFGFYETRQKTIQEKKAKQQQFQKQVWEGKPAEEKKELANGELKTQKSSEVASDLVEERTTTVQSNGDLRLSENGSVAKTGDAHKGSKPVVVSEKVILANGVANGC。

[0059] 3. Construction of the 35S overexpression vector using the goldengate method

[0060] Using the plasmid ligated to the T-vector in step 2 as a template, PCR amplification was performed with 35S-CsECT-F (SEQ ID NO: 4): GTGAAGACAAAATGGCTACTACTGTTGCTCCTGC and 35S-CsECT-R (SEQ ID NO: 5): GTGAAGACAAAAGCCTAACAACCATTTGCAACCCCATTTG to obtain a PCR gel recovery fragment.

[0061] After gel recovery, vector ligation was carried out according to the following system: 1 μL of PCR gel recovery fragment, 1 μL of pAGM243-35s-GFP plasmid, 1 μL of 10 mM ATP, 1 μL of buffer G, 0.5 μL of 4 T DNA ligase, 0.5 μL of BpiI, 5 μL of ddH 2 O. The reaction program was as follows: 37 °C for 10 min, 16 °C for 10 min, with 3 cycles; 37 °C for 10 min, 65 °C for 20 min. The ligated vector was transformed into DH5α Escherichia coli. Positive pAGM243-35s-CsECT-GFP strains were obtained through PCR detection and sequencing by Beijing Tsingke Biotechnology Co., Ltd. The pAGM243-35s-CsECT-GFP plasmid was extracted using a plasmid extraction kit and stored at -30 °C for later use. The pAGM243-35s-GFP vector of the present invention is the Kg2E-35SA-FLAG vector. The preparation method of the Kg2E-35SA-FLAG vector is the same as that in paragraphs

[0023] to

[0032] of CN118166023A, "A Simple and Efficient Citrus Genetic Transformation Final Vector and Its Construction Method and Application". The pAGM243 vector sequence can be found in paragraphs

[0034] to

[0037] of CN118166023A.

[0062] 4. Agrobacterium Transformation and Citrus Transformation

[0063] The plasmid pAGM243-35s-CsECT-GFP was transformed into Agrobacterium tumefaciens EHA105 as follows: 5 μL of the plasmid was added to the competent cells of Agrobacterium tumefaciens EHA105, and the mixture was allowed to stand for 30 min. After quick-freezing in liquid nitrogen for 1 min, it was incubated in a water bath at 37 °C for 2 min, then allowed to stand at room temperature for 2 min, and YEP medium was added. The mixture was spread on YEP medium containing spectinomycin at a concentration of 100 μg / mL, and cultured at 28 °C for 48 h. Positive pAGM243-35s-CsECT-GFP Agrobacterium tumefaciens was detected by PCR. The monoclonal strain was cultured overnight at 28 °C in YEP liquid medium containing rifampicin (rif) resistance and spectinomycin resistance, with the rif concentration of 50 μg / mL and the spectinomycin concentration of 100 μg / mL in the YEP liquid medium, and then inoculated into a new YEP medium containing rifampicin resistance and spectinomycin resistance for continued activation culture for about 12 h. Acetosyringone (AS) at a concentration of 50 μg / mL was added to the medium to obtain an AS liquid containing Agrobacterium tumefaciens.

[0064] CsECT transgenic citrus group: Wounds were made on the branches of Citrus mitis Blanco with a blade, and the wounds of the Citrus mitis Blanco branches were infected with the AS liquid containing Agrobacterium tumefaciens for 5 min, and the citrus branches were wrapped with plastic wrap. After 3 days, the wrapped plastic wrap was removed, and the branches were cultured under normal light. New buds grew out after about 1 month, and CsECT-positive transgenic citrus was obtained by screening with a handheld fluorometer.

[0065] Wild-type non-transgenic citrus: The same as the CsECT transgenic citrus group, the only difference being that the Agrobacterium tumefaciens AS liquid infection was not carried out.

[0066] The screening results are shown in Figure 1 , where A is a picture of wild-type non-transgenic Citrus mitis Blanco under white light, B is a picture of CsECT transgenic Citrus mitis Blanco material under white light, C and D are fluorescence images under GFP excitation light. C is the wild-type non-transgenic Citrus mitis Blanco under GFP excitation light, showing chlorophyll autofluorescence. Since the wild type does not have GFP, it does not emit green light, only the red light emitted by chlorophyll autofluorescence, so it is only red. D is a picture of CsECT transgenic Citrus mitis Blanco with a GFP fluorescent tag. CsECT transgenic Citrus mitis Blanco shows green fluorescence under GFP excitation light. The transgenic Citrus mitis Blanco emits green light due to GFP and also has the red light emitted by chlorophyll autofluorescence, so it appears pinkish-green overall.

[0067] Example 2 Evaluation of the disease resistance phenotype of transgenic citrus plants

[0068] Empty control group (Control): The empty pAGM243-35s-GFP plasmid was transformed into EHA105 Agrobacterium, specifically: 5 μL of the empty pAGM243-35s-GFP plasmid was added to the competent cells of EHA105 Agrobacterium, and allowed to stand for 30 minutes. After quick freezing in liquid nitrogen for 1 minute, the cells were placed in a water bath at 37°C for 2 minutes, allowed to stand at room temperature for 2 minutes, added to the YEP medium, and spread on the spectinomycin resistance medium, and cultured at 28°C for 48 hours. After the monoclonal strain was cultured overnight at 28°C and 200 rpm in the YEP liquid medium containing rif resistance and spectinomycin resistance, it was inoculated into a new YEP medium containing rif resistance and spectinomycin resistance and continued to be activated and cultured for about 12 hours. 50 μg / mL of acetosyringone (AS) was added to the medium to obtain the Agrobacterium infection solution containing the empty plasmid.

[0069] Preparation of citrus in the empty control group: Cut wounds on citrus kumquat branches with a blade, infect the wounds with Agrobacterium infection solution containing an empty plasmid for 5 minutes, and wrap the citrus branches with plastic wrap. After 3 days, untie the plastic wrap and culture them in normal light. New shoots will grow after about 1 month, and they will be screened using a handheld fluorescence instrument to obtain citrus in the empty control group.

[0070] The CsECT transgenic citrus (OE) obtained in Example 1 and the citrus of the empty control group (Control) were placed in an outdoor net room for cultivation. Under the condition of no pesticide spraying, the disease resistance results of the citrus in the OE and Control groups were as follows: Figure 2 As shown, the empty control group suffered more serious disease. From the appearance observation, the disease was caused by red spider mites, while the CsECT transgenic citrus (OE) showed good growth condition.

[0071] Further analysis was conducted to determine whether CsECT transgenic citrus was also resistant to the common citrus disease ulcer. The specific process was as follows:

[0072] The preserved canker pathogen Xanthomonas citri subsp. citri (Xcc) was streaked on LB solid medium and cultured at 28°C for 2 days, then inoculated into 1 mL LB liquid medium, cultured at 28°C overnight at 180 rpm, and identified by canker pathogen-specific primers F: TTCGGCGTCAACAAAATG (SEQ ID NO: 6) and R: AACTCCAGCACATACGGGTC (SEQ ID NO: 7), and then subjected to secondary amplification culture. The secondary amplification culture was specifically as follows: 500 μL of the canker pathogen XCC culture solution was added to 50 mL LB liquid medium, cultured overnight for 12 h, centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the suspension was resuspended with sterile water to OD 600= 0.3 for backup to obtain XCC bacterial liquid. The strain Xcc belongs to the Asian pathogenic type (type A).

[0073] Cultivate one-year-old CsECT transgenic citrus (OE) and empty vector control citrus (Control) in the greenhouse. The growth of the two types of citrus is the same, and the cultivation temperature is 25°C, which is used for citrus canker inoculation.

[0074] There are two methods for citrus canker inoculation: The first method is the acupuncture method: Use an inoculation needle to puncture wounds on the citrus leaves, and inoculate 3 μL of XCC bacterial liquid at the wound; the second method is the injection method: First puncture wounds on the citrus leaves, and then use a 1 mL syringe to inject the bacterial liquid into the citrus leaves.

[0075] Continue to cultivate the CsECT transgenic citrus and empty vector control citrus inoculated with citrus canker bacteria in the 25°C greenhouse, with normal water and fertilizer management. After 9 days, count the incidence of transgenic citrus and empty vector control citrus after inoculation. The results are as Figure 3 and Figure 4 shown. Figure 3 In it, A is the front of the citrus leaf inoculated with citrus canker bacteria by the acupuncture method, B is the back of the citrus leaf inoculated with citrus canker bacteria by the acupuncture method, C is a partial enlarged view of Figure B, D is the statistical chart of the citrus canker lesion area. Among them, the citrus canker lesion areas of the three biological replicates of the Control group are 0.15 cm 2 , 0.10 cm 2 and 0.11 cm 2 , respectively, and the citrus canker lesion areas of the three biological replicates of the OE group are 0.05 cm 2 , 0.03 cm 2 and 0.02 cm 2 . Figure 4 In it, A is the front view of the citrus leaf inoculated with citrus canker by the injection method, and B is the back view of the citrus leaf inoculated with citrus canker bacteria by the injection method.

[0076] According to Figure 3 and Figure 4 , it can be seen that 9 days after inoculation with citrus canker bacteria, the incidence of citrus canker in transgenic citrus is significantly lower than that of the empty vector control plants ( Figure 4 ), and the lesion area of transgenic citrus is significantly smaller than that of the empty vector control plants ( Figure 3 ).

[0077] In summary, the present invention clones the CsECT gene, constructs CsECT transgenic citrus, and through experiments, it is found that overexpression of the CsECT gene in citrus can significantly improve the citrus canker resistance of citrus.

[0078] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A CsECT protein related to plant disease resistance, characterized in that: The amino acid sequence of the CsECT protein is shown in SEQ ID NO:

8.

2. The nucleic acid molecule encoding the CsECT protein according to claim 1, characterized in that: The CDS sequence of the nucleic acid molecule is shown in SEQ ID NO:

1.

3. A recombinant vector, characterized in that: It comprises a starting vector and the nucleic acid molecule according to claim 2.

4. A recombinant bacterium, characterized in that: It comprises the original strain and the recombinant vector described in claim 3.

5. Use of the CsECT protein according to claim 1 or the nucleic acid molecule of the CsECT protein according to claim 2 or the recombinant vector according to claim 3 or the recombinant bacteria according to claim 4 in improving plant disease resistance.

6. The use according to claim 5, characterized in that: The improving the disease resistance of plants includes improving the resistance of plants to ulcer disease.

7. The use according to claim 5 or 6, characterized in that: The improving method includes overexpressing CsECT protein.

8. The use according to any one of claims 5 to 7, characterized in that: The application comprises the following steps: transferring the nucleic acid molecule encoding the CsECT protein into plants to induce overexpression of the CsECT protein.

9. A method for improving plant disease resistance or creating disease-resistant plants, characterized in that: The recombinant vector is transferred into plants to obtain plants with improved plant disease resistance; the recombinant vector is the recombinant vector described in claim 3 or 4 or the recombinant vector constructed by the construction method described in claim 5 or 6.

10. The method according to claim 9, characterized in that: The plants include citrus.

Images