Zygosaccharomyces rouxii and application of zygosaccharomyces rouxii in preparation of soy sauce

Abstract

The invention provides zygosaccharomyces rouxii and application thereof in preparing soy sauce. The zygosaccharomyces rouxii disclosed by the invention is zygosaccharomyces rouxii ZB443, and the preservation number of the zygosaccharomyces rouxii ZB443 is GDMCC (Glutamic Disease of Microorganisms) No: 65199. The invention further discloses a preparation method of the zygosaccharomyces rouxii ZB443. The yeast can effectively improve the fragrance of the soy sauce, has relatively strong lactic acid resistance, increases the contents of HEMF, HDMF, 1-octylene-3-ol, 3-hydroxy-2-butanone and ethanol in the soy sauce, and increases the sauce fragrance and mellow flavor.

Description

Technical Field

[0001] The present invention belongs to the technical field of microorganisms, and particularly relates to a Zygosaccharomyces rouxii ZB443 and its application in the preparation of soy sauce. Background Art

[0002] Soy sauce is one of the most common and widely used seasonings in China, and is also a popular seasoning in Southeast Asian countries and European and American countries. As a daily seasoning, soy sauce is one of the main ways for human body to intake salt. Excessive intake of salt will increase the prevalence of hypertension and cardiovascular and cerebrovascular diseases. To reduce the health risks of chronic diseases caused by high-salt intake among residents, China has proposed to reduce the sodium content standard of soy sauce from 6536 mg / 100 g in 2016 to 5230 mg / 100 g in 2030 (equivalent to 13.3 g / 100 g of sodium chloride). It can be seen that the food industry's demand for reducing the salt content in soy sauce is increasing day by day.

[0003] At present, according to different production methods, the production methods of low-salt soy sauce can be divided into direct production method and desalination method. The direct production method refers to the method of preparing low-salt soy sauce from raw materials such as soybeans through a fermentation process, while the desalination method is a method of preparing low-salt soy sauce by removing salt from ordinary high-salt soy sauce through physical methods. However, the reduction of salt content may change the sensory characteristics of the product, resulting in problems such as too high total acid, too low pH and alcohol content, and reduced aroma of soy sauce, leading to a decrease in the consumer acceptance of the food. 4-Hydroxy-2(5)-ethyl-5(2)-methyl-3(2H)-furanone (HEMF), 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF) are the main components of the sauce flavor substances in soy sauce. 1-Octen-3-ol has the aroma of mushrooms, 3-hydroxy-2-butanone has a sweet aroma flavor, and ethanol can give soy sauce a pleasant mellow aroma and has a certain preservative effect on soy sauce. Increasing the content of these aromatic compounds can improve the flavor of low-salt fermented soy sauce to improve the quality of soy sauce.

[0004] At present, the main ways to improve the flavor of soy sauce include selecting suitable raw materials and appropriate raw material ratios, adding an appropriate amount of microorganisms, extending the soy sauce fermentation time, and using blending to improve the flavor of soy sauce. The invention patent application CN202111158919.X discloses a preparation method and product of a flavor-enhanced and salt-reduced soy sauce, which adopts a gradient salt-increasing fermentation process to prepare salt-reduced soy sauce, and at the same time adds alkaline and acidic protease solutions to achieve a flavor-enhancing effect. The invention patent application CN202111050882.9 discloses a salt-reduced soy sauce with a typical Cantonese soy sauce flavor and its production method, which uses high-salt fermentation in the early stage and adds a wheat flavor fermentation liquid that has been fully enzymolyzed in the later stage to reduce salt content and improve flavor. The above-mentioned invention patent applications adopt two different salt-reduced soy sauce fermentation processes, and improve the flavor of soy sauce by additionally adding protease solution or flavor fermentation liquid, which increases the production cost and relatively cumbersome process steps. The invention patent application CN202211579052.X discloses a strain of Saccharomyces cerevisiae ZB424, which can increase the content of ethyl propionate and 1-octen-3-ol in soy sauce, enrich the aroma substances in soy sauce, and improve the overall flavor and quality of soy sauce. However, this invention patent application uses a low-salt solid-state soy sauce brewing method, and the strain needs to be domesticated for high-temperature resistance. Although the salt content can be effectively reduced, due to the high temperature during the fermentation process, the activity of other microorganisms is insufficient, and they cannot effectively participate in the soy sauce flavor fermentation stage. The invention patent application CN202211006556.2 discloses a brewing soy sauce fermentation method for reducing salinity and enhancing saltiness and umami. Weissella paramesenteroides JL-5 and Bacillus amyloliquefaciens JDF-2 that inhibit the growth of spoilage bacteria are isolated and screened from low-salt mash, and the obtained strains are used for the fermentation of low-salt-concentration mash by changing the microbial fermentation process of high-salt dilute-state soy sauce. However, the main research focuses on the saltiness and umami of soy sauce, and the contents of the main flavor substances such as alcohols and esters in the salt-reduced brewing soy sauce have decreased significantly. The invention patent application CN202111091945.5 discloses a strain of Wickerhamiella versatilis ZB435. Using a low-salt dilute-state fermentation technology, adding the strain ZB435 to the mash during the 20th to 40th days of mash fermentation can significantly increase the content of 4-ethylguaiacol, glutamic acid, and / or β-phenylethanol in soy sauce, but does not analyze other important aroma components of soy sauce.

[0005] In addition, during the process of fermenting soy sauce with Zygosaccharomyces rouxii under a salt-reduced system, the growth and metabolism of lactic acid bacteria become more vigorous, and excessive acid production will inhibit the growth of Zygosaccharomyces rouxii, which is not conducive to soy sauce fermentation.

[0006] Therefore, there is an urgent need to develop an aroma-enhancing yeast that can effectively improve the flavor of soy sauce, especially salt-reduced soy sauce, and at the same time has strong acid resistance. This is of great significance for promoting the sustainable and healthy development of the salt-reduced soy sauce industry. Summary of the Invention

[0007] In order to solve the problem of the reduction of soy sauce aroma caused by the reduction of salt content during the soy sauce fermentation process, through a large number of experimental screenings and studies, the present application isolated and screened a strain of Zygosaccharomyces rouxii ZB443 from moromi that can effectively improve the flavor substances of soy sauce (HEMF, HDMF, 1-octen-3-ol, 3-hydroxy-2-butanone, ethanol) and has strong acid tolerance. At the same time, a fermentation process for preparing soy sauce was developed, and the overall aroma of the prepared soy sauce is more intense and rich, and the taste and quality are better.

[0008] To this end, in the first aspect, the present invention provides a strain of Zygosaccharomyces rouxii ZB443, and the preservation number of the Zygosaccharomyces rouxii ZB443 is GDMCC No: 65199.

[0009] In the second aspect, the present invention provides a method for preparing soy sauce, the method comprising inoculating Zygosaccharomyces rouxii ZB443 into moromi and fermenting to obtain soy sauce.

[0010] In the third aspect, the present invention provides a soy sauce, which is fermented from Zygosaccharomyces rouxii ZB443 or by the method of the present invention; preferably, the soy sauce is a low-salt soy sauce; preferably, the sodium chloride content in the soy sauce is 10%-22% (w / w), such as 12%-18% (w / w), and further such as ≤15% (w / w), ≤14% (w / w) or ≤13% (w / w).

[0011] In the fourth aspect, the present invention provides the use of Zygosaccharomyces rouxii ZB443 in the preparation of soy sauce or the improvement of soy sauce flavor. Description of the Drawings

[0012] The drawings herein are used to provide a further understanding of the present invention, and constitute a part of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention. In the drawings:

[0013] Figure 1 Shows the colony morphology diagram of Zygosaccharomyces rouxii ZB443.

[0014] Figure 2 Shows the morphology of Zygosaccharomyces rouxii ZB443 observed under a microscope.

[0015] Figure 3 Shows the sensory evaluation results of the aroma of soy sauce fermented by Zygosaccharomyces rouxii ZB443.

[0016] Figure 4The comprehensive sensory evaluation results of the soy sauce with reduced salt fortified with Zygosaccharomyces rouxii ZB443 and the conventional high-salt diluted-state fermented soy sauce are shown.

[0017] Description of the preservation of biological materials

[0018] The present invention relates to the following biological materials that have been preserved at the Guangdong Provincial Microbial Culture Collection Center (5th Floor, Building 59, 100th Yard, Xianlie Middle Road, Guangzhou, Guangdong Province):

[0019] Zygosaccharomyces rouxii ZB443, with the preservation number GDMCC No: 65199 and the preservation date of September 24, 2024. Detailed implementation manners

[0020] The following will describe the implementation schemes of the present invention in detail in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. For those not specified in the examples, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. For the reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0021] Zygosaccharomyces rouxii ZB443

[0022] Research has found that the Zygosaccharomyces rouxii ZB443 screened in this application can effectively improve the flavor substances in soy sauce fermentation, including HEMF, HDMF, 1-octen-3-ol, 3-hydroxy-2-butanone, and ethanol. In addition, Zygosaccharomyces rouxii ZB443 can tolerate a relatively high content of lactic acid and can consume the excessive lactic acid produced during fermentation, which is very beneficial to the fermentation of soy sauce (especially soy sauce with reduced salt) and improves the overall aroma and flavor of soy sauce.

[0023] In one aspect, the present invention provides a Zygosaccharomyces rouxii ZB443, and the preservation number of the Zygosaccharomyces rouxii ZB443 is GDMCC No: 65199.

[0024] In some implementation schemes, the Zygosaccharomyces rouxii ZB443 has improved acid tolerance. In the wort medium added with lactic acid, inoculate Zygosaccharomyces rouxii ZB443 at an inoculation amount of 1%, and culture it at 30 °C and 180 rpm. The Zygosaccharomyces rouxii ZB443 can tolerate not less than 10.00 mg / mL of lactic acid.

[0025] In some embodiments, the Zygosaccharomyces rouxii ZB443 has an improved lactic acid metabolism ability. Add 5.00 - 10.00 mg / mL of lactic acid to the wort medium, inoculate Zygosaccharomyces rouxii ZB443 at an inoculation amount of 1%, and culture at 30 °C and 180 rpm. The Zygosaccharomyces rouxii ZB443 can consume 56% of the lactic acid in the medium after 6 days of fermentation.

[0026] In one aspect, the present invention provides the use of Zygosaccharomyces rouxii ZB443 in the preparation of soy sauce or the improvement of the flavor of soy sauce.

[0027] In one aspect, the present invention provides the use of Zygosaccharomyces rouxii ZB443 in increasing the content of any one or more of 4 - hydroxy - 2(5) - ethyl - 5(2) - methyl - 3(2H) - furanone (HEMF), 4 - hydroxy - 2,5 - dimethyl - 3(2H) - furanone (HDMF), 1 - octen - 3 - ol, 3 - hydroxy - 2 - butanone, ethanol, ethyl acetate, and 4 - ethylguaiacol in soy sauce or low - salt soy sauce.

[0028] In some embodiments, the sodium chloride content in the soy sauce prepared by Zygosaccharomyces rouxii ZB443 is 8 - 20 g / 100 ml, such as 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20 g / 100 ml, or within the range of any two of the above contents.

[0029] In some embodiments, the soy sauce prepared by Zygosaccharomyces rouxii ZB443 is low - salt soy sauce.

[0030] In some embodiments, the sodium chloride content in the low - salt soy sauce is ≤13.5 g / 100 ml, such as 9 - 13 g / 100 ml, and further such as ≤13 g / 100 ml, ≤12 g / 100 ml, or ≤11 g / 100 ml.

[0031] Soy sauce preparation method

[0032] In one aspect, the present invention provides a method for preparing soy sauce, the method comprising: inoculating Zygosaccharomyces rouxii ZB443 into the moromi, and fermenting to obtain the soy sauce.

[0033] In a specific embodiment, the preparation method includes one or more of the following steps:

[0034] 1) Making koji with cereals and / or legumes as raw materials to obtain soy sauce koji material;

[0035] 2) Add an aqueous sodium chloride solution to the soy sauce koji material and mix to make moromi;

[0036] 3) Inoculate the moromi with the Zygosaccharomyces rouxii ZB443;

[0037] 4) Ferment;

[0038] 5) Filter to obtain soy sauce.

[0039] In some embodiments, the legumes are selected from soybeans, such as soybean meal and defatted soybeans. The legumes are cooked or steamed for cooking. In some embodiments, the cereal is wheat, such as flour. In some embodiments, the cereal is roasted. In some embodiments, the koji-making raw materials are soybeans and wheat, and the weight ratio of the two is (6 - 8):(4 - 2).

[0040] In some embodiments, the moromi is prepared by mixing the soy sauce koji material and the aqueous sodium chloride solution. In some embodiments, the concentration of the aqueous sodium chloride solution is 10% - 22% (w / w), such as 12% - 18% (w / w), and further such as ≤15% (w / w), ≤14% (w / w) or ≤13% (w / w). In some embodiments, the volume ratio of the soy sauce koji material to the aqueous sodium chloride solution is 1:(1.5 - 5), such as 1:1.5, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, 1:5, or within the range of any two of the above ratios. In a preferred embodiment, the volume ratio of the soy sauce koji material to the aqueous sodium chloride solution is 1:(2 - 3).

[0041] In some embodiments, the Zygosaccharomyces rouxii ZB443 is inoculated on the 0 - 20th day, such as the 0 - 5th day, after the moromi is prepared, for example, on the day when the moromi is prepared, or on the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th day after the moromi is prepared.

[0042] In some embodiments, the inoculation amount of the Zygosaccharomyces rouxii ZB443 is 10 6 CFU / g to 10 9 CFU / g.

[0043] The fermentation described in this application can be carried out at multiple suitable temperatures for multiple time periods, and there is no particular limitation on the fermentation temperature and time, as long as the yeast can ferment at a reasonable rate at this temperature and time.

[0044] In some embodiments, the method includes fermenting first at a first temperature after the moromi is prepared, then continuing to ferment at a second temperature, and finally fermenting at a third temperature.

[0045] In some embodiments, the first, second, and third temperatures are independently 20 to 40 °C, such as 20 °C, 22 °C, 24 °C, 25 °C, 26 °C, 28 °C, 30 °C, 32 °C, 34 °C, 35 °C, 36 °C, 38 °C, 40 °C, or within the range of any two of the above temperatures, or the first, second, and third temperatures may be the ambient temperature.

[0046] In some embodiments, the second temperature is higher than the first temperature.

[0047] In some embodiments, fermentation is carried out at the first temperature for 1 - 20 days, such as 1 - 15 days, 1 - 10 days, such as 5 days.

[0048] In some embodiments, fermentation is carried out at the second temperature for 5 - 20 days, such as 5 - 15 days, such as 10 days.

[0049] In some embodiments, fermentation is carried out at the second temperature for 10 - 100 days, such as 10 - 50 days, 60 - 90 days, such as 70 days.

[0050] In a preferred embodiment, the fermentation includes the following three stages:

[0051] Stage I, days 0 - 5 for preparing the moromi; controlling the fermentation temperature at 20 - 25 °C, such as 22 - 24 °C;

[0052] Stage II, days 6 - 15 for preparing the moromi; controlling the fermentation temperature at 25 - 35 °C, such as 28 - 32 °C, and further such as 30 °C;

[0053] Stage III, from day 16 to fermentation maturity for preparing the moromi; controlling the fermentation temperature at the ambient temperature.

[0054] In some embodiments, the method for preparing soy sauce is selected from low - salt solid - state fermentation, high - salt dilute - state fermentation, or low - salt dilute - state fermentation.

[0055] In a preferred embodiment, the method for preparing soy sauce is high - salt dilute - state fermentation.

[0056] In some embodiments, the method is used to increase the content of at least one of the following aroma components in soy sauce: 4 - hydroxy - 2(5) - ethyl - 5(2) - methyl - 3(2H) - furanone (HEMF), 4 - hydroxy - 2,5 - dimethyl - 3(2H) - furanone (HDMF), 1 - octen - 3 - ol, 3 - hydroxy - 2 - butanone, ethanol, ethyl acetate, 4 - ethylguaiacol.

[0057] Soy sauce

[0058] In one aspect, the present invention provides a soy sauce, which is prepared by fermenting with Zygosaccharomyces rouxii ZB443 or by any of the methods described herein.

[0059] In some embodiments, the sodium chloride content in the soy sauce is 8 - 20 g / 100 ml, such as 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20 g / 100 ml, or within the range of any two of the above contents.

[0060] In some embodiments, the soy sauce is a low-salt soy sauce.

[0061] In some embodiments, the sodium chloride content in the low-salt soy sauce is ≤ 13.5 g / 100 ml, such as 9 - 13 g / 100 ml, or further such as ≤ 13 g / 100 ml, ≤ 12 g / 100 ml or ≤ 11 g / 100 ml.

[0062] The term "mash" used in the present invention refers to a thick semi-fluid mixture formed by mixing koji with an aqueous sodium chloride solution.

[0063] Example

[0064] The present invention will be further illustrated by specific examples and comparative examples below. However, it should be understood that these examples and comparative examples are only for more detailed and specific illustration, and should not be construed as limiting the present invention in any form.

[0065] Example 1. Strain isolation and screening

[0066] (1) Primary screening

[0067] Take 100 g of mash fermented for 30 days, add 200 mL of sterile water and shake. Then take 1 mL of the suspension and dilute it 10 -1 、10 -2 、10 -3 、10 -4 times with physiological saline, and use a malt extract agar medium containing 10% NaCl for dilution coating. Culture at 30 °C for 48 h, select single colonies for microscopic morphological observation. 17 strains are initially confirmed as yeast morphology. Pick the single colonies, resuspend them with 1 mL of physiological saline, and then use a malt extract medium containing 10% NaCl for streak purification. Culture at 30 °C for 48 h, and pick single colonies for secondary screening.

[0068] (2) Secondary screening

[0069] 17 strains obtained from the primary screening were identified by 26s rDNA bacterial species sequencing. 14 strains were Torulopsis and 3 strains were Zygosaccharomyces rouxii. The above yeasts were amplified to a concentration of 10 8 CFU / mL in soy sauce liquid medium and added to the 13% (w / w) salted moromi that had been fermented for 15 days for rescreening of soy sauce flavor enhancement fermentation. After the fermentation period, 8 R & D personnel with rich sensory experience described the flavors such as caramel aroma, wine aroma, soy sauce aroma, ester aroma, and sweet aroma of the crude oil by sensory smelling, synthesized the descriptive words with commonalities, and simultaneously analyzed the aroma components of the volatile flavor substances. The results are shown in Table 1. Backfilling aroma-producing yeasts in the fermented moromi all had a positive effect on enhancing the aroma of the crude oil. The overall aroma richness of the crude oil after adding yeast was higher than that of the crude oil without adding yeast, and its sensory performance was an increase in flavors such as soy sauce caramel aroma, wine aroma, soy sauce aroma, ester aroma, and sweet aroma.

[0070] Table 1 General description of sensory evaluation of crude oil fermented by yeast backfilling

[0071]

[0072]

[0073] It can be seen from the results of Table 1 that some of the crude oils fermented by 17 strains showed a certain soy sauce aroma and were selected as target strains for the next flavor enhancement verification.

[0074] Example 2. Aroma enhancement verification of the screened strain

[0075] Select 10 groups of backfill flavor-enhanced samples with significant differences in Example 1 and use headspace solid-phase microextraction-gas chromatography-mass spectrometry (SPME-GC-MS) for aroma analysis. The analysis results are shown in Table 2. The specific detection method is as follows:

[0076] Age the extraction fiber head of solid-phase microextraction in the injection port of the gas chromatograph at an aging temperature of 250°C for 1 h. Weigh 5 g of the crude oil after yeast flavor-enhanced fermentation into a headspace vial, seal and equilibrate, then insert the SPME extraction head and extract at 40°C for 30 min. Keep shaking during the extraction process. After the extraction is completed, desorb in the GC injection port (250°C) for 20 min.

[0077] Use an HP-INNOWAX elastic quartz capillary chromatographic analysis column (60 m × 0.25 mm × 0.25 μm). The carrier gas is helium (1.2 mL / min). Use an electron impact ionization (EI) ion source with an electron energy of 70 eV and an ion source temperature of 250°C. The programmed temperature conditions are: the initial temperature is 40°C, hold for 5 min, increase to 240°C at a rate of 5°C / min, and hold for 15 min. Use the splitless mode.

[0078] Analysis of the relative contents of key aroma components in the backfill fermentation of the screened strains in Table 2 (%)

[0079]

[0080]

[0081] From the data results in Table 2, taking the crude oil without yeast backfill as the control, compared with the control group, the aroma intensity of the crude oil samples after backfill fermentation with the screened yeast until the fermentation period is overall better than that of the control samples. Among them, the Zygosaccharomyces rouxii ZB443 sample shows significant advantages in sensory smelling, and the HEMF, HDMF, 3-hydroxy-2-butanone and ethanol produced by its metabolism are the highest among the 10 strains of yeast. Therefore, Zygosaccharomyces rouxii ZB443 is selected as the target strain for soy sauce fermentation.

[0082] Example 3: Identification of Zygosaccharomyces rouxii ZB443

[0083] Zygosaccharomyces rouxii ZB443 was cultured by repeated isolation and purification on a malt extract agar plate. Figure 1 This is the colony morphology of Zygosaccharomyces rouxii ZB443. Figure 2 This is the morphology observed under the microscope. Using the DNA-EZ Reagents V All-DNA-Fast-Out universal one-step DNA extraction solution, 2 μL of the bacterial solution activated with YPD liquid medium was added to 50 μL of the DNA extraction solution (Sangon Biotech, product number: B642315), and PCR was carried out after a 5-min water bath at 80 °C. The ITS sequence of the primer was amplified using the universal primers ITS4 and ITS5. The PCR amplification conditions were: pre-denaturation at 94 °C for 4 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 48 s, for 34 cycles; extension at 72 °C for 10 min. The following sequence was obtained. After alignment and analysis in the NCBI database using the BLAST program, the homologous similarity with Zygosaccharomyces rouxii CBS 732 was 99.71%, indicating that this strain belongs to the genus Zygosaccharomyces rouxii.

[0084] GGGTCGGAAGGATCATTATAGAAAAATGACGTGAACTCTTAACG

[0085] GAGTTCTCTCAAAGTGTTGGAGGGGAAGGCCTGCGCTTAATTGC

[0086] GCGGCTGTTTTTAATCTCCTCCGCCTTTGATACACACATTGGAGT

[0087] TTCTACTTTTTTGTTCTCTTTGGGAGGGTTCTGCTCTCCCAGAGG

[0088] TAAACACAAACAATCTTTTATTATACTATTAACACAGTCAAATGAA

[0089] TTTTAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGT

[0090] TCTCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAATGTG

[0091] AATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGC

[0092] GCCCCTTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCC

[0093] CTCTCAAACTTTACGTTTGGTAGTGAGCGATACTCTACTCTGGAG

[0094] TTTGCTTGAAAATGGGAGGCCATAGGCGAAGCATTGCTTTCCAAT

[0095] CCTGCGGCCCTCTGCTTACTTCCCCTTGTGGGTTGTGGCAGGGGA

[0096] AAGCGGGAGGCGCCTTGCCACGATAGTCGTATTAGGTTTTACCG

[0097] ACTCGGCGAAAGTGAAGAGGTTTGCTTTTTAAAAAGAAGCAGGC

[0098] AGCGTCTGGCTTGACAAAATTCTCAAAGTTTGACCTCAAATCAGG

[0099] TAGGATTACCCGCTGAACTTAAGCAAATCATCATGTCCCTCTTGG

[0100] TAAAG

[0101] Example 4. Acid tolerance test of Zygosaccharomyces rouxii ZB443

[0102] Add lactic acid at concentrations of 5.00 mg / mL, 6.00 mg / mL, 7.00 mg / mL, 8.00 mg / mL, 9.00 mg / mL, and 10.00 mg / mL to the wort medium, inoculate Zygosaccharomyces rouxii ZB443 at an inoculation amount of 1%, and culture it at 30 °C and 180 rpm. Detect the OD of the medium 600 and lactic acid content. The results are shown in Tables 3 and 4

[0103] Table 3 OD of Zygosaccharomyces rouxii ZB443 at different lactic acid concentrations 600

[0104]

[0105] Table 4 Lactic acid content (mg / mL) of Zygosaccharomyces rouxii ZB443 at different lactic acid concentrations

[0106]

[0107]

[0108] It can be seen from the results in Tables 3 and 4 that Zygosaccharomyces rouxii ZB443 can tolerate lactic acid at a concentration of 10.00 mg / mL, and at the same time, it can consume 56% of the lactic acid in the medium after 6 days of fermentation, indicating that it has strong lactic acid tolerance

[0109] Example 5: Aroma enhancement effect of Zygosaccharomyces rouxii ZB443 in a reduced-salt fermentation system

[0110] Cultivate Zygosaccharomyces rouxii ZB443 to a concentration of 10 8 CFU / mL, and add it to the fermentation system with a salt content of 13% at the initial stage of fermentation. Use the detection method of Example 1 to detect the volatile aroma components of the expired crude oil and conduct a sensory evaluation of the aroma flavor. The detection results of the volatile aroma components are shown in Table 5

[0111] Table 5 Detection of key aroma components of Zygosaccharomyces rouxii ZB443 in low-salt fermented soy sauce (%)

[0112]

[0113] The data in Table 5 show that in the fermentation system with a salt content of 13%, backfilling Zygosaccharomyces rouxii ZB443 can effectively increase the key aroma components in low-salt fermented soy sauce, that is, the contents of HEMF, HDMF, 3-hydroxy-2-butanone, and 1-octen-3-ol all increase, and the ethanol content increases by 62.4% compared with the control sample without yeast backfilling

[0114] In addition, 10 sensory evaluators with rich sensory evaluation experience were organized to comprehensively analyze the fermented crude oil of the control and the backfilled Zygosaccharomyces rouxii ZB443 in terms of six aspects: soy sauce aroma, ester aroma, fermented soybean aroma, fruity aroma, mellow aroma, and comprehensive aroma. The score ranges from 0 to 5 points, and the higher the score, the better the indicator. The evaluation results are as Figure 3 shown. Compared with the control, the aroma of soy sauce fermented with ZB443 was significantly improved, and the aromas such as soy sauce aroma, ester aroma, and mellow aroma were all enhanced, and the overall soy sauce aroma and ester aroma were more prominent.

[0115] Example 6: Optimization of the fermentation process of Zygosaccharomyces rouxii ZB443-enhanced reduced-salt soy sauce

[0116] (1) Optimization of the temperature control process for low-salt soy sauce

[0117] Low normal temperature process: Using soybeans and wheat flour as raw materials, inoculating Aspergillus oryzae 3.042 according to the conventional method for koji making. When the koji turns yellow (i.e., when making the sauce mash), mix it with low-temperature 13% brine at a temperature of 22 - 24°C (low normal temperature). The temperature of the sauce mash gradually rises to 30°C in the first 15 days, and then the temperature is naturally controlled.

[0118] 30°C process: Using soybeans and wheat flour as raw materials, inoculating Aspergillus oryzae 3.042 according to the conventional method for koji making. When the koji turns yellow, mix it with 13% brine at a temperature of 30°C, and then keep the temperature at 30°C during the subsequent fermentation.

[0119] The total acid content of the above two processes was detected according to GB 12456-2021 respectively, and the results are shown in Table 6.

[0120] Table 6 Changes in total acid content during the fermentation of temperature-adjusted sauce mash

[0121]

[0122] The results in Table 6 show that the total acid content of the sauce mash during the low normal temperature fermentation process is lower than that of the 30°C fermentation process. It can improve the phenomenon of rapid increase in total acid during the 30°C low-salt thin mash fermentation process, avoid too rapid pH drop in the early stage of sauce mash fermentation, and provide suitable pH conditions for the later growth of aroma-producing yeasts. Therefore, the low normal temperature fermentation process is selected for the preparation of low-salt soy sauce.

[0123] (2) Optimization of the fermentation process of Zygosaccharomyces rouxii ZB443-enhanced low-salt soy sauce

[0124] Based on the low and normal temperature fermentation process, a study was conducted on the enhancement process of Zygosaccharomyces rouxii ZB443. ZB443 yeast was inoculated on the 5th day of making the moromi (i.e., the yellowing stage, moromi temperature 22 - 24°C) and the 15th day of moromi fermentation (moromi temperature naturally rose to 30°C). The control group was without inoculating Zygosaccharomyces rouxii ZB443. Physicochemical indexes such as total acid, ammonia nitrogen, glutamic acid, and salt content, and key aroma indexes such as ethanol, HEMF, and HDMF were detected. The results are shown in Table 7.

[0125] Table 7 Physicochemical and aroma analysis of the enhancement process of Zygosaccharomyces rouxii ZB443

[0126]

[0127] Note: Taking the indexes of the control group as 1.00, the corresponding ratios of other groups were converted.

[0128] The crude ethanol, HEMF, and HDMF contents were higher when ZB443 yeast was inoculated on the 5th day of the yellowing stage, and its total acid was also lower than that of the inoculation on the 15th day and the control group, which proved that enhancing ZB443 yeast in the early stage of the yellowing stage had a stronger promotion effect on both system anti - contamination and aroma improvement.

[0129] Furthermore, a sensory comparison was made between the salt - reduced soy sauce enhanced with Zygosaccharomyces rouxii ZB443 and the conventional high - salt diluted - state fermented soy sauce. 10 experienced sensory evaluation personnel were recruited for comprehensive sensory evaluation. The evaluation indexes of the sensory evaluation included umami, sweetness, sourness, saltiness, aroma, and comprehensive taste. The results are as Figure 4 shown. The results showed that the aroma of the salt - reduced fermented soy sauce enhanced by yeast for fragrance improvement was better than that of the crude oil of the conventional high - salt fermentation process. At the same time, the saltiness of the soy sauce weakened to a certain extent after salt reduction, but the umami and sweetness of the soy sauce were effectively enhanced, making the taste of the salt - reduced fermented soy sauce sweet and fresh, the saltiness mild, and the taste coordinated and gentle.

[0130] Although the specific implementation manners of the present invention have been described in detail, those skilled in the art will understand that according to all the teachings that have been disclosed, various modifications and substitutions can be made to those details, and these changes are all within the protection scope of the present invention. The entire scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. A Zygosaccharomyces rouxii ZB443, wherein the deposit number of the Zygosaccharomyces rouxii ZB443 is GDMCC No: 65199.

2. A method for preparing soy sauce, the method comprising: The Zygosaccharomyces rouxii ZB443 described in claim 1 is inoculated into soy sauce mash and fermented to obtain the soy sauce.

3. The method of claim 2, wherein: Mixing soy sauce koji and sodium chloride aqueous solution to obtain the soy sauce mash; Preferably, the concentration of the sodium chloride aqueous solution is 10%-22% (w / w), such as 12%-18% (w / w), and for example ≤15% (w / w), ≤14% (w / w) or ≤13% (w / w); Preferably, the volume ratio of the soy sauce koji material to the sodium chloride aqueous solution is 1:(1.5-5), for example 1:(2-3).

4. The method according to claim 3, wherein the inoculation is performed on the 0th to 5th day after the mash is prepared; Preferably, the amount of inoculation is 10 6 CFU / g~10 9 CFU / g.

5. The method according to any one of claims 2 to 4, wherein the fermentation comprises the following three stages: Stage I is the 0th to 5th day of preparing the mash; the fermentation temperature is controlled to be 20-25° C., for example, 22-24° C.; Stage II is the 6th to 15th day of preparing the mash; the fermentation temperature is controlled to be 25-35° C., for example, 28-32° C., and for example, 30° C.; Phase III is from the 16th day after the mash is prepared to fermentation maturity; the fermentation temperature is controlled to be ambient temperature.

6. The method according to any one of claims 2 to 5, wherein: The method is high-salt dilute fermentation.

7. The method according to any one of claims 2 to 6, wherein: The method is used to increase the content of at least one of the following aroma components in soy sauce: 4-hydroxy-2(5)-ethyl-5(2)-methyl-3(2H)-furanone (HEMF), 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF), 1-octen-3-ol, 3-hydroxy-2-butanone, ethanol, ethyl acetate, and 4-ethylguaiacol.

8. Soy sauce fermented by the Zygosaccharomyces rouxii ZB443 of claim 1 or the method of any one of claims 2 to 7; Preferably, the soy sauce is reduced-salt soy sauce; Preferably, the sodium chloride content in the soy sauce is ≤13.5 g / 100 ml, such as 9-13 g / 100 ml, and further such as ≤13 g / 100 ml, ≤12 g / 100 ml or ≤11 g / 100 ml.

9. Use of the Zygosaccharomyces rouxii ZB443 according to claim 1 in preparing soy sauce or improving the flavor of soy sauce; Preferably, the Zygosaccharomyces rouxii ZB443 is used to increase the content of at least one of the following aroma components in soy sauce: 4-hydroxy-2(5)-ethyl-5(2)-methyl-3(2H)-furanone (HEMF), 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF), 1-octen-3-ol, 3-hydroxy-2-butanone, ethanol, ethyl acetate, and 4-ethylguaiacol.

10. The use according to claim 9, wherein The soy sauce is a reduced-salt soy sauce. Preferably, the sodium chloride content in the soy sauce is ≤13.5 g / 100 ml, such as 9-13 g / 100 ml, and further such as ≤13 g / 100 ml, ≤12 g / 100 ml or ≤11 g / 100 ml.

Images