Herbicide Jinmetolachlor degradation complex microbial inoculant WT1 and application thereof

Abstract

The invention discloses a herbicide metolachlor degradation complex microbial inoculant WT1 and application thereof. Belongs to the technical field of gold metolachlor degradation. The method comprises the following steps: taking a soil sample from a land parcel where Jinmetolal is applied throughout the year, screening out a strain capable of degrading herbicide Jinmetolal, identifying the screened strain through morphology, physiology, biochemistry and molecular biology, then carrying out an antagonism test between strains, and selecting strains without antagonism to construct a compound strain WT1, the strain WT1 is used for carrying out potting control effect tests and field control effect tests on buckwheat seedlings to obtain a Jinmetor degrading strain WT1, the phytotoxicity in the buckwheat seedling stage is relieved, and the Jinmetor degrading strain WT1 is safe to human and livestock and free of pollution to the environment and has good development and application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of pendimethalin degradation, and more specifically, to a compound bacterium agent WT1 for degrading pendimethalin, a herbicide, and its application. Background Art

[0002] Weeds in buckwheat fields are the main factors affecting buckwheat yield. At present, agricultural and mechanical measures cannot be fully utilized for prevention and control, mainly relying on chemical herbicides. However, buckwheat is particularly sensitive to herbicides. When using herbicides for controlling gramineous weeds at the seedling stage, the dosage must be strictly controlled. For broad-leaved weeds in buckwheat fields, there are no available herbicides after emergence, and only individual herbicides in amide herbicides, such as pendimethalin (S - metolachlor), can be used for soil sealing treatment. However, when farmers use it, they often cannot accurately measure the size of the field, accurately weigh the dosage of the medicine and the amount of water used, often resulting in phytotoxicity. There is no research on the prevention and control of herbicide phytotoxicity in buckwheat fields at home and abroad, and there is a lack of measures to solve the problems of buckwheat phytotoxicity and environmental hazards in the planting process.

[0003] The method of using microorganisms such as bacteria and fungi to alleviate herbicide phytotoxicity and degrade herbicides is safe and pollution - free, which is beneficial to improving crop quality, yield and safety. However, at present, the single - strain effect of the strain for degrading pendimethalin is not very ideal, and in the process of screening compound bacterium agents, due to the characteristics of each strain, the combined use effect cannot be predicted. There has been no report on compound bacterium agents for degrading pendimethalin herbicide.

[0004] In summary, how to provide a compound degrading bacterium agent for pendimethalin herbicide to alleviate the phytotoxicity of pendimethalin to buckwheat is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a compound bacterium agent WT1 for degrading pendimethalin, a herbicide, and its application.

[0006] In order to achieve the above purpose, the present invention adopts the following technical scheme:

[0007] A compound bacterium agent WT1 for degrading pendimethalin, a herbicide, comprises Bacillus velezensis WXB10 and Bacillus subtilis TXB2;

[0008] The Bacillus velezensis WXB10 is classified and named as Bacillus velezensis, and was deposited in the China Center for Type Culture Collection on May 19, 2022, with the deposit number CCTCC NO: M 2022680, and the deposit address is Wuhan University, Wuhan, China;

[0009] The Bacillus subtilis TXB2, whose taxonomic name is Bacillus subtilis, was deposited at the China Center for Type Culture Collection on May 19, 2022, with the deposit number CCTCC NO: M 2022679, and the deposit address is Wuhan University, Wuhan, China.

[0010] Furthermore, the viable count ratio of the Bacillus velezensis WXB10 to the Bacillus subtilis TXB2 is 1:1.

[0011] Application of the above-mentioned composite microbial agent WT1 in degrading the herbicide pendimethalin.

[0012] Application of the above-mentioned composite microbial agent WT1 in alleviating pendimethalin phytotoxicity to plants.

[0013] Application of the above-mentioned composite microbial agent WT1 in increasing plant yield and 1000-grain weight.

[0014] It can be seen from the above technical solutions that, compared with the prior art, the beneficial effects achieved by the present invention are as follows:

[0015] In the present invention, soil samples were taken from a plot where pendimethalin had been applied all year round at a depth of 0 - 10 cm from the ground surface, and strains capable of degrading the herbicide pendimethalin were screened out. The screened strains were identified by morphology, physiological and biochemical characteristics, and molecular biology. Then, an antagonism test was carried out among the strains, and a composite bacterial system WT1 was constructed by selecting strains with no antagonistic effect. The pot experiment and field experiment on the control effect of the bacterial system WT1 on buckwheat seedlings were carried out to obtain a pendimethalin-degrading bacterial system WT1, which can alleviate the phytotoxicity of buckwheat seedlings at the seedling stage, is safe for humans and animals, and has no pollution to the environment, showing good development and application prospects. Description of the Drawings

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention, and those of ordinary skill in the art can also obtain other drawings according to the provided drawings without creative efforts.

[0017] Figure 1 It is the result diagram of the plate experiment in Example 2 of the present invention;

[0018] Figure 2 It is the antagonistic effect diagram among strains in Example 3 of the present invention;

[0019] Figure 3 It is the strain morphology diagram of the strains WXB10 and TXB2 in Example 4 of the present invention;

[0020] Figure 4Gram staining diagrams of strains WXB10 and TXB2 in Example 4 of the present invention;

[0021] Figure 5 Phylogenetic tree of strains WXB10 and TXB2 in Example 4 of the present invention. Detailed implementation manners

[0022] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0023] The reagents required for the present invention are conventional experimental reagents and are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be elaborated here one by one.

[0024] The components of the culture media used in the following examples are as follows:

[0025] LB solid medium: 10 g of peptone, 5 g of yeast extract powder, 10 g of NaCl, 15 g of agar, 1000 mL of distilled water.

[0026] LB liquid medium: 10 g of peptone, 5 g of yeast extract powder, 10 g of NaCl, 1000 mL of distilled water.

[0027] PDA medium: 200 g of peeled potatoes, 18 g of agar, 20 g of glucose, 1000 mL of distilled water.

[0028] Basic inorganic salt medium: KH 2 PO 4 1.6 g, K 2 HPO 4 0.52 g, NH 4 NO 3 1.0 g, 0.5 g of NaCl, MgSO 4 ·7H 2 O 0.5 g, 1000 mL of distilled water.

[0029] Basic medium for carbon source determination: KH 2 PO 4 2.38 g, K 2 HPO 4 ·3H 2 O 5.65 g, (NH 4 ) 2 SO 4 2.64 g, MgSO 4 ·7H2 O 1 g, CuSO 4 ·5H 2 O 6.4 mg, ZnSO 4 ·7H 2 O 1.5 mg, FeSO 4 ·7H 2 O 1.1 mg, MnCl 2 ·7H 2 O 7.9 mg, agar 15 g, distilled water 1000 mL.

[0030] Nitrogen source determination basal medium: glucose 10 g, K 2 HPO 4 ·3H 2 O 1 g, MgSO 4 ·7H 2 O 5 g, NaCl 5 g, FeSO 4 ·7H 2 O 10 mg, agar 15 g, distilled water 1000 mL.

[0031] Malonate test medium: sodium malonate 3 g, yeast extract 1 g, NaCl 2 g, (NH 4 ) 2 SO 4 2 g, KH 2 PO 4 0.4 g, K 2 HPO 4 ·3H 2 O 0.6 g, bromothymol blue 25 mg, distilled water 1000 mL, pH 7.4.

[0032] Methyl red test medium: peptone 7.0 g, glucose 5 g, NaCl 5 g, distilled water 1000 mL.

[0033] Starch hydrolysis test medium: soluble starch 2 g, beef extract 3 g, peptone 5 g, glucose 2.5 g, agar 18 g, distilled water 1000 mL, pH 7.0.

[0034] Fat hydrolysis test medium: peptone 10 g, CaCl 2 ·H 2 O 0.1 g, agar 17 g, distilled water 1000 mL, pH 7.4.

[0035] NA medium: beef extract 3 g, peptone 5 g, glucose 2.5 g, agar 18 g, distilled water 1000 mL, pH 7.0.

[0036] Example 1

[0037] Isolation of Strains

[0038] Soil samples were taken from 0 - 10 cm below the surface of the farmland plots in Wuchuan County, Hohhot City, Inner Mongolia and the new campus of Inner Mongolia Agricultural University in Hohhot City, Inner Mongolia. 5 g of soil samples were weighed and placed in a liquid basic inorganic salt culture medium containing 95 mL. Pendimethalin was added as the sole carbon source for microbial growth and utilization, so that the final concentration of pendimethalin was 50 mg / L. The mixture was cultured on a shaker at 150 r / min and 28 °C for 7 days with enrichment culture. Then, 1 mL was transferred to a basic inorganic salt culture medium containing 100 mg / L pendimethalin and cultured for 7 days. Subsequently, 1 mL was transferred to a basic inorganic salt culture medium containing 150 mg / L pendimethalin and cultured for 7 days. By gradually increasing the concentration of pendimethalin, the selection pressure of the herbicide on microorganisms was increased, aiming to isolate and screen highly efficient herbicide-degrading strains. After 21 days of enrichment culture, the basic inorganic salt culture medium was made into 10 -1 、10 -3 、10 -4 、10 -5 different concentrations. 200 μL of the culture medium with different concentrations was respectively spread on PDA and LB media. The 10 -3 concentration culture medium was spread on PDA, and the 10 -4 and 10 -5 concentration culture media were respectively spread on LB for the isolation of fungi and bacteria. This was repeated 3 times. After inoculation, it was placed in an incubator at 25 °C for 2 - 5 days. Different morphological single colonies were picked for purification, numbered, preserved, and reserved for use.

[0039] Example 2

[0040] Primary Screening of Pendimethalin-Degrading Bacteria by Plate Method

[0041] The isolated bacterial strains were secondarily purified on LB medium by the streak plate method, and the fungal strains were secondarily purified on PDA medium by the single spore isolation method. The purified bacterial strains were spread on LB medium by the dilution plating method and cultured for 3 days, while the fungal strains were inoculated on PDA medium and cultured for 5 days. 500 μL of the herbicide pendimethalin was quickly added to 99.5 mL of the basic inorganic salt medium at a temperature of 40 ± 2.5 °C to make the total volume of the solution in the medium 100 mL, and it was immediately mixed evenly. Before the medium solidified, it was poured into glass petri dishes, 20 mL per dish. After the medium solidified in the petri dishes, the 5-mm-diameter bacterial and fungal colonies were inverted and inoculated into the petri dishes. The non-inoculated petri dishes were used as controls. Each treatment was repeated 3 times and cultured at 25 °C. Whether there was a clear zone around the colonies was observed. After 7 days of culture, the diameter of the clear zone was measured to preliminarily determine whether the strains could utilize the herbicide pendimethalin. The results are shown in Table 1, Figure 1 as follows.

[0042] Table 1 Results of Plate Test

[0043]

[0044] After primary screening, 2 strains were obtained, named WXB10 and TXB2 respectively. Transparent circles appeared on the plates for strains WXB10 and TXB2, with the diameters D of the transparent circles being 1.54 cm and 1.35 cm respectively, indicating the ability to utilize the herbicide pendimethalin.

[0045] Example 3

[0046] Construction of the composite bacterial system WT1 and determination of the pendimethalin degradation rate

[0047] Select strains WXB10 and TXB2 screened in the primary screening test on the plate, and judge the compatibility of the strains through the plate antagonism test. Prepare the bacterial strain WXB10 into a bacterial suspension with a concentration of 1×10 8 CFU / mL. Take 200 μL of the test bacterial WXB10 bacterial suspension and spread it on the LB medium, and culture it in a constant temperature incubator at 25 °C for 3 days. Punch the strain TXB2 into a bacterial cake with a diameter of 5 mm, and invert and inoculate the test bacterial cake TXB2 into the petri dish full of the strain WXB10. Set 3 replicates, and observe whether the inoculated bacterial cake can inhibit the growth of the strain in the petri dish and produce a transparent circle after 3 days. The appearance of a transparent circle indicates an antagonistic effect between the two strains. The results are as Figure 2 shown.

[0048] The results showed that there was no transparent circle around the bacterial cake, indicating that there was no antagonism between the strains. Strains WXB10 and TXB2 could be used to construct a composite bacterial system, named WT1.

[0049] Method for determining the pendimethalin degradation rate: Prepare the bacterial solutions of strains WXB10 and TXB2 with a concentration of 1×10 8 CFU / mL respectively. Take equal proportions of each bacterial solution, with a total of 5 mL, and transfer it into 95 mL of basic inorganic salt medium with a pendimethalin concentration of 100 mg / L under aseptic operation. Incubate it in a shaker at 25 °C and 180 r / min under constant temperature for 7 days and 21 days to obtain the test solution. Take 5 mL of the test solution and place it in a 50 mL centrifuge tube, add 5 mL of acetonitrile, shake it on a shaker at 25 °C and 220 r / min for 1 h, add 1 g of NaCl, and shake until obvious liquid stratification can be observed. Then centrifuge at 4000 g for 5 min, use a pipette to aspirate the upper organic liquid, filter the supernatant with a 0.22 μm disposable filter, and measure the degradation rate with a high performance liquid chromatograph after filtration.

[0050] Instrument conditions: The concentration of S-metolachlor in the sample was determined by liquid chromatography. The mobile phase was acetonitrile: ultrapure water (20:80, V / V). The detection wavelength of S-metolachlor was 254 nm, the flow rate was 1.0 mL / min, the injection volume was 5 μL, the column temperature was 25 °C, and the retention time was 8 min. The substance was determined according to its peak time, and the content of S-metolachlor was quantitatively calculated according to its peak area.

[0051]

[0052] The results are shown in Table 2.

[0053] Table 2 Degradation rate results of S-metolachlor by the composite bacterial system

[0054]

[0055] Example 4

[0056] Strain identification and preservation

[0057] (1) Morphological identification

[0058] The strains were spread on LB solid medium by the dilution method to grow single colonies. The single colony of strain WXB10 was milky white, with a dry and rough surface, wrinkles, opaque, and irregular edges. The colony of strain TXB2 was milky white, opaque, with irregular edges, wrinkles, and a depression in the middle ( Figure 3 ).

[0059] (2) Physiological and biochemical identification

[0060] The experiment referred to the "Manual for the Systematic Identification of Common Bacteria" to determine the physiological and biochemical indexes of the strains, such as the utilization of carbon sources, nitrogen sources, malonate, methyl red test, starch hydrolysis, oxidase test, and catalase test. Strain WXB10 was a Gram-positive bacterium ( Figure 4 ), which could use mannitol, fructose, glucose, histidine, ammonium nitrate, and ammonium sulfate as the sole carbon and nitrogen sources, could hydrolyze starch and fat, utilize malonate, and produce catalase. See Table 3 for details. Strain TXB2 was a Gram-positive bacterium ( Figure 4 ), which could decompose starch and fat, could use glucose and mannitol as the sole carbon sources, and ammonium nitrate and ammonium sulfate could be used as the sole nitrogen sources. See Table 4 for details.

[0061] Table 3 Physiological and biochemical characteristics of strain WXB10

[0062]

[0063] Note: "+" indicates positive, and "-" indicates negative.

[0064] Table 4 Physiological and biochemical characteristics of strain TXB2

[0065]

[0066] Note: "+" indicates positive and "-" indicates negative.

[0067] (3) Molecular biological identification

[0068] The DNA extraction was carried out according to the instructions of the TIAN GEN Bacterial Genomic DNA Extraction Kit (centrifugal column type) (Beijing, China), purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. The PCR primers for strains WXB10 and TXB2 were 27F and 1492R, 7F and 1540R, rpoBF and rpoBR, trpBF and trpBR respectively. The primer sequences are shown in Table 5 for details.

[0069] The 25 μL reaction system contained: 17 μL of ddH 2 O, 2.5 μL of 10×PCR Buffer, 2 μL of dNTP, 1 μL of the upstream primer, 1 μL of the downstream primer, 0.5 μL of Taq DNA polymerase, and 1 μL of template DNA. The PCR reaction conditions were: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s; annealing at the annealing temperature for 30 s; extension at 72 °C for 1 min; 34 cycles; and extension at 72 °C for 10 min.

[0070] The PCR products of the 4 genes were detected by 1% agarose gel electrophoresis and sent to Sangon Biotech (Shanghai) Co., Ltd. for 16S rDNA sequencing. The sequencing results are as follows. The 4 gene sequences obtained were spliced, and the splicing results were compared with the Gen Bank nucleic acid database. The strain sequences with higher similarity were selected for analysis, and the phylogenetic tree was constructed using the software MEGA7.0. Strain WXB10 and Bacillus velezensis clustered together, and strain TXB2 and Bacillus subtilis clustered together ( Figure 5 ).

[0071] Table 5 Primers and sequences

[0072]

[0073]

[0074] The amplified sequence of WXB10 is as follows:

[0075] 27F 1492R:

[0076]

[0077] 7F 1540R:

[0078]

[0079] rpoBR rpoBF:

[0080]

[0081] trpBF trpBR:

[0082]

[0083] The TXB2 amplification sequence is as follows:

[0084] 27F 1492R:

[0085]

[0086] 7F 1540R:

[0087]

[0088] rpoBR rpoBF:

[0089]

[0090] trpBF trpBR:

[0091] ATGTACGCCCAATCCAAATGATGCTGGTAAAAAACAGATTTTCCATTGTAACATAAGTTGACAAAAAGAAAAAGGGAAGCAGCCAAACGGCTATTTCCCCTTTTTTATAGTGATGCTTTCAAAATTGACAGCACATCTTCTTTGTTGAGTGATTTAAATTGGCCGAATGTACCGTTAGCCATTGCCTTGTCAGCAATTGTGTCAAGCTGCTCATCATTAATATCATAATCAGCAAGACGGTTCGGAGCGCCAAGGCTTGTCCAGAATGCGGACAGCTTATCGATACCTTCAAGGGCAATTTCTTCATCCGTTTTACCTGCTTCTTCAACATCAAACACGCGAACTGCAAGCTGTTTCATGCGGGCAGGGTTTTCAGACAATGTGTGTCTCATCCAGTTCGGGAACAAAATTGCCAGTCCGCCGGCATGCGGAATATCATAAACGGCTGATACTGCATGTTCAATATGTGAGTGCCACAA, SEQ ID NO.16.

[0092] Based on the results of comprehensive morphological, physiological and biochemical tests and molecular biological identification, strain WXB10 was identified as Bacillus velezensis, and strain TXB2 was identified as Bacillus subtilis.

[0093] (4) Preservation

[0094] The said Bacillus velezensis was named WXB10, and its taxonomic name is Bacillus velezensis. It was preserved in the China Center for Type Culture Collection on May 19, 2022, with the preservation number CCTCC NO: M 2022680, and the preservation address is Wuhan University, Wuhan, China.

[0095] The said Bacillus subtilis was named TXB2, and its taxonomic name is Bacillus subtilis. It was preserved in the China Center for Type Culture Collection on May 19, 2022, with the preservation number CCTCC NO: M 2022679, and the preservation address is Wuhan University, Wuhan, China.

[0096] Example 5

[0097] Mitigation Effect of Compound Bacterial Agent WT1 on Pendimethalin Phytotoxicity in Pot Experiments

[0098] Compound bacterial agent WT1 was used for seed dressing of buckwheat, and then herbicides with different concentrations were sprayed. The degradation effect of compound bacterial agent WT1 on pendimethalin and the mitigation effect of phytotoxicity were analyzed through the change of phytotoxicity index.

[0099] The isolated bacterial strains were cultured in LB liquid medium in a shaker at 25 °C and 180 r / min, and diluted to 1×10 8 CFU / mL to prepare the bacterial agent; compound bacterial agent WT1 was prepared by mixing the components of each single-bacterial agent in equal proportion. For buckwheat seed dressing, 20 mL of compound bacterial agent was added to every 20 g of seeds and stirred evenly, and then placed in a cool and dry place to dry for later use.

[0100] A total of two pot experiments were carried out: using sterilized soil (July 2023) and unsterilized soil (December 2023) for the experiments respectively.

[0101] For the first pot experiment, soil samples were taken from the farm of Inner Mongolia Agricultural University, sterilized at 180 °C for 2 h in an oven, and then mixed evenly with vermiculite at a volume ratio of 2:1 for use; for the second pot experiment, the soil from the new area farm of Inner Mongolia Agricultural University was taken directly without sterilization, and the rest was the same as the first pot experiment.

[0102] Each treatment was set with 6 herbicide concentrations of 0, 80, 100, 120, 140, 160 mL / 667m 2 and 3 replicates were set.

[0103] After sowing, the soil was covered with 2 - 3 cm. The soil surface area was calculated through the soil diameter in different flowerpots. According to 60 kg of water consumption per 667m 2 and 6 different application concentrations of 0, 80, 100, 120, 140, 160 mL / 667m 2 of pendimethalin, the water consumption and application rate in the flowerpots were calculated proportionally according to the soil surface area in the flowerpots, and then the herbicide pendimethalin was sprayed immediately. 10 days after sowing, the phytotoxicity level was investigated according to the phytotoxicity grading standard (Table 6), and the phytotoxicity index and the ratio of mitigating phytotoxicity were calculated.

[0104] Table 6 Phytotoxicity Grading Standard of Buckwheat Herbicide Pendimethalin

[0105]

[0106] Note: When investigating, record the number of damaged buckwheat seedlings and the damage level, and calculate the phytotoxicity index and the control effect of phytotoxicity.

[0107]

[0108] The results are shown in Tables 7, 8, 9, and 10.

[0109] Table 7 Phytotoxicity index of buckwheat after seed dressing with compound microbial agent and spraying pendimethalin (July 2023, soil sterilized)

[0110]

[0111] Table 8 Ratio of reduction in phytotoxicity of buckwheat after spraying pendimethalin with compound microbial agent seed dressing (%) (July 2023, soil sterilized)

[0112]

[0113] Table 9 Phytotoxicity index of buckwheat after seed dressing with compound microbial agent and spraying pendimethalin (December 2023, soil not sterilized)

[0114]

[0115] Table 10 Ratio of reduction in phytotoxicity of buckwheat after spraying pendimethalin with compound microbial agent seed dressing (%) (December 2023, soil not sterilized)

[0116]

[0117] As can be seen from Tables 7 and 8, under the condition of soil sterilization, when applying herbicides at 80, 100, 120, 140, 160 mL / 667 m 2 the compound microbial agent WT1 can alleviate the phytotoxicity of pendimethalin to buckwheat. Among them, when the herbicide dosage is 80 mL / 667 m 2 the alleviating effect is the best, and the reduction ratio is 63.0%. As can be seen from Tables 9 and 10, when applying herbicides at 80, 100, 120, 140, 160 mL / 667 m 2 under the condition of non-sterilized soil, the compound microbial agent WT1 can alleviate the phytotoxicity of pendimethalin to buckwheat. Among them, when the herbicide dosage is 80 mL / 667 m 2 the alleviating effect is the best, and the reduction ratio is 83.3%. Followed by 120 mL / 667 m 2 with a reduction ratio of 59.4%.

[0118] Example 6

[0119] Alleviating effect of compound microbial agent WT1 on pendimethalin phytotoxicity in field trials

[0120] Buckwheat was dressed with compound microbial agent WT1 and then sprayed with herbicides at different concentrations. The degradation effect of compound microbial agent WT1 on pendimethalin and the alleviating effect on phytotoxicity were analyzed through the change of phytotoxicity index.

[0121] The test site was set at the teaching base of Inner Mongolia Agricultural University in Hailiutu, Tumd Left Banner, Hohhot, Inner Mongolia. In the test, 6 concentrations of the herbicide S-metolachlor, namely 0, 80, 100, 120, 140, and 160 mL / 667m 2 were set for each treatment, and there were 3 replicates. The pretreatment method of seed dressing with the compound microbial agent was the same as that in Example 5.

[0122] The seeds were sown on July 20, 2023, with a row spacing of 40 cm. A furrow with a depth of 4 - 5 cm was opened with a furrow opener. The seeds dressed with the compound microbial agent were sown and immediately covered with soil, and then different concentrations of the soil-sealing herbicide S-metolachlor were applied immediately. The herbicide was diluted according to 60 kg of water consumption per 667m 2 and 6 different application concentrations of 0, 80, 100, 120, 140, and 160 mL / 667m 2 were used. 15 days after sowing, the phytotoxicity level was investigated according to the phytotoxicity grading standard (Table 6), and the phytotoxicity index and the ratio of reducing phytotoxicity were calculated. The calculation formulas were the same as those in Example 5.

[0123] The effect of the compound microbial agent WT1 on alleviating the phytotoxicity of buckwheat seedlings can be seen in Table 11 and Table 12.

[0124] Table 11 Phytotoxicity index of buckwheat after spraying S-metolachlor with the compound microbial agent in the field experiment

[0125]

[0126] Table 12 Effect of the compound microbial agent on reducing the phytotoxicity of buckwheat after spraying S-metolachlor in the field experiment (%)

[0127]

[0128] As can be seen from Table 11 and Table 12, in the field experiment, when the herbicide was applied at 80, 100, 120, 140, and 160 mL / 667m 2 , the compound microbial agent WT1 could alleviate the phytotoxicity of S-metolachlor to buckwheat. Among them, when the herbicide dosage was 120 mL / 667m 2 , the alleviating effect was the best, and the reducing ratio was 73.9%. Followed by 80 mL / 667m 2 , and the reducing ratio was 47.2%.

[0129] Example 7

[0130] Effect of the compound microbial agent WT1 on increasing the yield and 1000-grain weight of buckwheat in the field experiment

[0131] Buckwheat seeds were dressed with the compound microbial agent WT1, and then different concentrations of herbicides were sprayed. The yield-increasing effect of the compound microbial agent WT1 was analyzed through the changes in yield and 1000-grain weight.

[0132] The test site was set at the teaching base of Inner Mongolia Agricultural University in Hailiutu, Tumd Left Banner, Hohhot, Inner Mongolia. In the test, each treatment had 6 concentrations of the herbicide S-metolachlor, namely 0, 80, 100, 120, 140, 160 mL / 667m 2 6, and one manual weeding control, with 3 replicates. The pretreatment method of seed dressing with the compound microbial agent was the same as that in Example 5.

[0133] Sowing was carried out on July 20, 2023, with a row spacing of 40 cm. A furrow with a depth of 4 - 5 cm was opened with a furrow opener, and the seeds dressed with the compound microbial agent were sown and immediately covered with soil, and then different concentrations of the soil-sealing herbicide S-metolachlor were immediately applied. The herbicide was diluted according to 60 kg of water consumption per 667m 2 60 kg of water consumption, and the herbicide concentrations were 0, 80, 100, 120, 140, 160 mL / 667m 2 6 different application concentrations. After harvesting, the yield and 1000-grain weight were measured. The yield increase effect of the compound microbial agent WT1 is shown in Table 13 and Table 14.

[0134] Table 13 Effects of seed dressing with compound microbial agent on buckwheat yield after spraying S-metolachlor in field trials (kg / 667m 2 )

[0135]

[0136] Table 14 Effects of seed dressing with compound microbial agent on 1000-grain weight of buckwheat after spraying S-metolachlor in field trials (g)

[0137]

[0138] As can be seen from Table 13, the yield of applying the compound microbial system WT1 at each herbicide concentration was higher than that of the non-application microbial agent CK. When applying the compound microbial system WT1, at the S-metolachlor concentrations of 80 and 100 mL / 667m 2 , the yields were 88.9 kg / 667m 2 and 88.2 kg / 667m 2 , respectively, and there was no significant difference from the manual weeding control of 87.8 kg / 667m 2 , indicating that the compound microbial system WT1 did not reduce the yield at the concentrations of 80 and 100 mL / 667m 2 . As can be seen from Table 14, in the non-application microbial agent CK, when the S-metolachlor dosage was 80 mL / 667m 2 , the 1000-grain weight was 22.2 g, and there was no significant difference from the 1000-grain weight of the manual weeding control of 22.6 g, indicating that when the S-metolachlor dosage was 80 mL / 667m 2 , it was safe for buckwheat and did not reduce the 1000-grain weight. When the S-metolachlor dosage was greater than 80 mL / 667m 2 , the 1000-grain weight was significantly lower than that of the manual weeding control, indicating that when it was greater than 80 mL / 667m2 The application rate of the herbicide will reduce the 1000-grain weight of buckwheat. When applying the composite bacterial strain WT1, when the application rate of Jinduer is greater than 100 mL / 667 m 2 , the 1000-grain weight is significantly lower than that of other herbicide concentrations, indicating that when it is greater than 100 mL / 667 m 2 , the ability of the composite bacterial strain WT1 to alleviate the reduction of 1000-grain weight caused by the herbicide decreases.

[0139] In this specification, the various embodiments are described in a progressive manner. The key point of each embodiment is to illustrate the differences from other embodiments. The same or similar parts among the various embodiments can be referred to each other.

[0140] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but will be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A herbicide Jindul degradation composite bacterial agent WT1, characterized in that: These include Bacillus velez WXB10 and Bacillus subtilis TXB2; The Bacillus velezensis WXB10 is classified as Bacillus velezensis and was deposited in China Center for Type Culture Collection on May 19, 2022, with a deposit number of CCTCC NO: M 2022680. The deposit address is Wuhan University, Wuhan, China. The Bacillus subtilis TXB2 is classified and named Bacillus subtilis, and was deposited in the China Center for Type Culture Collection on May 19, 2022, with a deposit number of CCTCC NO: M 2022679, and the deposit address is Wuhan University, Wuhan, China.

2. The composite bacterial agent WT1 according to claim 1, characterized in that The ratio of the number of live bacteria of the Bacillus Velez WXB10 and the Bacillus subtilis TXB2 is 1:

1.

3. Use of the composite bacterial agent WT1 according to any one of claims 1 or 2 in degrading the herbicide Jindul.

4. Use of the composite bacterial agent WT1 according to any one of claims 1 or 2 in alleviating Jindul phytotoxicity in plants.

5. Use of the composite bacterial agent WT1 according to any one of claims 1 or 2 in increasing plant yield and thousand-grain weight.

Images