Jinmetolachlor degrading bacterium DH3 and application thereof
By screening and identifying Serratia marzipan DH3, this strain can efficiently degrade Jinduer, solve the problem of Jinduer's drug damage in buckwheat fields, achieve the improvement of buckwheat yield and 1,000-particle weight, and is pollution-free to the environment.
Patent Information
- Application Number
- CN202510233812.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art has failed to effectively solve the problem of the herbicide Jinduer on buckwheat in buckwheat fields, and there is a lack of effective degradation measures for such drug damage.
By screening and identifying a strain of Serratia marigold DH3, this strain can efficiently degrade Jinduer and is used to prepare herbicide Jinduer degrading bacteria agents to alleviate buckwheat drug damage.
The degradation rate of strain DH3 in degradation of Jinduer reached 28.41%~38.14%, effectively alleviating Jinduer's drug damage to buckwheat, increasing crop yield and 1,000 grain weight, and without pollution to the environment.
Smart Images
Figure CN120060042A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of pendimethalin degradation, and more particularly to a pendimethalin-degrading bacterium DH3 and its application. Background Art
[0002] Weeds in buckwheat fields are the main factors affecting buckwheat yield. At present, agricultural and mechanical measures cannot be fully utilized for prevention and control, and mainly rely on chemical herbicides. However, buckwheat is particularly sensitive to herbicides. When using herbicides for controlling gramineous weeds at the seedling stage, the dosage must be strictly controlled. For broad-leaved weeds in buckwheat fields, there are no available herbicides after emergence, and only individual herbicides in amide herbicides, such as pendimethalin (S - metolachlor), can be used for soil sealing treatment. However, when farmers use it, they often cannot accurately measure the size of the field, accurately weigh the dosage of the drug and the amount of water used, which often leads to phytotoxicity. There is no research on the prevention and control of herbicide phytotoxicity in buckwheat fields at home and abroad, and there is a lack of measures to solve the problems of buckwheat phytotoxicity and environmental hazards in the planting process.
[0003] The method of using microorganisms such as bacteria and fungi to alleviate herbicide phytotoxicity and degrade herbicides is safe and pollution-free, which is beneficial to improving crop quality, yield and safety. However, at present, strains for degrading the herbicide pendimethalin have not been reported.
[0004] In summary, how to provide a bacterium for degrading the herbicide pendimethalin to alleviate the phytotoxicity of pendimethalin to buckwheat is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0005] In view of this, the present invention provides a pendimethalin-degrading bacterium DH3 and its application.
[0006] The present invention takes soil samples from 0 - 10 cm above the ground surface of a plot where pendimethalin has been applied all year round, and places the bacterial cake of the strain upside down on a basic inorganic salt solid medium with pendimethalin as the sole carbon source. The microorganisms in the soil are preliminarily screened by observing whether a transparent circle can appear around the bacterial cake, and the strains are re-screened by measuring the degradation rate through liquid chromatography. The screened strains are identified by morphology, physiological and biochemical characteristics and molecular biology, and a pendimethalin-degrading bacterium, Serratia marcescens, is obtained. And the strain DH3 is subjected to pot control efficacy tests and field control efficacy tests on buckwheat seedlings.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] A strain of Serratia marcescens DH3, named DH3, with the taxonomic name Serratia marcescens, was deposited at the China Center for Type Culture Collection on July 1, 2024, with the deposit number CCTCC NO: M 20241437 and the deposit address being Wuhan University, Wuhan, China.
[0009] The above-mentioned Serratia marcescens DH3 is used for degrading the herbicide pendimethalin.
[0010] The above-mentioned Serratia marcescens DH3 is used for preparing a pendimethalin-degrading microbial agent.
[0011] The above-mentioned Serratia marcescens DH3 is used for increasing the yield and 1000-grain weight of buckwheat.
[0012] A pendimethalin-degrading microbial agent, comprising the above-mentioned Serratia marcescens DH3.
[0013] A method for degrading pendimethalin in soil, by applying the above-mentioned Serratia marcescens DH3.
[0014] It can be seen from the above technical solutions that, compared with the prior art, the beneficial effects achieved by the present invention are as follows:
[0015] The pendimethalin-degrading bacterium of the present invention is Serratia marcescens DH3. Using strain DH3 to degrade pendimethalin in the medium for 7 days, the degradation rate is 28.41%, and degrading pendimethalin in the medium for 21 days, the degradation rate is 38.14%. The Serratia marcescens DH3 provided by the present invention is used for rapid degradation of pendimethalin, alleviating the phytotoxicity of buckwheat seedlings at the seedling stage, being safe for humans and animals, and having no pollution to the environment, and has good development and application prospects. Description of the Drawings
[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained according to the provided drawings.
[0017] Figure 1 It is the result diagram of the plate test in Example 2 of the present invention;
[0018] Figure 2 It is the strain morphology diagram of strain DH3 in Example 4 of the present invention;
[0019] Figure 3Gram staining diagram of strain DH3 in Example 4 of the present invention;
[0020] Figure 4 Phylogenetic tree of strain DH3 in Example 4 of the present invention. Detailed implementation manners
[0021] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0022] The reagents required for the present invention are conventional experimental reagents and are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be elaborated here one by one.
[0023] The components of the culture media used in the following examples are as follows:
[0024] LB solid medium: 10 g of peptone, 5 g of yeast extract powder, 10 g of NaCl, 15 g of agar, 1000 mL of distilled water.
[0025] LB liquid medium: 10 g of peptone, 5 g of yeast extract powder, 10 g of NaCl, 1000 mL of distilled water.
[0026] PDA medium: 200 g of peeled potatoes, 18 g of agar, 20 g of glucose, 1000 mL of distilled water.
[0027] Basic inorganic salt medium: KH 2 PO 4 1.6 g, K 2 HPO 4 0.52 g, NH 4 NO 3 1.0 g, 0.5 g of NaCl, MgSO 4 ·7H 2 O 0.5 g, 1000 mL of distilled water.
[0028] Basic medium for carbon source determination: KH 2 PO 4 2.38 g, K 2 HPO 4 ·3H 2 O 5.65 g, (NH 4 ) 2 SO 4 2.64 g, MgSO 4 ·7H 2O 1g, CuSO 4 ·5H 2 O 6.4mg, ZnSO 4 ·7H 2 O 1.5mg, FeSO 4 ·7H 2 O 1.1mg, MnCl 2 ·7H 2 O 7.9mg, agar 15g, distilled water 1000 mL.
[0029] Nitrogen source determination basal medium: glucose 10g, K 2 HPO 4 ·3H 2 O 1g, MgSO 4 ·7H 2 O 5g, NaCl 5g, FeSO 4 ·7H 2 O 10mg, agar 15g, distilled water 1000 mL.
[0030] Malonate test medium: sodium malonate 3g, yeast extract 1g, NaCl 2g, (NH 4 ) 2 SO 4 2 g, KH 2 PO 4 0.4g, K 2 HPO 4 ·3H 2 O 0.6g, bromothymol blue 25mg, distilled water 1000 mL, pH 7.4.
[0031] Methyl red test medium: peptone 7.0g, glucose 5g, NaCl 5g, distilled water 1000 mL.
[0032] Starch hydrolysis test medium: soluble starch 2g, beef extract 3g, peptone 5g, glucose 2.5g, agar 18g, distilled water 1000 mL, pH 7.0.
[0033] Fat hydrolysis test medium: peptone 10g, CaCl 2 ·2H 2 O 0.1g, agar 17g, distilled water 1000 mL, pH 7.4.
[0034] NA medium: beef extract 3g, peptone 5g, glucose 2.5g, agar 18g, distilled water 1000 mL, pH 7.0.
[0035] Example 1
[0036] Isolation and screening of strains
[0037] Soil samples were taken from a plot in Longmen Town, Ding'an County, Hainan Province, at a depth of 0 - 10 cm from the ground surface. 5 g of soil samples were weighed and placed in a liquid basal inorganic salt culture medium containing 95 mL. Pendimethalin was added as the sole carbon source for microbial growth and utilization, so that the final concentration of pendimethalin was 50 mg / L. The mixture was cultured on a shaker at 150 r / min and 28 °C for 7 days. Then, 1 mL was transferred to a basal inorganic salt culture medium containing 100 mg / L pendimethalin and cultured for 7 days. Subsequently, 1 mL was transferred again to a basal inorganic salt culture medium containing 150 mg / L pendimethalin and cultured for 7 days. By gradually increasing the concentration of pendimethalin, the selection pressure of the herbicide on microorganisms was increased, aiming to isolate and screen highly efficient herbicide-degrading strains. After 21 days of enrichment culture, the basal inorganic salt culture medium was made into 10 -1 、10 -3 、10 -4 、10 -5 different concentrations. 200 μL of the culture medium with different concentrations was respectively spread on PDA and LB media. The culture medium with a concentration of 10 -3 was spread on PDA, and the culture media with concentrations of 10 -4 and 10 -5 were respectively spread on LB for the isolation of fungi and bacteria. This was repeated 3 times. After inoculation, it was placed in an incubator at 25 °C for 2 - 5 days. Different morphological single colonies were picked for purification, numbered, stored, and reserved for use.
[0038] Example 2
[0039] Primary screening of pendimethalin-degrading bacteria by plate method
[0040] The isolated bacterial strains were secondarily purified on LB medium by the streak plate method, and the fungal strains were secondarily purified on PDA medium by the single spore isolation method. The purified bacterial strains were spread on LB medium by the dilution plating method and cultured for 3 days, and the fungal strains were inoculated on PDA medium and cultured for 5 days. 500 μL of the herbicide pendimethalin was quickly added to 99.5 mL of the basal inorganic salt medium at a temperature of 40 ± 2.5 °C to make the total volume of the solution in the medium 100 mL, and immediately mixed evenly. Before the medium solidified, it was poured into glass petri dishes, 20 mL per dish. After the medium solidified in the petri dishes, bacterial and fungal agar discs with a diameter of 5 mm were inverted and inoculated into the petri dishes. The non-inoculated petri dishes were used as controls. Each treatment was repeated 3 times and cultured at 25 °C. Whether there was a clear zone around the agar discs was observed. After 7 days of culture, the diameter of the clear zone was measured to preliminarily determine whether the strains could utilize the herbicide pendimethalin. The results are shown in Table 1, Figure 1 as follows.
[0041] Table 1 Results of plate test
[0042]
[0043] After primary screening, 1 strain was obtained and named DH3. The strain DH3 showed a clear zone on the plate, with the diameter D of the clear zone being 1.39 cm, indicating its ability to utilize the herbicide S-metolachlor.
[0044] Example 3
[0045] Determination of the degradation rate of S-metolachlor by strain DH3
[0046] Method for determining the degradation rate of S-metolachlor: Take 5 mL of the test bacterial liquid with a concentration of 1×10 8 CFU / mL, transfer it into 95 mL of the basic inorganic salt medium with a S-metolachlor concentration of 100 mg / L under aseptic conditions, and incubate it at a constant temperature in a shaker at 25°C and 180 r / min for 7 d and 21 d to obtain the test solution. Take 5 mL of the test solution and place it in a 50 mL centrifuge tube, add 5 mL of acetonitrile, shake it on a shaker at 25°C and 220 r / min for 1 h, add 1 g of NaCl, and shake until obvious liquid stratification can be observed. Then centrifuge it at 4000 g for 5 min, aspirate the upper organic liquid with a pipette, filter it through a 0.22 μm disposable filter, and determine the degradation rate with a high performance liquid chromatograph after filtration.
[0047] Instrument conditions: The concentration of S-isopropyl metolachlor in the sample was determined by liquid chromatography. The mobile phase was acetonitrile: ultrapure water (20:80, V / V), the detection wavelength of S-isopropyl metolachlor was 254 nm, the flow rate was 1.0 mL / min, the injection volume was 5 μL, the column temperature was 25°C, and the retention time was 8 min. The substance was determined according to its elution time, and the content of S-isopropyl metolachlor was quantitatively calculated according to its peak area.
[0048]
[0049] The results are shown in Table 2.
[0050] Table 2 Degradation rate results of the isolated strain on S-isopropyl metolachlor
[0051]
[0052] Example 4
[0053] Identification and preservation of strain DH3
[0054] (1) Morphological identification
[0055] The strain was spread on the LB solid medium by the dilution method to grow single colonies, as Figure 2 shown. The colonies of strain DH3 were round and raised, opaque in the center, irregular at the edges, with a size of 1 - 2.5 mm, and all produced red pigments.
[0056] (2) Physiological and biochemical identification
[0057] The experiment referred to the Manual for the Systematic Identification of Common Bacteria to determine the physiological and biochemical indexes of strain DH3, such as the utilization of carbon sources, nitrogen sources, the utilization of malonate, methyl red test, starch hydrolysis, oxidase test, and catalase test. Strain DH3 is a Gram-negative bacterium ( Figure 3 ), which can utilize mannitol, fructose, maltose, glucose, sucrose, histidine, sodium nitrate, and ammonium nitrate as the sole carbon and nitrogen sources, can hydrolyze starch and fat, utilize malonate, produce oxidase and catalase, as shown in Table 3 for details.
[0058] Table 3 Physiological and Biochemical Characteristics of Strain DH3
[0059]
[0060] Note: "+" indicates positive, and "-" indicates negative.
[0061] (3) Molecular Biology Identification
[0062] The DNA extraction was carried out according to the instructions of the TIAN GEN Bacterial Genomic DNA Extraction Kit (centrifugal column type) (Beijing, China), which was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. The PCR primers for strain DH3 were 27F and 1492R, 7F and 1540R, dh3AF and dh3AR, dh3BF and dh3BR, and the primer sequences are shown in Table 4 for details.
[0063] The 25 μL reaction system contained: 17 μL of ddH 2 O, 2.5 μL of 10×PCR Buffer, 2 μL of dNTP, 1 μL of the upstream primer, 1 μL of the downstream primer, 0.5 μL of Taq DNA polymerase, and 1 μL of template DNA. The PCR reaction conditions were: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s; annealing at the annealing temperature for 30 s; extension at 72 °C for 1 min; 34 cycles; and extension at 72 °C for 10 min.
[0064] The PCR products of the 4 genes were detected by 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for 16S rDNA sequencing, and the sequencing results were as follows. The 4 gene sequences obtained were spliced, the splicing results were compared with the Gen Bank nucleic acid database, and the phylogenetic tree was constructed using the software MEGA7.0. Strain DH3 and Serratia marcescens (accession number: NR102509) were clustered together ( Figure 4 ).
[0065] Table 4 Primers and Sequences
[0066]
[0067] 27F 1492R:
[0068]
[0069] 7F 1540R
[0070]
[0071] dh3AF dh3AR
[0072] TTAGCACAAAGGGGAGCTTGCTCCCTGGGTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGTGGTGAACTTAATACGTTCATCAATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGA, SEQ ID NO.11。
[0073] dh3BF dh3BR
[0074] TTTTAGCACAAAGGGGAGCTTGCTCCCTGGGTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGTGGTGAACTTAATACGTTCATCAATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGAGAAGATCTGGAAA, SEQ ID NO.12。
[0075] Based on the results of comprehensive morphological, physiological and biochemical tests and molecular biological identification, the strain DH3 was identified as Serratia marcescens.
[0076] (4) Preservation
[0077] The said Serratia marcescens was named DH3, and its taxonomic name was Serratia marcescens. It was preserved in the China Center for Type Culture Collection on July 1, 2024, with the preservation number CCTCC NO: M20241437, and the preservation address was Wuhan University, Wuhan, China.
[0078] Example 5
[0079] Mitigation effect of strain DH3 on the phytotoxicity of pendimethalin in pot experiments
[0080] Use strain DH3 to dress the seeds of buckwheat, and then spray herbicides at different concentrations. Analyze the effects of strain DH3 on degrading pendimethalin and alleviating phytotoxicity through the change of phytotoxicity index.
[0081] Cultivate strain DH3 in LB liquid medium in a shaker at 25 °C and 180 r / min, and dilute it to 1×10 8 CFU / mL to make a bacterial agent; for seed dressing of buckwheat, add 20 mL of the bacterial agent to every 20 g of seeds, stir evenly, and place it in a cool and dry place to dry for later use.
[0082] There are two pot experiments in total: conduct experiments with sterilized soil (July 2023) and unsterilized soil (December 2023) respectively.
[0083] For the first pot experiment, take soil samples from the farm of Inner Mongolia Agricultural University, sterilize them at 180 °C for 2 h in an oven, and mix them evenly with vermiculite at a volume ratio of 2:1 for use; for the second pot experiment, take the soil from the new area farm of Inner Mongolia Agricultural University without sterilization and use it directly, and the rest is the same as the first pot experiment.
[0084] Set 6 herbicide concentrations of 0, 80, 100, 120, 140, and 160 mL / 667m 2 for each treatment, and set 3 replicates.
[0085] After sowing, cover the soil with 2 - 3 cm. Calculate the soil surface area through the soil diameter in different flowerpots, and calculate the water consumption and herbicide application amount in the flowerpots according to the water consumption of 60 kg per 667m 2 and 6 different application concentrations of 0, 80, 100, 120, 140, and 160 mL / 667m 2 of pendimethalin. Then randomly spray the herbicide pendimethalin. 10 days after sowing, investigate the phytotoxicity level according to the phytotoxicity grading standard (Table 5), and calculate the phytotoxicity index and the ratio of alleviating phytotoxicity.
[0086] Table 5 Phytotoxicity grading standard of buckwheat herbicide pendimethalin
[0087]
[0088] Note: Record the number of damaged buckwheat seedlings and the damage level during the investigation, and calculate the phytotoxicity index and the phytotoxicity control effect.
[0089]
[0090] The results are shown in Tables 6, 7, 8, and 9.
[0091] Table 6 Phytotoxicity index of buckwheat after spraying pendimethalin with strain seed dressing (July 2023, soil sterilized)
[0092]
[0093] Table 7 Ratio of reduction in phytotoxicity of buckwheat after seed dressing with strains and spraying of S-metolachlor (%) (July 2023, soil sterilized)
[0094]
[0095] Table 8 Phytotoxicity index of buckwheat after seed dressing with strains and spraying of S-metolachlor (December 2023, soil not sterilized)
[0096]
[0097] Table 9 Ratio of reduction in phytotoxicity of buckwheat after seed dressing with strains and spraying of S-metolachlor (%) (December 2023, soil not sterilized)
[0098]
[0099] As can be seen from Table 6 and Table 7, in the case of soil sterilization, when applying herbicides at 80, 100, 120, 140, 160 mL / 667 m 2 the strain DH3 could alleviate the phytotoxicity of S-metolachlor to buckwheat. Among them, when the herbicide dosage was 80 mL / 667 m 2 the effect was the best, with a reduction ratio of 55.9%. Followed by 100 mL / 667 m 2 and 140 mL / 667 m 2 with reduction ratios of 49.8% and 44.7% respectively. As can be seen from Table 8 and Table 9, when applying herbicides at 80, 100, 120, 140, 160 mL / 667 m 2 in the case of non-sterilized soil, the strain DH3 could alleviate the phytotoxicity of S-metolachlor to buckwheat, and there was no horizontal difference.
[0100] Example 6
[0101] Effect of strain DH3 on alleviating phytotoxicity of S-metolachlor in field trials
[0102] Buckwheat was dressed with strain DH3 and then sprayed with herbicides at different concentrations. The effects of strain DH3 on degrading S-metolachlor and alleviating phytotoxicity were analyzed through changes in the phytotoxicity index.
[0103] The test site was set at the teaching base of Inner Mongolia Agricultural University in Hailiutu, Tumd Left Banner, Hohhot, Inner Mongolia. In the test, each treatment was set with 6 concentrations of the herbicide S-metolachlor at 0, 80, 100, 120, 140, 160 mL / 667 m 2 and there were 3 replicates. The pretreatment method of seed dressing with the bacterial solution was the same as in Example 5.
[0104] Sown on July 20, 2023, with a row spacing of 40 cm, use a furrow opener to open a ridge furrow with a depth of 4 - 5 cm, sow the seeds mixed with the bacterial solution and immediately cover the soil, then immediately apply the soil - closed herbicide Jinduer at different concentrations. The herbicide is diluted according to 60 kg of water consumption per 667 m 2 and 0, 80, 100, 120, 140, 160 mL / 667 m of herbicide 2 for 6 different application concentrations. 15 days after sowing, investigate the phytotoxicity level according to the phytotoxicity grading standard (Table 5), calculate the phytotoxicity index and the ratio of reducing phytotoxicity. The calculation formulas are the same as those in Example 5.
[0105] The effects of strain DH3 on alleviating the phytotoxicity of buckwheat seedlings can be seen in Tables 10 and 11.
[0106] Table 10 Phytotoxicity index of buckwheat after spraying Jinduer with strain - treated seeds in field trials
[0107]
[0108] Table 11 Effect of strain - treated seeds on reducing the phytotoxicity of buckwheat after spraying Jinduer in field trials (%)
[0109]
[0110] As can be seen from Tables 10 and 11, in the field trials, when applying 80, 100, 120, 140, 160 mL / 667 m of herbicide 2 , strain DH3 can alleviate the phytotoxicity of Jinduer to buckwheat. Among them, when the herbicide dosage is 80 mL / 667 m 2 and 140 mL / 667 m 2 , the effects are the best, and the reduction ratios are 50% and 44.9% respectively. Followed by 100 mL / 667 m 2 , with a reduction ratio of 34.7%.
[0111] Example 7
[0112] Effect of strain DH3 on improving the yield and 1000 - grain weight of buckwheat in field trials
[0113] Buckwheat seeds were treated with strain DH3 and then sprayed with herbicides at different concentrations to analyze the yield - increasing effect of the isolated strain through yield and 1000 - grain weight analysis.
[0114] The test site was set at the teaching base of Inner Mongolia Agricultural University in Hailiutu, Tumd Left Banner, Hohhot, Inner Mongolia. In the test, each treatment had 6 concentrations of the herbicide Jinduer at 0, 80, 100, 120, 140, 160 mL / 667 m 2 and an artificial weeding control, with 3 replicates. The pretreatment method of mixing the seeds with the bacterial solution was the same as that in Example 5.
[0115] Sown on July 20, 2023, with a row spacing of 40 cm, use a furrow opener to open furrows with a depth of 4 - 5 cm, sow the seeds mixed with the bacterial liquid and immediately cover the soil, then immediately apply the soil - closed herbicide Jinduer at different concentrations. The herbicide is diluted according to 60 kg of water consumption per 667 m 2 and the herbicide dosages are 0, 80, 100, 120, 140, 160 mL / 667 m 2 for 6 different application concentrations. After harvest, measure the yield and 1000 - grain weight. The yield - increasing effect of strain DH3 is shown in Tables 12 and 13.
[0116] Table 12 Effects of strain seed dressing on buckwheat yield after spraying Jinduer in field trials (kg / 667 m 2 )
[0117]
[0118] Table 13 Effects of strain seed dressing on buckwheat 1000 - grain weight after spraying Jinduer in field trials (g)
[0119]
[0120] As can be seen from Table 12, when no microbial agent (CK) is applied, when the dosage of the herbicide Jinduer is 100 mL / 667 m 2 , the yield has no obvious difference from that of the manual weeding control. When it is greater than 100 mL / 667 m 2 , the yield decreases significantly. When the microbial agent DH3 is applied, when the dosages of the herbicide Jinduer are 80, 100, 120 mL, 140 mL / 667 m 2 , there is no obvious difference from the manual weeding control. When it is greater than 140 mL / 667 m 2 , the yield decreases significantly. And when the microbial agent DH3 is applied, it is greater than CK at each herbicide dosage, indicating that the microbial agent DH3 can increase the buckwheat yield. As can be seen from Table 13, when no microbial agent (CK) is used and the dosage of the herbicide Jinduer is 80 mL / 667 m 2 , the 1000 - grain weight is 22.2 g, which has no significant difference from the 1000 - grain weight of 22.6 g of the manual weeding control, indicating that when the dosage of Jinduer is 80 mL / 667 m 2 , it is safe for buckwheat and does not reduce the 1000 - grain weight. When the dosage of Jinduer is greater than 80 mL / 667 m 2 , the 1000 - grain weight is significantly lower than that of the manual weeding control, indicating that a herbicide dosage greater than 80 mL / 667 m 2 will reduce the buckwheat 1000 - grain weight. When the microbial agent DH3 is applied, when the dosage of the herbicide Jinduer is greater than 120 mL / 667 m 2 , the 1000 - grain weight is significantly lower compared with other herbicide concentrations, indicating that when the dosage of the herbicide Jinduer is greater than 120 mL / 667 m 2 , the ability of the microbial agent DH3 to alleviate the reduction of 1000 - grain weight caused by the herbicide decreases.
[0121] The various embodiments in this specification are described in a progressive manner. Each embodiment focuses on the differences from other embodiments. For the same or similar parts among the various embodiments, reference can be made to each other.
[0122] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather will be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A strain of Serratia marcescens DH3, characterized in that The Serratia marcescens is named DH3, and its classification name is Serratia marcescens. It was deposited in the China Center for Type Culture Collection on July 1, 2024, with a deposit number of CCTCC NO: M 20241437, and the deposit address is Wuhan University, Wuhan, China.
2. Use of the Serratia marcescens DH3 according to claim 1 in degrading the herbicide Kindol.
3. Use of the Serratia marcescens DH3 according to claim 1 in preparing a herbicide Jindul degrading bacterial agent.
4. Use of the Serratia marcescens DH3 described in claim 1 in increasing buckwheat yield and thousand-grain weight.
5. A herbicide Jindul degrading bacterial agent, characterized in that: The method comprises the Serratia marcescens DH3 as described in claim 1.
6. A method for degrading the herbicide Jindul in soil, characterized in that: The Serratia marcescens DH3 according to claim 1 is administered.