Cadmium-resistant plant endophytic complex microbial inoculant and application thereof

Abstract

The invention relates to a cadmium-tolerant plant endophytic complex microbial inoculant and application thereof, and relates to the technical field of microorganisms. The plant endophytic complex microbial inoculant is prepared by compounding bacillus velezensis CC09, pseudomonas chlororaphis L89 (Pseudomonas chlororaphis L89) and proteus mirabilis L10 (Proteus mirabilis), and the plant endophytic complex microbial inoculant is prepared by compounding the bacillus velezensis CC09, the pseudomonas chlororaphis L89, the proteus mirabilis L10 and the proteus mirabilis L10, the plant endophytic complex microbial inoculant, the plant endophytic complex microbial inoculant and the plant endophytic complex microbial inoculant. The plant endophytic complex microbial inoculant can significantly promote the growth of pepper, and compared with a blank group, the plant height can be improved by 23.6%, the activity of superoxide dismutase (SOD) is improved by 186.4%, and the content of malondialdehyde is reduced by 19.7%. In addition, the plant endophytic complex microbial inoculant can effectively reduce the accumulation of cadmium in the roots, stems and leaves of capsicum, and the accumulation of cadmium is respectively reduced by 39.8%, 5.0% and 26.8%. The plant endophytic complex microbial inoculant can also reduce the content of capsicum absorbable cadmium in soil. The method is suitable for planting the peppers in the cadmium-polluted soil and improving the soil.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a cadmium-tolerant plant endophytic composite bactericide and its application. Background Art

[0002] Due to the characteristics of pepper as a cadmium hyperaccumulating vegetable, the risk of exceeding the standard is relatively high, and the phenomenon of exceeding the standard is increasing day by day. At the same time, with the increase of cadmium concentration in the soil, the growth of pepper will be hindered to varying degrees, manifested as a significant decrease in plant height, a decrease in antioxidant capacity, and damage to the cell membrane structure.

[0003] Using biological bactericides to reduce the cadmium absorption of crops has the technical advantages of environmental protection, high efficiency, economy and sustainability. At present, the research on bactericides for reducing cadmium pollution mainly focuses on plant growth-promoting rhizobacteria, but their application in protected agriculture of crops such as pepper is relatively less.

[0004] Plant endophytes, as a class of microorganisms symbiotic with plants, compared with microorganisms growing on the phyllosphere and rhizosphere of plants, because they are colonized in the internal tissues of plants (apoplast or symplast), their living environment is more stable, and under the stress of external biological or abiotic factors, they show a more obvious growth-promoting effect on plants. Therefore, plant endophytes have broad application prospects in the process of reducing the absorption of heavy metals by plants, promoting plant growth and passivating cadmium-polluted soil. However, there are still many challenges in practical applications. The application effects of existing technology strains have limitations, mainly reflected in the single function of the strains and poor effects. In the application of pepper cultivation, there is no strain that can simultaneously promote the growth of pepper, reduce the cadmium accumulation in pepper, and reduce the content of available cadmium in the soil. Summary of the Invention

[0005] The present invention provides a plant endophytic composite bactericide, which is prepared by compounding Bacillus velezensis ( Bacillus velezensis ) CC09, Pseudomonas chlororaphis ( Pseudomonas chlororaphis ) L89 and Proteus mirabilis ( Proteus mirabilis ) L10. The plant endophytic composite bactericide can simultaneously promote the growth of pepper, reduce the cadmium accumulation in pepper, and reduce the content of available cadmium in the soil.

[0006] The Bacillus velezensis CC09 has been disclosed in the patent with the publication number CN102199563B and the invention title "A biocontrol bacterium for preventing plant diseases and its preparation method".

[0007] The Pseudomonas chlororaphis L89 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 2, 2024. Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit number is CGMCC No. 32873. The 16S rDNA sequence of this strain is as shown in Sequence Listing SEQ ID NO.1.

[0008] The Proteus mirabilis L10 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 2, 2024. Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit number is: CGMCC No. 32872. The 16S rDNA sequence of this strain is as shown in Sequence Listing SEQ ID NO.2.

[0009] Furthermore, the Bacillus velezensis CC09, Pseudomonas chlororaphis L89, and Proteus mirabilis L10 were all isolated from the leaves of Cinnamomum camphora on the campus of Nanjing University. The isolation process was as follows: First, the collected Cinnamomum camphora leaves were washed with sterile water, and then sequentially surface-disinfected with 70% (v / v) ethanol solution and 2% (w / v) sodium hypochlorite solution. The disinfected leaf samples were placed in a sterile mortar, and 9 mL of sterile phosphate buffer solution (PBS, pH 7.4) was added and ground into a homogenate. An appropriate amount of the homogenate was serially diluted (10 -1 -10 -5 ), and then spread on LB solid medium plates containing 40 ppm (1 ppm = 1 mg / kg) cadmium. After culturing at 37 °C for 16 h, single colonies with different morphological characteristics were picked and separated and purified by streaking until pure cultures were obtained.

[0010] Furthermore, the Bacillus velezensis CC09, Pseudomonas chlororaphis L89, and Proteus mirabilis L10 have the following physiological characteristics: (1) They have good tolerance to cadmium and can all tolerate a cadmium concentration of 200 ppm; (2) They have the ability to remove cadmium. In a medium with a cadmium concentration of 40 ppm, the cadmium removal rates of Bacillus velezensis CC09, Pseudomonas chlororaphis L89, and Proteus mirabilis L10 are 26%, 27%, and 31% respectively; (3) They all have protease, nitrogen fixation, potassium solubilization, and phosphorus solubilization activities.

[0011] Furthermore, the above plant endophytic composite bactericide was prepared by the following method: S1. Inoculate Bacillus velezensis CC09, Pseudomonas chlororaphis L89 and Proteus mirabilis L10 into TSB (Tryptic Soy Broth) medium to obtain seed solutions; S2. Transfer the seed solutions of Bacillus velezensis CC09, Pseudomonas chlororaphis L89 and Proteus mirabilis L10 in S1 to TSB medium respectively to obtain Bacillus velezensis CC09 culture solution, Pseudomonas chlororaphis L89 culture solution and Proteus mirabilis L10 culture solution; S3. Adjust the OD of the Bacillus velezensis CC09 culture solution, Pseudomonas chlororaphis L89 culture solution and Proteus mirabilis L10 culture solution obtained in S2 600 to 0.5, mix them to obtain a mixed culture solution, and add 0.3% - 0.5% arabic gum, 0.05% - 0.15% Tween 20 and 0.03% - 0.05% ascorbic acid to the mixed culture solution according to the mass - volume ratio to obtain the plant endophytic composite microbial agent.

[0012] Furthermore, the seed solutions mentioned in step S1 above specifically refer to inoculating Bacillus velezensis CC09, Pseudomonas chlororaphis L89 and Proteus mirabilis L10 into test tubes of TSB medium respectively and culturing overnight at 37 °C to obtain seed solutions.

[0013] Furthermore, the mixing in step S3 above means mixing the Bacillus velezensis CC09 culture solution, Pseudomonas chlororaphis L89 culture solution and Proteus mirabilis L10 culture solution according to the volume ratio of (1 - 3):(1 - 3):(1 - 3).

[0014] On the other hand, the present invention provides an application of the plant endophytic composite microbial agent in promoting the growth of peppers.

[0015] Furthermore, the application is to promote the growth of peppers by drenching the roots or spraying the leaves of peppers with the plant endophytic composite microbial agent.

[0016] Furthermore, promoting the growth of peppers specifically means drenching the roots or spraying the leaves of peppers with the plant endophytic composite microbial agent to increase the plant height of peppers, enhance the activity of superoxide dismutase (SOD), and reduce the content of malondialdehyde.

[0017] The above - mentioned SOD activity and the above - mentioned malondialdehyde content are important indicators for evaluating the antioxidant capacity and the degree of cell membrane damage in peppers; Among them, SOD is an important antioxidant enzyme that can catalyze the dismutation of superoxide anion radicals (O 2- ) into oxygen and hydrogen peroxide (H 2 O 2), thereby reducing the damage of reactive oxygen species (ROS) to cells. An increase in SOD activity usually indicates that plants have a strong antioxidant capacity and can effectively cope with environmental stress; The content of malondialdehyde is an index of cell membrane damage and is one of the products of cell membrane lipid peroxidation. An increase in its content usually means that the degree of cell membrane lipid peroxidation intensifies and the cell membrane structure is damaged. The damage of the cell membrane will lead to an increase in the permeability of the cell membrane, and the electrolytes and nutrients in the cell will leak out, affecting the normal function of the cell.

[0018] On the other hand, the present invention provides an application in reducing cadmium absorption by peppers.

[0019] Furthermore, the application is to reduce the cadmium absorption of peppers by irrigating the roots or spraying the leaves of peppers with the compound bacterium agent.

[0020] Furthermore, the above-mentioned reduction of cadmium absorption by peppers is specifically manifested as a reduction in the accumulation of cadmium content in the roots, stems and leaves of peppers.

[0021] On the other hand, the present invention provides an application of a plant endophytic compound bacterium agent in improving cadmium-polluted soil, which is characterized in that by applying the compound bacterium agent to cadmium-polluted soil, the available cadmium in the soil is converted into residual cadmium.

[0022] Compared with the prior art, the present invention has the following advantages: (1) The plant endophytic compound bacterium agent of the present invention has a significant growth-promoting effect on peppers: The pot experiment shows that, compared with the blank group, the plant endophytic compound bacterium agent of the present invention can increase the plant height by 23.6%, increase the superoxide dismutase (SOD) activity by 186.4%, and reduce the malondialdehyde content by 19.7%.

[0023] Among them, the plant height of the peppers in the group treated with Proteus mirabilis L10 alone and the group treated with the combination of Bacillus velezensis CC09 and Pseudomonas chlororaphis L89 (CC09+L89) is less than that of the blank control, while the plant height of the peppers in the three-bacterium combination treatment group (L10+CC09+L89) is significantly higher than that of the blank control group; The malondialdehyde content in the peppers in the group treated with Proteus mirabilis L10 alone and the group treated with the combination of Bacillus velezensis CC09 and Pseudomonas chlororaphis L89 (CC09+L89) is higher than that of the blank control group, while the malondialdehyde content in the peppers in the three-bacterium combination treatment group (L10+CC09+L89) is significantly lower than that of the blank control group; The SOD activity in the peppers in the combination treatment group of Proteus mirabilis L10 and the combination of Bacillus velezensis CC09 and Pseudomonas chlororaphis L89 (CC09+L89) is increased to some extent, but the SOD activity in the peppers in the three-bacterium combination treatment group (L10+CC09+L89) is 1.9 times higher than that of the blank control group.

[0024] (2)The plant endophytic composite bactericide of the present invention has a prominent effect on reducing cadmium absorption by peppers: the plant endophytic composite bactericide can reduce the cadmium content in the roots, stems and leaves of peppers by 39.8%, 5.0% and 26.8% respectively.

[0025] (3)The plant endophytic composite bactericide of the present invention improves soil quality: the plant endophytic composite bactericide reduces the proportion of exchangeable cadmium in the soil by 14.8% and increases the proportion of residual cadmium by 2.2%, indicating that the plant endophytic composite bactericide of the present invention can convert exchangeable cadmium in the soil into residual cadmium, thereby reducing the cadmium that plants can directly absorb and utilize. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a morphological characteristic and phylogenetic tree diagram of Bacillus velezensis CC09, where a represents the morphological characteristics of Bacillus velezensis CC09, and b represents the phylogenetic tree of Bacillus velezensis; Figure 2 It is a morphological characteristic and phylogenetic tree diagram of Pseudomonas chlororaphis L89, where c represents the morphological characteristics of Pseudomonas chlororaphis L89, and d represents the phylogenetic tree of Pseudomonas chlororaphis; Figure 3 It is a morphological characteristic and phylogenetic tree diagram of Proteus mirabilis L10, where e represents the morphological characteristics of Proteus mirabilis L10, and f represents the phylogenetic tree of Proteus mirabilis; Figure 4 It is a diagram showing the tolerance of Bacillus velezensis CC09, Pseudomonas chlororaphis L89, and Proteus mirabilis L10 under different cadmium concentrations. Among them, a represents the tolerance of the above three bacteria under a cadmium concentration of 2 ppm, b represents the tolerance of the above three bacteria under a cadmium concentration of 40 ppm, and c represents the tolerance of the above three bacteria under a cadmium concentration of 200 ppm; Figure 5 It is a bar chart of cadmium removal rates of Bacillus lehensis CC09, Pseudomonas chlororaphis L89, and Proteus mirabilis L10. Among them, CC09 represents Bacillus velezensis CC09, L89 represents Pseudomonas chlororaphis L89, and L10 represents Proteus mirabilis L10; Figure 6 It is a diagram showing the effect of promoting the growth of peppers by different treatment groups in a pot experiment. Among them, a, b, and c respectively represent the plant height, malondialdehyde content, and SOD enzyme activity of peppers. Among them, S6 represents the treatment group with Proteus mirabilis L10 alone, S8 represents the treatment group with the composite bacteria of Bacillus velezensis CC09 and Pseudomonas chlororaphis L89, S11 represents the treatment group with the plant endophytic composite bactericide of the present invention, and A, B, and C indicate that the data have significant differences; Figure 7This is a diagram showing the effect of the endophytic complex bacterial agent of the present invention on the cadmium content in different parts of peppers in a pot experiment. Here, CK represents the blank control group, and S11 represents the treatment group with the endophytic complex bacterial agent of the present invention; Figure 8 This is a diagram showing the effect of the endophytic complex bacterial agent of the present invention on the cadmium availability in soil. Here, CK represents the blank control group, and S11 represents the treatment group with the endophytic complex bacterial agent of the present invention. Detailed implementation manners

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0028] Example 1: Isolation and identification of bacterial strains For the leaves of camphor trees, rinse the leaves with sterile water to remove surface dirt and attached microorganisms. Subsequently, disinfect the samples with 70% alcohol for 5 min, and then disinfect with 2% sodium hypochlorite solution for 10 min, while gently stirring to ensure full contact between the solution and the leaves. Finally, rinse with sterile water three times. The sterile water from the last rinse is spread on TSA medium. If no bacteria grow, it indicates that the surface disinfection is thorough. Then, take 1 g of the completely disinfected leaves and add 9 ml of sterile phosphate buffer to grind into a homogenate for gradient dilution. Take an appropriate (10 -3 -10 -5 )-diluted 100 μl of the sample solution and spread it on LB medium containing 40 ppm cadmium, and culture at 37 °C for 16 h. Observe the color, shape, and size of the single colonies, select single bacteria with different morphologies for purification, and screen out strains that can tolerate high concentrations of cadmium. Use the universal primers for 16S rDNA (27F: AGAGTTTGATCATGGCTCAG / 1492R: TACGGTTACCTTGTTACGACTT) to amplify the 16S sequences of strains CC09, L89, and L10, and sequence them. Submit the sequencing results to the NCBI nucleic acid database for homology comparison, and construct a phylogenetic tree to determine the genetic relationship and classification of the strains.

[0029] Figure 1 a shows the colony characteristics of Bacillus velezensis CC09. It grows well on TSA medium. In the early stage, the colonies are relatively sticky, milky white and opaque, with a smooth and convex surface. In the later stage, the surface starts to wrinkle, the edge is irregular, and an irritating odor is produced. The phylogenetic tree is as Figure 1 shown in b.

[0030] Figure 2 c is the colony characteristic of Pseudomonas chlororaphis L89, which grows well on TSA medium, showing orange-yellow transparency, with a smooth surface and regular edges. The phylogenetic tree is as Figure 2 shown in d.

[0031] Figure 3 e is the colony characteristic of Proteus mirabilis L10, which grows well on TSA medium, showing milky white and transparency, with a smooth surface and regular edges. The phylogenetic tree is as Figure 3 shown in f.

[0032] Example 2: Evaluation of cadmium tolerance, cadmium removal rate and growth-promoting activity of strains 2.1 Test method (1) Tolerance of single strain to cadmium: Pick single colonies of Bacillus velezensis CC09, Pseudomonas chlororaphis L89, and Proteus mirabilis L10 from the TSA plate, inoculate them into a 15 ml centrifuge tube containing 5 ml of TSB medium, and culture overnight in a shaker at 37 °C and 200 rpm to obtain seed liquid. Then adjust the bacterial liquid to OD 600 = 0.5 with sterile water, and transfer it to fresh TSB medium containing 2 - 200 ppm cadmium at a ratio of 1%. Measure the OD 600 value every 2 h for continuous detection for 24 h.

[0033] (2) Cadmium removal rate of single strain: Dissolve 0.1 g of cadmium chloride in 80 ml of water, make up the volume to 100 ml to obtain a stock solution containing 1000 ppm cadmium, and dilute it into solutions with different gradients of 0.5 ppm, 1 ppm, 3 ppm, 5 ppm, 8 ppm, and 10 ppm. Use ICP-OES for detection to construct a standard curve.

[0034] The seed liquid obtained as described in 2.1(1) is transferred to fresh TSB medium containing 40 ppm cadmium at a ratio of 1%, and samples are taken once every 24 h for a total of 5 times. After centrifuging the samples at 8000×g for 10 min, filter them through a 0.22 μm filter membrane, dilute them 5 times with 5% nitric acid, and place them in a 4 °C refrigerator for further testing.

[0035] (3) Growth-promoting activity of single strain: After obtaining the seed liquids of the 3 bacteria in the manner described in 2.1(1) above, inoculate them onto the following media by the method of streaking on a plate, and judge whether they have the corresponding growth-promoting activity according to the presence or absence of a hydrolysis zone.

[0036] Protease detection medium (peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, skim milk 10 g / L, agar 15 g / L).

[0037] Ashby nitrogen-fixing solid medium (potassium dihydrogen phosphate 0.2 g / L, magnesium sulfate 0.2 g / L, sodium chloride 0.2 g / L, calcium carbonate 5.0 g / L, mannitol 10.0 g / L, calcium sulfate 0.1 g / L, agar 15.0 g / L).

[0038] Inorganic phosphorus medium (glucose 10.0 g / L, ammonium sulfate 0.5 g / L, yeast extract powder 0.5 g / L, sodium chloride 0.3 g / L, tricalcium phosphate 5.0 g / L).

[0039] Organic phosphorus medium (glucose 10.0 g / L, ammonium sulfate 0.5 g / L, yeast extract powder 0.5 g / L, sodium chloride 0.3 g / L, lecithin 0.2 g / L).

[0040] Potassium-solubilizing medium (sucrose 5.0 g / L, disodium hydrogen phosphate 2.0 g / L, magnesium sulfate heptahydrate 0.5 g / L, ferric chloride 0.005 g / L, calcium carbonate 0.1 g / L, potassium feldspar 2.0 g / L).

[0041] 2.2 Test results The results showed that: as Figure 4 shown, although L10, L89 and CC09 showed a trend of increasing lag phase at the concentrations of 40 ppm and 200 ppm, all three strains could tolerate cadmium concentrations of 2, 40, and 200 ppm and were strains with good tolerance to cadmium. The cadmium removal rates at 40 ppm were as Figure 5 shown, and the cadmium removal rates of the three bacteria all showed an upward trend with the increase of culture time. The removal rates on the fifth day were 31%, 27%, and 26% respectively, showing good cadmium removal ability.

[0042] At the same time, as shown in Table 1, all three bacteria had activities related to plant growth promotion such as protease, nitrogen fixation, potassium solubilization, and phosphorus solubilization, and were strains with good plant growth promotion potential.

[0043] Table 1: Plant growth promotion activities of different strains (+ represents having plant growth promotion activity)

[0044] Example 3: Pot experiment to evaluate the effect of the plant endophytic composite bacterium agent of the present invention on plants in cadmium-polluted soil 3.1 Materials and methods 3.1.1 Test materials Test soil: The soil was collected from Majiachong, Dongba Town, Gaochun District, Nanjing City. The soil in this area was a cadmium-contaminated soil sample. After air-drying for 10 days, it was ground and passed through a 100-mesh sieve.

[0045] Test plants: King No. 5 of Sujiao Doctor 3.1.2 Experimental design: Four treatments were designed, with 6 replicates for each treatment.

[0046] Treatment 1: Blank control, without applying any fertilizer (denoted as group CK).

[0047] Treatment 2: Using single strain L10 (denoted as group S6).

[0048] Treatment 3: Using the composite microbial agent of CC09 + L89 (denoted as group S8).

[0049] Treatment 4: Using the composite microbial agent of the present invention (denoted as group S11).

[0050] The microbial agent was irrigated into the roots once a week, 10 ml each time, for three consecutive weeks, and samples were collected in the fourth week.

[0051] 3.1.3 Experimental method (1) Preparation of pepper seedlings: Select plump pepper seeds, first disinfect them with 2.5% sodium hypochlorite for 5 minutes, then rinse them with deionized water 3 times, and then disinfect them with 75% alcohol for 5 minutes. After cleaning, place them in an incubator at 28 °C for germination. After germination, sow the pepper seeds in a seedling tray with a volume ratio of 3:1 of nutrient soil to vermiculite, evenly cover them with a layer of fine soil, place them in a plant culture room at 28 °C, and culture them under a 16-8 h light-dark cycle for about 3 weeks. When the peppers grow to the 4-6 leaf stage, select seedlings with consistent growth and transplant them into the test soil.

[0052] (2) Preparation of the microbial agent for the treatment group: Inoculate the strain into the liquid TSB medium, culture it overnight in a shaker at 37 °C and 200 rpm to obtain a seed solution, and transfer it to a fresh medium at a ratio of 1%. After culturing in a shaker at 37 °C and 200 rpm for 16-24 h, adjust the OD of the bacterial solution with an equal amount of sterile water 600 = 0.5. For S6, only strain L10 was added. For S8, strains CC09 and L89 were mixed in equal proportions at a volume ratio of 1:1. For S11, strains CC09, L89, and L10 were mixed in equal proportions at a viable cell count ratio of 1:1:1, and then 0.4% arabic gum was added as a protective agent, 0.1% Tween 20 was added as an emulsifier, and 0.042% ascorbic acid was added as an antioxidant according to the mass-volume ratio to obtain a liquid plant endophyte composite microbial agent.

[0053] (3)Detection of physiological and biochemical properties of peppers: ① Plant height measurement: At the 21st day after the treatment with the microbial agent, the plant height was uniformly measured by a single person.

[0054] ② Determination of SOD enzyme activity: Take 1 - 2 g of fresh leaves of the sample, remove the leaf veins, cut them into pieces, take 0.1 g and put it into a pre-cooled 2 ml centrifuge tube, grind it into a homogenate state with a grinder to obtain the crude enzyme solution. Add reagents in sequence according to Table 2, react under a 4000 lx fluorescent lamp for 20 min, and calculate the enzyme activity through the following formula: SOD enzyme activity = ((A 0 - A S ) × V T ) / (A 0 × 0.5 × FW × V 1 ) The total SOD activity is expressed in enzyme units per gram of fresh weight; the specific activity unit is expressed in enzyme units / mg of protein; A 0 — Absorbance value of the light-illuminated control tube; A S — Absorbance value of the sample tube; V T — Total volume of the sample solution in ml; V 1 — Volume of the sample used during the determination in ml; FW — Sample weight in g.

[0055] Table 2: Order and amount of reagents added for SOD enzyme activity detection

[0056] The reagent formulations in Table 2 are as follows: 0.05 mol / L phosphate buffer (PBS, pH = 7.8): A stock solution: 0.2 mol / L disodium hydrogen phosphate solution: B stock solution: 0.2 mol / L sodium dihydrogen phosphate solution They are respectively made up to 1000 ml with distilled water. Take 228.75 ml of the A stock solution and 21.25 ml of the B stock solution, and make up to 1000 ml with distilled water. Add 10 g of polyvinylpyrrolidone.

[0057] 130 mmol / L methionine solution: Take 1.399 g of Met and make up to 100 ml with a phosphate buffer at pH = 7.8; 100 μmol / L EDTA-Na 2 solution: Take 0.03721 g of EDTA-Na 2Make up to 1000 ml with phosphate buffer solution; 100 μM riboflavin solution: Take 0.0075 g of riboflavin, make up to 100 ml with distilled water, store in the dark, prepare it as needed, and dilute it 10 times; 750 μmol / L nitroblue tetrazolium solution: Weigh 0.06133 g of nitroblue tetrazolium and make up to 100 ml with phosphate buffer solution, store in the dark.

[0058] ③ Determination of malondialdehyde content: 10% TCA: Dissolve 100 g of trichloroacetic acid and make up to 1 L; 0.6% TBA: 0.6 g of thiobarbituric acid, dissolve it with a small amount of sodium hydroxide, and make up to 100 ml with 10% TCA.

[0059] Weigh three portions of 0.1 g of the above-mentioned shredded leaves, add 1 ml of 10% TCA, grind them into a homogenate with a grinder, centrifuge at 4000 rpm for 10 min, collect the supernatant, and obtain the crude enzyme extract. Pipette 20 μl of the crude enzyme extract and add 20 μl of 0.6% TBA, mix well, react in a boiling water bath for 15 min, quickly cool and then centrifuge, centrifuge at 8000×g for 5 min, and take the supernatant to measure the absorbance at wavelengths of 532 nm, 600 nm, and 450 nm.

[0060] (4) Detection of cadmium concentration in pepper roots, stems and leaves Place the pepper samples in an oven at 65 °C for 1 h to inactivate enzymes and then dry them at 105 °C until they reach a constant weight. Cut the dried samples into roots, stems and leaves, and put them into bags separately. Weigh 0.1 g of the dried samples from different parts into a microwave digestion tube, add 5 ml of ultrapure nitric acid, and pre-digest at 100 °C for 1 h on a microwave digestion instrument. Then add 3 ml of hydrogen peroxide and digest in the microwave digestion instrument. After digestion is completed, take out the digestion tube, place it on a digestion instrument at 150 °C to drive off the acid until about 1 ml remains, and make up to 25 ml. Determine using ICP-MS (Inductively Coupled Plasma Mass Spectrometry).

[0061] (5) Determination of total cadmium in soil Accurately weigh 0.5 g of soil sample into a polytetrafluoroethylene beaker, add 3 ml of hydrochloric acid to the beaker, and pre-digest at 100 °C for 1 h. Continue to add 5 ml of nitric acid, 2 ml of hydrofluoric acid, and 1 ml of perchloric acid to the beaker, and digest at 150 °C until the soil turns white. Drive off the acid until about 1 ml of acid residue remains in the beaker, cool and make up to 25 ml. Detect the cadmium content using ICP-OES (Inductively Coupled Plasma Optical Emission Spectrometer).

[0062] (6) Determination of different available cadmium forms in soil In the soil, there are significant differences in the absorption ability of different cadmium fractions by plants. The following are the different cadmium fractions in the soil and their effects on plant absorption: Cadmium fractions that can be absorbed by plants include exchangeable cadmium, reducible cadmium, and oxidizable cadmium.

[0063] Exchangeable cadmium: This is the cadmium fraction with the highest biological availability in the soil. The binding ability of exchangeable cadmium with the soil solid-phase adsorption medium is weak, and it is easily released into a highly mobile free state, thus being absorbed by plant roots.

[0064] Reducible cadmium: Under reducing conditions, reducible cadmium can dissolve and release, becoming a potentially available part for plants.

[0065] Oxidizable cadmium: Under oxidizing conditions, oxidizable cadmium can also be released, becoming a potentially available part for plants.

[0066] The cadmium fraction that is not easily absorbed by plants is residual cadmium.

[0067] Residual cadmium: Residual cadmium mainly exists in the soil mineral structure, with stable properties and is not easily released under normal conditions. Therefore, its absorption ability by plants is very low.

[0068] Detection of exchangeable cadmium: Add 1 g of soil sample to 40 ml of 0.11 M acetic acid solution, shake at 25 °C and 200 rpm for 16 h, then centrifuge at 3000 rpm for 20 min to separate the extract from the solid residue. Pour the supernatant into a polyethylene container. Store it in a refrigerator at 4 °C for later measurement. Add 20 ml of distilled water to wash the residue, shake at 200 rpm for 15 min, and centrifuge at 3000 rpm for 20 min. Pour out the supernatant and discard it.

[0069] Detection of reducible cadmium: Add 40 ml of 0.5 mol / L hydroxylamine hydrochloride to the solid residue from the previous step. The remaining steps are the same as the extraction of exchangeable cadmium.

[0070] Detection of oxidizable cadmium: Add 10 ml of hydrogen peroxide solution to the solid residue from the previous step, digest at room temperature for 1 h, continue to digest in a water bath at 85 °C for 1 h, then reduce the volume to 3 ml by further heating. Add another 10 ml of hydrogen peroxide solution. Continue to digest at 85 °C for 1 h. Remove the lid and evaporate the liquid to about 1 ml. Add 50 ml of 1.0 mol / l ammonium acetate solution to the cooled residue and shake at 22 ± 5 °C for 16 h. The remaining steps are the same as the extraction of exchangeable cadmium.

[0071] Detection of residual cadmium: The remaining residues from the previous step were digested using the total cadmium digestion method for soil. All samples were detected using ICP-OES.

[0072] In this experiment, the plant endophytic compound bacterium agent S11 was used to treat cadmium-polluted soil, and the changes in cadmium fractions in the soil before and after treatment were measured according to the above method. The preparation of the compound bacterium agent S11 was the same as that in Example 3.1.3 (2).

[0073] 3.3 Test results (1) Physiological and biochemical properties of peppers The results showed that: compared with only using S6 and the compound bacterium agent S8, the plant endophytic compound bacterium agent S11 of the present invention could significantly increase the plant height, SOD enzyme activity of plants and reduce the malondialdehyde content. As Figure 6 shown, compared with the control group, the plant height and SOD enzyme activity of the plant endophytic compound bacterium agent S11 of the present invention increased by 23.6% and 186.4% respectively, and the malondialdehyde content decreased by 19.7%. However, compared with the control group, the plant height of the compound bacterium agents S6 and S8 decreased, while the malondialdehyde content increased. This indicates that the combination of L10, L89 and CC09 can significantly promote plant growth, improve plant stress resistance and reduce cell damage caused by cadmium pollution.

[0074] (2) Cadmium concentrations in the roots, stems and leaves of peppers The results showed that: as Figure 7 shown, the plant endophytic compound bacterium agent of the present invention could effectively reduce the cadmium entering the roots, stems and leaves of peppers by 39.8%, 5.0% and 26.8% respectively, significantly reduce the cadmium content in peppers, and better protect the safety of crops.

[0075] (3) Determination of total cadmium and different cadmium fractions in soil The results showed that: as Figure 8 shown, applying the plant endophytic compound bacterium agent S11 of the present invention significantly reduced the exchangeable cadmium that can be directly utilized by plants in the soil by 14.8%, and increased the residual cadmium that is difficult to be utilized in the soil by 2.2%. This indicates that applying the plant endophytic compound bacterium agent of the present invention immobilizes the cadmium in the soil into a form that is difficult for plants to utilize, achieving a certain soil improvement effect.

Claims

1. A plant endophytic composite bacterial agent, characterized in that: Including Bacillus velez Bacillus velezensis )CC09 and Pseudomonas chlororaphis ( Pseudomonas chlororaphis )L89 and Proteus mirabilis ( Proteus mirabilis )L10; The deposit number of the Bacillus velez CC09 is CGMCC No.4669. The deposit number of the Pseudomonas chlororaphis L89 is CGMCC No.32873. The deposit number of the Proteus mirabilis L10 is CGMCC No.32872.

2. The plant endophytic composite bacterial agent according to claim 1, characterized in that: The method comprises the following preparation steps: S1, inoculating Bacillus velez CC09, Pseudomonas chlororaphis L89 and Proteus mirabilis L10 into TSB liquid medium to obtain seed liquid; S2, respectively transferring the seed liquids of Bacillus velez CC09, Pseudomonas chlororaphis L89 and Proteus mirabilis L10 in S1 to TSB liquid culture medium for cultivation to obtain culture liquid of Bacillus velez CC09, culture liquid of Pseudomonas chlororaphis L89 and culture liquid of Proteus mirabilis L10; S3, adjust the OD of the culture solution of Bacillus velez CC09, Pseudomonas chlororaphis L89 and Proteus mirabilis L10 obtained in S2 600 The mixed culture solution is compounded with a protective agent, an emulsifier and an antioxidant to obtain the plant endophyte composite bacterial agent.

3. The composite bacterial agent according to claim 2, characterized in that: The compounding ratio described in step S3 is (1-3): (1-3): (1-3) by volume.

4. The composite bacterial agent according to claim 2, characterized in that: The protective agent in step S3 is gum arabic, the emulsifier is Tween 20, and the antioxidant is ascorbic acid.

5. The composite bacterial agent according to claim 4, characterized in that: The added amount of the gum arabic is 0.3%-0.5% of the mixed culture solution in terms of mass volume ratio, the added amount of the Tween 20 is 0.05%-0.15% of the mixed culture solution in terms of mass volume ratio, and the added amount of the ascorbic acid is 0.03%-0.05% of the mixed culture solution in terms of mass volume ratio.

6. Use of the composite bacterial agent as described in any one of claims 1 to 5 in promoting the growth of pepper.

7. Use of the composite bacterial agent as described in any one of claims 1 to 5 in reducing cadmium absorption of pepper.

8. Use of the composite bacterial agent as described in any one of claims 1 to 5 in improving cadmium pollution in soil.

Images