Plant endophytic complex microbial inoculant for pepper continuous cropping and application of plant endophytic complex microbial inoculant

Abstract

The invention provides a plant endophytic complex microbial inoculant for pepper continuous cropping and application thereof, and relates to the technical field of microorganisms. The plant endophytic complex microbial inoculant comprises bacillus velezensis CC09 (Bacillus velezensis) and pseudomonas chlororaphis L89 (Pseudomonas chlororaphis), and the plant endophytic complex microbial inoculant comprises bacillus velezensis CC09 (Bacillus velezensis CC09) and pseudomonas chlororaphis L89 (Pseudomonas chlororaphis L89). The plant endophytic complex microbial inoculant has the beneficial effects of preventing and treating phytophthora capsici, promoting pepper growth, improving pepper yield, improving pepper quality, increasing soil organic carbon content and carbon sequestration enzyme activity and the like. The method is suitable for pepper planting, especially pepper continuous cropping.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural microorganisms, and particularly relates to a plant endophytic composite bactericide for continuous cropping of peppers and its application, especially in continuous cropping of peppers. Background Art

[0002] Pepper cultivation faces the severe challenge of continuous cropping obstacles, which are mainly reflected in the following aspects: Firstly, soil-borne diseases caused by fungi such as Phytophthora spp. Phytophthora will show an increasing trend, seriously affecting the growth and health of peppers; Secondly, the accumulation of allelochemicals and the deterioration of soil physical and chemical properties lead to a significant decline in the yield and quality of peppers, having a negative impact on the economic benefits of pepper cultivation; Thirdly, continuous cropping will cause a significant decrease in the activity of soil carbon-fixing enzymes, resulting in a large consumption of the content of organic carbon in the soil, affecting the ecological function and sustainable utilization of the soil.

[0003] At present, biological control measures are considered to be able to effectively improve the above situation, and the application of plant endophytic bacteria has received particular attention. As a type of microorganism symbiotic with plants, plant endophytic bacteria have various beneficial functions. On the one hand, it can inhibit the growth of pathogenic bacteria, reduce the accumulation of harmful substances in plants and soil, and play a long-term role in plants through an effect similar to a "vaccine", thereby providing continuous disease prevention effects for plants; On the other hand, plant endophytic bacteria can also promote plant growth and enhance plant stress resistance. Although plant endophytic bacteria have significant effects in disease prevention and growth promotion, the biocontrol ability of existing technology strains is often relatively single and difficult to simultaneously have multiple functions such as growth promotion, disease prevention, and carbon fixation. Summary of the Invention

[0004] The present invention provides a plant endophytic composite bactericide, which is obtained by compounding Bacillus velezensis CC09 and Pseudomonas chlororaphis L89. The composite plant endophytic bacteria can simultaneously achieve three effects: effectively inhibiting Phytophthora blight disease in continuous cropping of peppers; promoting pepper growth, improving the yield and quality of peppers; and enhancing the soil carbon fixation ability.

[0005] The Bacillus velezensis CC09 has been disclosed in the patent with the publication number CN102199563B and the invention name "A biocontrol bacterium for preventing plant diseases and its preparation method".

[0006] The Pseudomonas chlororaphis L89 was deposited on December 2, 2024 at the China General Microbiological Culture Collection Center, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCC No. 32873. The 16S rDNA sequence of this strain is as shown in Sequence Listing SEQ ID NO.1.

[0007] Both the Bacillus velezensis CC09 and the Pseudomonas chlororaphis L89 were isolated from the leaves of Cinnamomum camphora on the campus of Nanjing University. The specific isolation process is as follows: Wash the above-mentioned Cinnamomum camphora leaves with sterile water, and surface disinfect the Cinnamomum camphora leaves with 70% ethanol and 2% sodium hypochlorite. Then add 9 mL of sterile phosphate buffer to the completely disinfected Cinnamomum camphora leaf samples, grind them into a homogenate, and select gradients of 10-3 - 10-5 for spreading on LB plates. Pick single colonies with different morphologies for isolation and purification. The obtained single bacteria were screened through a plate confrontation experiment to obtain strains that can effectively inhibit Phytophthora capsici.

[0008] Furthermore, the above-mentioned plant endophytic compound bactericide is prepared by the following method: S1. Inoculate the Bacillus velezensis CC09 and the Pseudomonas chlororaphis L89 into TSB (Tryptic Soy Broth liquid medium) for cultivation respectively to obtain the Bacillus velezensis CC09 seed liquid and the Pseudomonas chlororaphis L89 seed liquid; S2. Transfer the Bacillus velezensis CC09 seed liquid and the Pseudomonas chlororaphis L89 seed liquid described in S1 into TSB liquid medium respectively, and place them on a shaker for scale-up cultivation to obtain the Bacillus velezensis CC09 culture solution and the Pseudomonas chlororaphis L89 culture solution; S3. Adjust the OD600 of the Bacillus velezensis CC09 culture solution and the Pseudomonas chlororaphis L89 culture solution to 0.5 respectively for compounding to obtain a compound culture solution, and add a protective agent, an emulsifier and an antioxidant to the compound culture solution to obtain the plant endophytic compound bactericide.

[0009] Furthermore, in the cultivation described in the above step S1, the temperature is 36 - 38 °C and the time is 12 - 18 h.

[0010] Furthermore, the compounding ratio described in the above step S3 is (1 - 3):(1 - 3) by volume ratio.

[0011] Furthermore, the protective agent described in the above step S3 is arabic gum, the emulsifier is Tween 20, and the antioxidant is ascorbic acid; The addition amount of the arabic gum is 0.3% - 0.5% (g / mL) of the compound culture solution described in step S3 by mass-volume ratio; The addition amount of Tween 20 is 0.05%-0.15% of the composite culture solution described in step S3 by mass-volume ratio (g / mL); The addition amount of ascorbic acid is 0.03%-0.05% of the composite culture solution described in step S3 by mass-volume ratio (g / mL).

[0012] On the other hand, the present invention provides an application of the plant endophytic composite bactericide in the prevention and control of pepper diseases.

[0013] Furthermore, the plant endophytic composite bactericide is applied by root irrigation or foliar spraying to effectively control the occurrence of Phytophthora blight of pepper.

[0014] On the other hand, the present invention provides an application of the plant endophytic composite bactericide in increasing the yield and improving the quality of peppers.

[0015] Furthermore, the plant endophytic composite bactericide is applied by root irrigation or foliar spraying to significantly increase the yield and quality of peppers.

[0016] On the other hand, the present invention provides an application of the plant endophytic composite bactericide in soil carbon sequestration.

[0017] Furthermore, the plant endophytic composite bactericide is applied by root irrigation or foliar spraying, which can effectively increase the organic carbon content of the soil and enhance the soil's carbon sequestration ability.

[0018] ‌Pepper continuous cropping refers to continuously planting peppers in the same plot. Pepper continuous cropping usually causes problems such as soil nutrient imbalance and soil property change.

[0019] The present invention provides a method for pepper continuous cropping, and the above-mentioned any plant endophytic composite bactericide is irrigated into the roots during the growth period of pepper seedlings.

[0020] Furthermore, the volume ratio of Bacillus velezensis CC09 to Pseudomonas chlororaphis L89 in the composite bactericide is (1-3):(1-3).

[0021] Furthermore, the above-mentioned plant endophytic composite bactericide is irrigated into the roots during the growth period of pepper seedlings.

[0022] Furthermore, the plant endophytic composite bactericide is irrigated into the roots once before transplanting pepper seedlings, and the plant endophytic composite bactericide is irrigated into the roots every two weeks after transplanting pepper seedlings.

[0023] Furthermore, the dosage of the plant endophytic composite bactericide is 1×10 7 -9×10 7 cfu (i.e., 1×10 7 -9 ×10 7 cfu / plant).

[0024] Compared with the prior art, the advantages of the present invention are as follows: (1) For the endophytic composite bacterial agent of the present invention, in the pot experiment, when the inoculation amount is 10 mL / plant, the control effect on Phytophthora capsici is 100%, which is significantly higher than 26.6%-60% of a single strain, with an increase of 40%-73.4%; (2) For the endophytic composite bacterial agent of the present invention, in the pot experiment, it can significantly promote the growth of peppers. Compared with a single strain, it can increase the plant height of peppers by more than 16.06%.

[0025] (2) For the endophytic composite bacterial agent of the present invention, in the field experiment, it can promote the growth of peppers. Compared with the blank control group, it can increase the plant height, the number of flowers, and the chlorophyll content of peppers by 12.66%, 109.7%, and 7.5% respectively.

[0026] (3) For the endophytic composite bacterial agent of the present invention, in the field experiment, compared with the blank control group, it can increase the yield of the first crop of peppers by 80.1% and the total yield by 30.7%; and it can improve the quality of peppers. Compared with the blank control group, it can increase the contents of soluble amino acids, soluble sugars, vitamin C and other nutrients in peppers by 192.3%, 54.8%, and 38.7% respectively.

[0027] (4) The endophytic composite bacterial agent provided by the present invention can increase the soil carbon-fixing enzyme activity and the soil organic carbon content by 40.05% and 18.7% respectively compared with the blank control group, by 46.7% and 42.4% respectively compared with the single strain Bacillus velezensis CC09, and by 51.1% and 42.3% respectively compared with the single strain Pseudomonas chlororaphis L89.

[0028] The increase in soil organic carbon content can promote the formation of soil organic-inorganic complexes, make soil particles form good aggregate structures, increase soil aeration, water permeability and water retention, create a good environment for the growth of crop roots, and is conducive to the expansion of roots and the absorption of nutrients and water; in addition, soil organic carbon is an important carrier of soil nutrients, and the increase in its content can increase the adsorption and storage capacity of soil for nutrients, reduce nutrient loss, make nutrients such as nitrogen, phosphorus, and potassium in the soil more effectively supplied to crops, improve the utilization rate of fertilizers, and thus promote the growth of crops.

[0029] The prior art generally applies biochar to increase the relative abundance of genera such as Bacillus, and these genera increase the soil organic carbon content by decomposing organic substances and promoting the formation of soil aggregates. While the endophytic composite bacterial agent of the present invention is directly applied to the soil, it can enhance the carbon-fixing enzyme activity, thereby increasing the soil organic carbon content. Description of the Drawings

[0030] Figure 1 Morphological characteristics and phylogenetic tree of Bacillus velezensis CC09, where A shows the morphological characteristics of Bacillus velezensis CC09 and B represents the phylogenetic tree of Bacillus velezensis CC09.

[0031] Figure 2 Morphological characteristics and phylogenetic tree of Pseudomonas chlororaphis L89, where C shows the morphological characteristics of Pseudomonas chlororaphis L89 and D represents the phylogenetic tree of Pseudomonas chlororaphis L89.

[0032] Figure 3 Comparison chart of the incidence of Phytophthora capsici and the plant height of pepper in different treatment groups in the pot experiment, where A represents the effect of different treatment groups on the incidence of pepper in the pot experiment and B represents the effect of different treatment groups on the plant height of pepper in the pot experiment.

[0033] Figure 4 Effect diagram of the plant endophytic complex microbial inoculum on the growth-related indicators of pepper in the field experiment, where A represents the effect of different treatments on the plant height of pepper, B represents the effect of different treatments on the chlorophyll content of pepper, and C represents the effect of different treatments on the number of flowers of pepper.

[0034] Figure 5 Effect diagram of the plant endophytic complex microbial inoculum on the yield of pepper in the field experiment.

[0035] Figure 6 Effect diagram of the plant endophytic complex microbial inoculum on the quality of pepper in the field experiment, where A, B, and C respectively represent the standard curves of soluble active amino acids, soluble sugars, and vitamin C, and D, E, and F respectively represent the effects of different treatment groups on the contents of soluble active amino acids, soluble sugars, and vitamin C in pepper.

[0036] Figure 7 Effect diagram of the plant endophytic complex microbial inoculum on the soil carbon sequestration capacity in the field, where A represents the effect of different treatment groups on the soil carbon sequestration enzyme activity, B represents the standard curve of soil organic carbon, and C represents the effect of the plant endophytic complex microbial inoculum on the content of organic carbon in the field soil.

[0037] In the above figures, S1 represents the single-strain treatment group of Bacillus velezensis CC09, S4 represents the single-strain treatment group of Pseudomonas chlororaphis L89, S9 represents the treatment group of the plant endophytic complex microbial inoculum, CK represents the blank control group, and P represents the treatment group of the pesticide azoxystrobin. Above Figure 3 、 Figure 7 a, b, and c indicate significant differences in data. Detailed implementation methods

[0038] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0039] Example 1: Isolation and identification of Bacillus velez CC09 and Pseudomonas chlororaphis L89 Take the camphor leaves and rinse them with sterile water to remove surface dirt and attached microorganisms. Then, disinfect the samples with 70% alcohol for 5 min, and then disinfect them with 2% sodium hypochlorite solution for 10 min, stirring gently to ensure that the solution is in full contact with the leaves, and finally rinse them with sterile water three times. Next, take 1 g of the completely disinfected leaves, add 9 mL of sterile phosphate buffer, grind them into a homogenate, and then 10 -1 -10 -5 Perform gradient dilution. Take 100uL 10 -3 -10 5 The diluted sample solution was spread on LB medium and cultured at 37 °C for 16 h. The color, shape and size of the single colonies were observed, and the single bacteria with different morphologies were selected for purification, and the strains that could inhibit pepper phytophthora were screened out through plate confrontation experiments.

[0040] The 16S sequences of CC09 and L89 strains were amplified and sequenced using universal primers for 16S rDNA (27F: AGAGTTTGATCATGGCTCAG / 1492R: TACGGTTACCTTGTTACGACTT). The sequencing results were submitted to the NCBI nucleic acid database for homology comparison, and a phylogenetic tree was constructed to determine the relationship and classification of the strains.

[0041] Figure 1 A is the colony characteristic of Bacillus Velez CC09, which grows well on TSA medium. In the early stage, the colony is sticky, milky white and opaque, with a smooth and convex surface. In the later stage, the surface begins to wrinkle, the edges are irregular, and a pungent odor is produced.

[0042] Figure 2 C is Pseudomonas chlororaphis L89, which grows well on TSA medium and appears orange-yellow and transparent with a smooth surface and regular edges.

[0043] Phylogenetic tree of Bacillus velez CC09 and Pseudomonas chlororaphis L89 Figure 1 B, Figure 2 As shown in D.

[0044] Example 2: Evaluation of the effect of endophytic complex bacterial agents on preventing Phytophthora capsici and their growth-promoting ability in indoor potted plants 2.1 Test materials, locations and methods 2.1.1 Test crops and varieties: Sujiao Doctor Wang No. 5 2.1.2 Test location: Greenhouse of the Production Institute of Jiangsu Academy of Agricultural Sciences 2.1.3 Test design: There were 5 treatments in the test design, each treatment was repeated 3 times, and each repetition included 5 plants.

[0045] Treatment 1: Blank control, without applying any fertilizers and fungicides (denoted as group CK).

[0046] Treatment 2: Using endophytic complex bacterial agents (denoted as group S9).

[0047] Treatment 3: Using the single strain CC09 (denoted as group S1).

[0048] Treatment 4: Using the single strain L89 (denoted as group S4).

[0049] Treatment 5: Using the pesticide azoxystrobin (denoted as group P).

[0050] 2.1.4 Test methods (1) Preparation of endophytic complex bacterial agents Bacillus velezensis CC09 and Pseudomonas chlororaphis L89 were respectively inoculated into liquid TSB medium and cultured in a shaker at 37 °C and 200 rpm for 12 h to obtain the seed liquid of Bacillus velezensis CC09 and the seed liquid of Pseudomonas chlororaphis L89. They were respectively transferred to fresh medium at a ratio of 1%, and after culturing in a shaker at 37 °C and 200 rpm for 20 h, the OD of the bacterial liquid was adjusted with an equal amount of sterile water 600 = 0.5. After mixing at a volume ratio of 1:1, 0.4% arabic gum was added as a protective agent, 0.1% Tween 20 was added as an emulsifier, and 0.042% ascorbic acid was added as an antioxidant according to the mass-volume ratio to obtain the liquid endophytic complex bacterial agent S9.

[0051] (2) Preparation of spore suspension of Phytophthora capsici 1 g of CaCO was added to 100 mL of V8 juice (purchased from Campbell Soup Company, USA), centrifuged at 2500 rpm for 5 min, and the supernatant was diluted with water at a ratio of 1:9 to obtain V8 liquid medium. 3 15 g of agar powder was added to 1 L of V8 liquid medium to prepare V8 solid medium.

[0052]

[0053] ​The Phytophthora capsici pathogen was inoculated on a V8 solid petri dish and cultured in the dark at 28 °C in a constant temperature incubator for 10 d until the mycelium covered the plate. A punch with a diameter of 6 mm was used to punch discs at the edge of the colony. The discs were picked up with a sterile needle and transferred to an empty petri dish with a diameter of 9 cm, with the fungal surface facing up, and 10 discs were picked into each petri dish. 15 mL of sterilized water was added to the petri dish, and it was placed in a laminar flow hood with a light intensity of 300 lx. The water was changed every 30 min for a total of 3 times. Then, the water in the dish was sucked out with a pipette, and 10 mL of V8 liquid medium was added. It was cultured in the dark at 28 °C for 24 h to induce the production of a large number of sporangia. Then, it was placed in a 4 °C refrigerator for 30 min and then at room temperature for 30 min. At this time, a large number of zoospores were released. 10 μL of the spore suspension was taken and observed and counted under an upright microscope using a hemocytometer, and it was diluted to a spore suspension with a concentration of 1×10 5 cells / mL.

[0054] (3)Preparation of sterile soil The collected soil was air-dried at room temperature for 10 days and then ground and passed through a 100-mesh sieve. The sieved soil was placed in a sterile high-temperature and high-pressure resistant sealed bag and sterilized at 121 °C in an autoclave for 1 h. After taking it out, it was placed for 2 days. After the water vapor was completely dried, it was sterilized again by the above steps. Sterile soil was thus obtained.

[0055] 2.2 Detection method (1)Determination of the control effect of the plant endophytic complex bactericide on Phytophthora capsici Plump pepper seeds were selected. First, they were disinfected with 2.5% sodium hypochlorite for 5 min, then rinsed 3 times with sterile water, and then disinfected with 75% alcohol for 5 min. After cleaning, they were placed in a constant temperature incubator at 28 °C for germination. After germination, the pepper seeds were sown in a seedling tray with a volume ratio of nutrient soil to vermiculite of 3:1, evenly covered with a layer of fine soil, and placed in a 28 °C plant culture room for about 3 weeks with a 16 h - 8 h light-dark cycle. After the peppers grew to the 4 - 6 leaf stage, seedlings with consistent growth were selected and transplanted into sterile soil. One week after transplantation, the plant endophytic complex bactericide was used for root irrigation. The dosage of the bactericide was 10 7 cfu per pepper seedling (i.e., 1×10 7 cfu / plant). Sterile water was used as the negative control group, and azoxystrobin was used as the positive control. The single-bacterium control group was treated in the same method as described in 2.1.4(1) except for not mixing. 24 h later, 1 mL (1×10 5 cells / mL) of the Phytophthora capsici spore suspension was inoculated at the roots of the peppers. There were 5 seedlings in each treatment, and each treatment was repeated 3 times. After the treatment, the disease incidence of the peppers was observed every day, and the disease incidence was counted after 14 days. The incidence was calculated according to the following formula: Incidence = number of diseased plants / total number of plants × 100% (2) Determination of the effect of endophytic compound microbial agents on the plant height of peppers The detection method was the same as that in "Determination of the control effect of endophytic compound microbial agents on Phytophthora capsici of peppers", except that no pathogenic bacteria were inoculated. The plant height of peppers was measured 14 days after treatment.

[0056] 2.3 Test results (1) Control effect of endophytic compound microbial agents on Phytophthora capsici of peppers The detection results are shown in Figure 3 . The results showed that the control effect of endophytic compound microbial agents on Phytophthora capsici of peppers was significantly higher than that of single bacteria. Compared with the incidence rate of 26.6% - 60% in the single-bacteria treatment, the plants treated with the compound microbial agent did not develop the disease at all, and the disease prevention rate reached 100% (p < 0.05).

[0057] (2) Effect of endophytic compound microbial agents on the plant height of peppers The root irrigation treatment with endophytic compound microbial agents had an obvious promoting effect on the plant height of peppers, and the plant height of peppers increased by more than 16% compared with the single-bacteria treatment.

[0058] Example 3: Field evaluation of the growth promotion, yield increase and quality improvement ability of endophytic compound microbial agents on peppers 3.1 Test materials, locations and methods 3.1.1 Test crops and varieties: Sujiao Doctor Wang No. 5 3.1.2 Test location: Jiangsu Academy of Agricultural Sciences 3.1.3 Test design: There were 2 treatments in the test design, with three replicates for each treatment, a total of 6 plots, randomly grouped and arranged, and the plot area was 10 m 2 , and there were 30 plants in each plot.

[0059] Treatment 1: Blank control, without applying any fertilizer (denoted as group CK).

[0060] Treatment 2: Using endophytic compound microbial agents (denoted as group S9).

[0061] 3.1.4 Test and detection methods (1) Field evaluation of the growth promotion effect of endophytic compound microbial agents on peppers The preparation of endophytic compound microbial agents was as described in Example 2.1.4 (1), and the seedling cultivation was as described in 2.2 (1). After the peppers grew to the 4 - 6 leaf stage, they were hardened off for one week, and the root irrigation was carried out with endophytic compound microbial agents before transplanting. After transplanting, the root irrigation with endophytic compound microbial agents was carried out every two weeks after a one-week seedling recovery period. The dosage of the microbial agent was 1×10 7CFU per chili seedling. Stop root irrigation one week before chili harvest. To ensure consistency in standards, count the number of flowers and plant height of all chilies using the single-person counting method, and use a handheld chlorophyll meter (SPAD-502, Konica Minolta) for chlorophyll detection.

[0062] (2)Field evaluation of the yield increase effect of the plant endophytic complex microbial agent on chilies The chilies in the experimental plot were picked from early June to late June 2024. To ensure the accuracy of the experimental results, the same person harvested the chilies in the same state each time, and the single yield and total yield were counted.

[0063] (3)Field evaluation of the quality improvement ability of the plant endophytic complex microbial agent on chilies The chilies from the same plot harvested each time were combined into one portion, with a total of 6 samples in 2 treatment groups. Referring to the "Experimental Guidance for Postharvest Physiology and Biochemistry of Fruits and Vegetables", the ninhydrin method was used to determine the soluble amino acid content of the chilies in treatment groups 1-2; the phenol-sulfuric acid method was used to determine the soluble sugar content of the chilies in treatment groups 1-2; the bathophenanthroline method was used to determine the vitamin C content of the chilies in treatment groups 1-2 (see the standard curve results in Figure 6 A, 6B, 6C).

[0064] Determination process of soluble amino acids by the ninhydrin method: Take 6 20 mL stoppered graduated test tubes, number them, add various reagents according to Table 1, cover with a glass stopper, and mix well. Then heat in a 100 °C water bath for 15 min (seal the mouth during heating), take out and immediately place in cold water to cool quickly. Then quickly add 5.0 mL of 95% ethanol to each tube, stopper the tube, and shake the test tube vigorously so that the red product formed during heating is oxidized by the oxygen in the air and fades, and the solution is blue-violet at this time. Then dilute to 20 mL with 60% ethanol, zero with tube 0 as the reference, and measure the absorbance value of the solution at a wavelength of 570 nm. Repeat three times, use the mass of amino nitrogen as the abscissa and the absorbance value as the ordinate to draw a standard curve, and find the linear regression equation.

[0065] Table 1: Dosage of each reagent for making the soluble amino acid standard curve

[0066] Weigh 1.0 g of the above-mentioned collected chili fruit samples, add 5.0 mL of 10% acetic acid solution, grind them in a pre-cooled mortar, transfer to a 100 mL volumetric flask, dilute with distilled water to the scale, and mix well. Then filter through dry filter paper into a triangular flask for standby.

[0067] Absorb 1.0 mL of the sample filtrate and place it in a 20 mL dry stoppered graduated test tube. Add 1.0 mL of ammonia-free distilled water. The other operating steps are the same as those for preparing the standard curve.

[0068]

[0069] M’——The mass of amino acid obtained from the standard curve, μg V ——The total volume of the sample extract, mL V t ——The volume of the sample extract taken during the determination, mL m ——The mass of the sample, g Detection of soluble sugar by the phenol-sulfuric acid method: Take 6 25 mL graduated test tubes, number them, and add 100 μg / mL sucrose standard solution and distilled water according to Table 2. Then, add 1.0 mL of 90 g / L phenol solution to the test tubes in sequence, shake well, and then add 5 mL of concentrated sulfuric acid from the front of the tube liquid within 5 - 20 s, shake well. The total volume of the mixed solution is 8 mL, and let it react at room temperature for 30 min. Then, using the blank as the reference, measure the absorbance value of the mixed reaction solution at a wavelength of 485 nm. Plot the standard curve with the sucrose mass as the abscissa and the absorbance as the ordinate, and find the linear regression equation.

[0070] Table 2: Reagent amounts for preparing the sucrose standard curve by the phenol-sulfuric acid method for the determination of soluble sugar

[0071] Grind 1 g of the pepper fruit sample on ice and transfer it to a graduated test tube. Then add 5 - 10 mL of distilled water, seal it with a plastic film, extract it in a boiling water bath for 30 min, take it out and wait for it to cool before filtering. Filter the filtrate directly into a 100 mL volumetric flask, then recover the residue into the test tube, add 5 - 10 mL of distilled water, boil and extract for 10 min, and filter it into the volumetric flask. Rinse the test tube and the residue repeatedly with water, filter and transfer them all into the volumetric flask and make up to the mark. Absorb 0.5 mL of the sample into a test tube and add 1.5 mL of distilled water. The determination steps are the same as those for preparing the standard curve. Calculate the soluble sugar content through the following formula:

[0072] M’——The mass of sucrose obtained from the standard curve, μg V ——The total volume of the sample extract, mL N ——The dilution factor of the sample extract V t ——The volume of the sample extract taken during the determination m ——The mass of the sample, g Detection of vitamin C by the bathophenanthroline method: Take 7 test tubes, number them, add various solutions according to Table 3, place the mixture at 30 °C for reaction for 60 min, and then, using the mixture in test tube 0 as the reference, measure the absorbance value at a wavelength of 534 nm. Draw a standard curve with the mass of ascorbic acid as the abscissa and the absorbance value as the ordinate, and obtain the linear regression equation.

[0073] Table 3: Preparation of ascorbic acid standard curve

[0074] Weigh 10.0 g of the pulp sample of the pepper fruit sample and place it in a mortar. Add 20 mL of 50 g / L TCA solution, grind it into a slurry under ice bath conditions, transfer it to a 100 mL volumetric flask, and make up the volume to the scale with 50 g / L TCA solution. After mixing and extracting for 10 min, filter and collect the filtrate for standby.

[0075] According to the absorbance value, find out the mass of ascorbic acid in the corresponding mixture on the standard curve, and calculate the ascorbic acid content in the fruit and vegetable tissue according to the following formula. The ascorbic acid content in fruits and vegetables is expressed as the mass of ascorbic acid contained in 100 g of the sample (fresh weight), that is, mg / 100 g. Calculation formula: Take 1.0 mL of the sample extract in a test tube, add 1.0 mL of 50 g / L TCA solution, and then, in the same way as making the standard curve, add other components, carry out the reaction and measurement. Record the absorbance value of the reaction system at a wavelength of 534 nm.

[0076]

[0077] M’——The mass of ascorbic acid obtained from the standard curve, μg V t ——The volume of the sample extract used in titration, mL V——The total volume of the sample extract, mL m ——The mass of the sample, g 3.2 Test results (1) Field evaluation of the growth promotion effect of the plant endophytic complex bacterium agent on peppers The results show that the plant height, number of flowers and chlorophyll of peppers in treatment 2 increased by 12.7%, 109.7% and 7.5% respectively compared with those in treatment 1, and the effect was very significant (p < 0.05) (the results are shown in Figure 4 A, 4B, 4C).

[0078] (2) Field evaluation of the yield increase effect of the plant endophytic complex bacterium agent on peppers The results show that, compared with treatment 1, treatment 2 significantly increased the single yield of peppers, up to 80.11% at most, and the total yield increased by 30.66% (p < 0.05) (the results are shown inFigure 5 ).

[0079] (3) Field evaluation of the ability of the endophytic complex microbial inoculum to improve the quality of peppers The results showed that: compared with Treatment 1, Treatment 2 significantly increased the contents of soluble amino acids, soluble sugars, and vitamin C in the first crop of peppers by 192.3%, 54.75%, and 38.73% respectively ( Figure 6 D, 6E, 6F). This indicates that the complex microbial inoculum has a very good effect on improving the quality of peppers.

[0080] Example 4: Field evaluation of the effect of the endophytic complex microbial inoculum on soil carbon sequestration ability 4.1 Test materials, locations, and methods 4.1.1 Test crops and varieties: Supiao Boshiwang No. 5 4.1.2 Test location: Fields of Jiangsu Academy of Agricultural Sciences 4.1.3 Test design: There were 4 treatments in the test design, with 3 replicates for each treatment, a total of 12 plots, randomly grouped and arranged. The plot area was 10 m 2 , and there were 30 plants in each plot.

[0081] Treatment 1: Blank control, without applying any fertilizers and fungicides (denoted as group CK).

[0082] Treatment 2: Using the endophytic complex microbial inoculum (denoted as group S9).

[0083] Treatment 3: Using the single strain CC09 (denoted as group S1) Treatment 4: Using the single strain L89 (denoted as group S4) 4.1.4 Test methods The preparation of the endophytic complex microbial inoculum was as described in Example 2.1.4(1), and the seedling cultivation was as described in 2.2(1). After the peppers grew to the 4 - 6 leaf stage, they were hardened off for one week. Before transplanting, Treatments 2 - 4 were used for root irrigation respectively. After root irrigation and transplanting, after one week of slow seedling stage, Treatments 2 - 4 were used for root irrigation every two weeks. The dosage of the microbial inoculum was calculated as 9×10 7 cfu (i.e., 9×10 7 cfu / plant) based on the viable cell count. Root irrigation was stopped one week before pepper harvest.

[0084] 4.2 Detection methods (1) Detection of soil carbon sequestration enzyme activity: Weigh 1.5 g of the sample soil and place it in a 15 mL sterile centrifuge tube. Add 7.5 mL of pre-cooled soil remover, vortex to mix evenly, then centrifuge at 10,000×g for 10 min at room temperature, and collect the precipitate. Repeat this step twice; then add 7.5 mL of pre-cooled 0.01 mol / L phosphate buffer solution, vortex to mix evenly, centrifuge at 10,000×g for 10 min at room temperature, and collect the precipitate. Repeat this step twice; finally, add 5 mL of sterile ultrapure water, vortex to mix evenly, centrifuge at 10,000×g for 10 min at room temperature, and collect the precipitate. The precipitate is the extracted crude protein precipitate. The precipitate is placed at -70°C for standby after freeze-drying for 24 h.

[0085] Take 1.0 g of the crude protein precipitate and place it in a 10 mL pre-cooled sterile centrifuge tube. Add 6 mL of cell sample protein extraction solution, vortex to mix evenly, place it in an ice bath, and thoroughly break the cells by ultrasonic method; then centrifuge at 20,000×g for 15 min at 4°C, collect the supernatant, and repeat the centrifugation operation once to ensure that all the protein solution is collected. Add solid ammonium sulfate to 80% solubility, then place it in a shaker at 4°C and mix well. Centrifuge at 20,000×g for 20 min at 4°C, collect the precipitated protein, dissolve it with 50 μL of dissolution solution, and then store it at 0°C for later use. The enzyme content is detected by ELISA enzyme-linked method.

[0086] Configuration of soil ion remover: Configuration of soil remover: 50 mmol / L tris(hydroxymethyl)aminomethane hydrochloride buffer solution; 20 mmol / L ethylenediaminetetraacetic acid; 100 mmol / L sodium chloride; 10 g / L polyvinylpyrrolidone; adjust pH = 10.0.

[0087] Ratio of extraction solution: 100 mmol / L tris(hydroxymethyl)aminomethane hydrochloride buffer solution, 1 mmol / L dithiothreitol, 0.0002 mg / L protease inhibitor; adjust pH = 7.8. Ratio of dissolution solution: 100 mmol / L tris(hydroxymethyl)aminomethane hydrochloride buffer solution, 1 mmol / L dithiothreitol, adjust pH = 7.8. (2)Detection of organic carbon in soil (detected according to the standard of the Ministry of Ecology and Environment (HJ615 - 2011)): Add glucose standard solution, mercuric sulfate, potassium dichromate and concentrated sulfuric acid successively according to Table 4. Set the temperature of the constant heat heater to 135 °C. When the temperature rises to nearly 100 °C, open the stopper of the above-mentioned stoppered digestion glass tube and place it in the heating hole of the constant temperature heater. Start timing when the instrument temperature shows 135 °C and heat for 30 min. Then turn off the switch of the constant temperature heater, take out the stoppered digestion glass tube and cool it to room temperature in a water bath. Slowly add about 50 mL of water to each stoppered digestion glass tube and continue to cool to room temperature. Then make up the volume to 100 mL with water, stopper and shake well. Measure the absorbance at a wavelength of 585 nm using a 10 mm cuvette with water as the reference. Plot the calibration curve with the absorbance corrected to zero concentration as the ordinate and the corresponding organic carbon (mg) as the abscissa.

[0088] Table 4: Preparation of organic carbon standard curve

[0089] Accurately weigh 0.1 g of the air-dried soil sample passed through a 60-mesh sieve and carefully add it to a 100 mL stoppered digestion glass tube, avoiding sticking to the wall. Carry out digestion, cooling and volume fixation in the same way as for preparing the standard curve. Let it stand directly in the stoppered digestion glass tube until clear. Finally, take the supernatant to measure the absorbance.

[0090]

[0091] m 1 —— Mass of dry matter in the sample, g; W oc —— Content of organic carbon in the soil sample (mass fraction based on dry weight), %; A —— Absorbance of the sample digestion solution; A 0 —— Absorbance of the blank test; a —— Intercept of the calibration curve; b —— Slope of the calibration curve.

[0092] 4.3 Test results The results are as Figure 7 , applying the endophytic complex bacterial agent can significantly improve the carbon fixation enzyme activity of the soil. Compared with Treatment 1, the carbon fixation enzyme activity in Treatment 2 increased by 40.1%, 9.4% and 22.4% on the 7th, 14th and 21st days of the experiment respectively; compared with Treatment 3, the carbon fixation enzyme activity in Treatment 2 increased by 46.7%, 10.03% and 24.7%; compared with Treatment 4, the carbon fixation enzyme activity in Treatment 2 increased by 51.2%, 7.3% and 20.7%.

[0093] The endophytic complex microbial agents in plants also significantly increased the organic carbon content in the soil. Compared with treatment 1, treatment 2 increased by 18.7%, 39.3% and 18.2% on the 7th, 14th and 21st days of the experiment respectively; compared with treatment 3, treatment 2 increased by 21.8%, 42.3% and 10.6% respectively, and compared with treatment 4, treatment 2 increased by 18.3%, 42.4% and 12.1% respectively.

Claims

1. A plant endophytic composite bacterial agent, characterized in that: Including Bacillus velez Bacillus velezensis ) CC09 and Pseudomonas chlororaphis ( Pseudomonas chlororaphis )L89; The deposit number of the Bacillus velez CC09 is CGMCC No.4669. The deposit number of the Pseudomonas chlororaphis L89 is CGMCC No.32873.

2. The plant endophytic composite bacterial agent according to claim 1, characterized in that: The method comprises the following preparation steps: S1. Inoculate Bacillus Velez CC09 and Pseudomonas chlororaphis L89 into TSB liquid culture medium for cultivation, respectively, to obtain Bacillus Velez CC09 seed solution and Pseudomonas chlororaphis L89 seed solution; S2, transferring the Bacillus velez CC09 seed solution and the Pseudomonas chlororaphis L89 seed solution described in S1 into TSB liquid culture medium respectively, placing them on a shaking table for expansion culture to obtain Bacillus velez CC09 culture solution and Pseudomonas chlororaphis L89 culture solution; S3. The OD600 of the Bacillus velezensis CC09 culture solution and the Pseudomonas chlororaphis L89 culture solution described in S2 are adjusted to 0.5 respectively, and the culture solutions are compounded at a volume ratio of (1-3): (1-3) to obtain a composite culture solution, and a protective agent, an emulsifier and an antioxidant are added to the composite culture solution to obtain the plant endophyte composite bacterial agent.

3. The plant endophytic composite bacterial agent according to claim 2, characterized in that: The protective agent is gum arabic, the emulsifier is Tween 20, and the antioxidant is ascorbic acid.

4. Use of the composite bacterial agent as claimed in claim 1 in preventing and controlling pepper diseases.

5. Use of the composite bacterial agent as claimed in claim 1 in increasing the yield and improving the quality of pepper.

6. Use of the composite bacterial agent as claimed in claim 1 in increasing soil organic carbon.

7. The use according to any one of claims 4 to 6, characterized in that: The plant endophytic composite fungal agent according to claim 1 is irrigated into the roots of pepper seedlings during their growth period.

8. The use according to any one of claims 4 to 6, characterized in that: The root of the pepper seedlings is irrigated with the plant endophytic composite fungus agent once before transplanting, and the root of the pepper seedlings is irrigated with the plant endophytic composite fungus agent once every two weeks after transplanting.

9. The use according to any one of claims 4 to 6, characterized in that: The dosage of the plant endophytic composite bacterial agent is calculated as 1×10 per pepper seedling based on the number of viable bacteria. 7 -9×10 7 cfu.

Images