Salmonella manhattan phage and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to a salmonella manhattan phage and application thereof. The phage is named as vB Sal M467 and is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.46195, and the preservation date is September 29, 2024. The bacteriophage provided by the invention is separated from sewage of a farm and belongs to a tailed virus, and genomics shows that the bacteriophage belongs to a Kayfunavius genus, a non-virulence gene and a drug-resistant gene, and has safety. The biological characteristic result of the bacteriophage shows that at least eight salmonella serotypes can be split, the bacteriophage has good stability to temperature (-20 DEG C to 60 DEG C) and acid-base property (pH = 3-12), the outbreak amount is 158.83 PFU / cell, and the bacteriophage can be massively proliferated in a short time. The bacteriophage can be used for preventing and controlling salmonella in food such as lettuce and milk.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly relates to a Salmonella Manhattan phage and its application. Background Art

[0002] Foodborne pathogenic bacteria are important factors causing foodborne diseases. Among them, Salmonella is one of the most common pathogenic bacteria in global bacterial foodborne diseases and is an important threat to food safety and public health. With the widespread use and abuse of antibiotics, the multi-drug resistance of Salmonella has gradually become serious, becoming one of the important global public health problems and also bringing challenges to the field of food safety.

[0003] In recent years, food poisoning caused by Salmonella Manhattan serotype due to food contamination has been reported from time to time, and this serotype was rarely reported in the past. Therefore, the prevention and control of this newly emerging Salmonella is of great significance for ensuring food safety. Physical and chemical prevention and control means are often used in the food industry. Since these methods may have problems such as affecting food quality and chemical hazard residues, there is an urgent need for new prevention and control means to control Salmonella.

[0004] A phage is a virus that can infect bacteria. It has a wide distribution range, is easy to isolate, and has a low cost, making it a good means for the prevention and control of pathogenic bacteria. It can adsorb to the surface of pathogenic bacteria, inject its own nucleic acid into the pathogenic bacteria cells, replicate and assemble therein, and lyse the bacteria to release progeny phages, thus completing lysis. For example, Patent CN118389453B provides a phage of Salmonella with a preservation number of CGMCC NO.45962 and its application; Patent CN111100844B discloses the isolation and application of a Salmonella phage RDP-SA-17118.

[0005] At present, many studies have shown that phages can be used in animal feed, clinical treatment, and food safety prevention and control. However, due to the high specificity of phages, their antibacterial spectrum is relatively narrow, and there is a lack of research on phages against Salmonella Manhattan. Therefore, exploring efficient phages of Salmonella Manhattan can provide important materials and a basis for the research and development of food safety prevention and control agents. Summary of the Invention

[0006] Based on the problem of the lack of phages against Salmonella Manhattan described in the background art, the purpose of the present invention is to provide a Salmonella Manhattan phage and its application.

[0007] The Salmonella Manhattan phage is a Salmonella Manhattan phage vB Sal M467 (Salmonella Manhattan phage vB SalM467, belonging to the genus Kayfunavirus), has been deposited with the China General Microbiological Culture Collection Center. The deposit number is CGMCC No. 46195, and the deposit date is September 29, 2024. It can be used for the prevention and control of Salmonella Manhattan in food, drugs, and the environment.

[0008] The object of the present invention can be achieved by the following technical solutions:

[0009] One of the technical solutions of the present invention provides a Salmonella Manhattan phage.

[0010] Furthermore, the phage is a strain of Salmonella Manhattan phage vB Sal M467. The phage was deposited with the China General Microbiological Culture Collection Center on September 29, 2024. The deposit number is CGMCC No. 46195, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China. Taxonomic naming: Phage of the genus Kayfunavirus

[0011] Furthermore, the phage vB Sal M467 has a head diameter of 52.58 nm and a tail length of 20.21 nm, and belongs to the Caudovirales order in terms of morphology;

[0012] Furthermore, according to genomic analysis, the phage vB Sal M467 belongs to the phage of the genus Kayfunavirus. The total genome length is 40111 bp, and the G + C content is 50.1%. The total number of genes that can be encoded is 46, including the proteins lysozyme and holin with lysis functions. Among them, the gene sequence of lysozyme is shown in SEQ.ID.No.1, and the gene sequence of holin is shown in SEQ.ID.No.2. There is no tRNA, no virulence genes, no drug resistance genes, and it has safety.

[0013] Furthermore, the phage vB Sal M467 can be stored for a long time at -80°C; the phage vB Sal M467 maintains good activity at -20°C to 60°C; the phage vB Sal M467 maintains good activity at pH = 3 to 12, and has good thermal stability and acid-base stability.

[0014] Another technical solution of the present invention provides a microbial preparation containing the above phage vB Sal M467.

[0015] Another technical solution of the present invention provides the application of the above microbial preparation.

[0016] Further, in the application, the microbial preparation is used as an antibacterial agent, a disinfectant, a food additive, and a feed additive; the antibacterial agent, the disinfectant, the food additive, and the feed additive are used for inhibiting Salmonella in food, medicine, and the environment.

[0017] Further, the Salmonella includes any one of the following Salmonella: Salmonella typhimurium, Salmonella heidelberg, Salmonella enteritidis, Salmonella derby, Salmonella newport, Salmonella moscow, Salmonella manhattan, and Salmonella typhimurium monophasic variant.

[0018] Further, the multiplicity of infection (MOI) of the phage vB_Sal_M467 is 0.0001 to 10;

[0019] In some specific embodiments of the present invention, the phage vB Sal The optimal multiplicity of infection (MOI) of M467 is 0.0001; the latent period is 10 min, and the lysis period is 10 to 50 min.

[0020] Further, the antibacterial agent and the disinfectant further need to include pharmaceutically acceptable excipients or carriers; and are in the form of tablet dosage form, spray dosage form, powder dosage form, solution dosage form, or gel dosage form;

[0021] The pharmaceutically acceptable excipients refer to components used to convert the active compound / biological preparation into a dosage form suitable for administration, and the pharmaceutically acceptable excipients include any one of binders, fillers, stabilizers, pH regulators, antioxidants, and / or disintegrants.

[0022] Further, the phage in the antibacterial agent and the disinfectant can be added at MOI = 0.0001 to 0.01.

[0023] Further, the food additive and the feed additive further need to include food or feed-approved excipients; the food or feed-approved excipients are used to improve the flavor, taste, texture, appearance, and nutritional value of food or feed; the food or feed-approved excipients include at least any one of starch and / or modified starch (commonly used as a food thickener), cellulose and cellulose derivatives, hydrocolloids, emulsifiers, anti-caking agents, sweeteners, or colorants.

[0024] Further, the phage in the food additive and the feed additive can be added at MOI = 0.0001 to 0.01.

[0025] In some specific embodiments of the present invention, the bacteriostatic agent is a food bacteriostatic agent, and the phage in the food bacteriostatic agent can be used in a food matrix; the food matrix includes a liquid food matrix or a solid food matrix; the liquid food matrix includes any one of milk, fruit and vegetable juice, edible oil, alcoholic beverage, and honey; the solid food matrix includes any one of meat, eggs, or fruits and vegetables;

[0026] In some preferred specific embodiments of the present invention, the solid food matrix is lettuce, and the liquid food matrix is milk;

[0027] In some preferred specific embodiments of the present invention, when the food matrix is lettuce, the phage can effectively control the concentration of Salmonella in lettuce, with a maximum reduction of 2.91 log CFU / mL, indicating that the phage can be used for the prevention and control of Salmonella in solid foods;

[0028] In some preferred specific embodiments of the present invention, when the food matrix is milk, the phage can effectively control the concentration of Salmonella in milk, with a maximum reduction of 4.66 log CFU / mL, indicating that the phage can be used for the prevention and control of Salmonella in liquid foods.

[0029] The technical solution of the present invention has the following advantages / beneficial effects:

[0030] (1) The phage vB_Sal_M467 provided by the present invention has a head diameter of 52.58 nm and a tail length of 20.21 nm, and belongs to the order Caudovirales in terms of morphology; according to genomic analysis, the phage vB Sal M467 belongs to the phage of the genus Kayfunavirus.

[0031] The phage vB Sal M467 provided by the present application has a total genome length of 40111 bp and a G+C content of 50.1%; the total number of genes that can be encoded is 46, including proteins with lysis functions, lysozyme, holin, etc., without tRNA, without virulence genes, without drug resistance genes, and has safety. The biological characteristics results of the phage of the present invention show that the phage maintains good activity at -20°C to 60°C and pH = 3 to 12, and has good thermal stability and acid-base stability.

[0032] (2) The phage of the present invention is isolated from the sewage of a farm, with low isolation cost, and has a lytic effect on 8 Salmonella serotypes (including Salmonella typhimurium, Salmonella heidelberg, Salmonella enteritidis, Salmonella derby, Salmonella newport, Salmonella moscow, Salmonella manhattan, Salmonella typhimurium monophasic variant), and has broad-spectrum properties.

[0033] (3) The present invention uses a lettuce model and a milk model to evaluate the application effect of the phage vB_Sal_M467 in a food matrix. The results show that the phage vB_Sal_M467 can effectively reduce the number of Salmonella in food and can be used as a potential means for food prevention and control, providing a theoretical basis for adding phages to food. Description of the Drawings

[0034] Figure 1 It is the plaque morphology of the purified phage vB_Sal_M467 in Example 1;

[0035] Figure 2 It is the electron microscopy morphology of the phage vB_Sal_M467 in Example 3;

[0036] Figure 3 It is the temperature stability of the phage vB_Sal_M467 in Example 5;

[0037] Figure 4 It is the acid-base stability of the phage vB_Sal_M467 in Example 6;

[0038] Figure 5 It is the optimal multiplicity of infection of the phage vB_Sal_M467 in Example 7

[0039] Figure 6 It is the one-step growth curve of the phage vB_Sal_M467 in Example 8;

[0040] Figure 7 It is the genomic circular map of the phage vB_Sal_M467 in Example 9;

[0041] Figure 8 It is the inhibitory effect of the phage vB_Sal_M467 on the host bacteria under different MOIs in Example 10;

[0042] Figure 9 It is the inhibitory effect of the phage vB_Sal_M467 on the host bacteria on lettuce in Example 11;

[0043] Figure 10 It is the inhibitory effect of the phage vB_Sal_M467 on the host bacteria in milk in Example 12. Detailed Embodiments

[0044] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be described in detail below in conjunction with specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be pointed out that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made. These all belong to the protection scope of the present invention.

[0045] There are no special restrictions on the sources of all raw materials of the present invention, and those purchased on the market or prepared by conventional methods well-known to those skilled in the art are all acceptable. The LB medium used in the examples was prepared according to the conventional methods in the art, and the components included peptone (10 g / L), sodium chloride (5 g / L), yeast powder / paste (10 g / L), and water. The LB semi-solid medium and solid medium were obtained by adding agar (0.2 - 0.7%, 1.5 - 2.0% respectively) to the LB liquid medium. All instruments used in the examples, such as culture dishes, spreading rods, etc., need to be sterilized by high-temperature and high-pressure operations before use.

[0046] Example 1: Amplification, isolation and purification of phage vB_Sal_M467

[0047] (1) Treatment of water sample (sewage sample from the farm where phage was isolated):

[0048] Collect the sewage from the farm and centrifuge it (5000 x g, 10 min), and obtain the water sample through a 0.22 μm filter membrane.

[0049] (2) Amplification culture of phage:

[0050] The host bacterium used for isolating phage is Salmonella Manhattan MRL040467 preserved in the strain library (MRL040467 is the laboratory preservation number, and reference can be made to the published paper Liu T, Zhang W, Li D, et al. Isolation and characterization of Salmonella Typhimurium monophasic variant phage and its application in foods [J]. Food Research International. 2025, 203: 115852. https: / / doi.org / 10.1016 / j.foodres.2025.115852).

[0051] Pick a single colony of Salmonella enterica subsp. enterica serovar Manhattan MRL040467 and inoculate it into 5 mL of sterile LB liquid medium. Incubate it overnight with shaking at 37 °C and 180 r / min. Take 100 μL of the overnight culture and add it to 5 mL of 0.5% LB semi-solid medium, mix well, pour it onto the LB solid medium. After it solidifies, add 10 μL of the sewage sample processed in step (1). Incubate at 37 °C for 6 h and observe the formation of clear plaques.

[0052] (3) Purification of phage:

[0053] Select a single large and clear plaque on the plate, pick it up with an inoculation loop and add it to 1 mL of PBS buffer solution. Perform 10-fold serial dilutions, and take 100 μL of phage solutions at different dilution gradients and 100 μL of bacterial solutions, and culture them using the double-layer plate method (i.e., the lower layer of the plate medium is LB solid medium; the upper layer is 0.5% LB semi-solid medium) for 6 h. Select a single large and clear plaque again for picking, and repeat the above steps 5 times until clear plaques of uniform size appear, obtaining the purified phage vB Sal M467, which has been sent to the China General Microbiological Culture Collection Center, with the preservation number CGMCC No. 46195 and the preservation date September 29, 2024. In the laboratory, this phage vB Sal M467 can be stored in a 4 °C refrigerator.

[0054] Results: See Figure 1 . A strain of Salmonella enterica subsp. enterica serovar Manhattan phage was isolated and named vB Sal M467, which can form clear plaques on the double-layer agar plate.

[0055] Example 2: Enrichment and preservation of phage vB Sal M467

[0056] (1) Enrichment of phage:

[0057] Take 100 μL of the purified phage solution (phage vB Sal M467) and 100 μL of the overnight culture of the host bacterial solution (Salmonella enterica subsp. enterica serovar Manhattan MRL040467), add them to 5 mL of 0.5% LB semi-solid medium, pour it onto the LB solid medium. After it solidifies, invert it and incubate it in a 37 °C incubator for 6 h until a clear empty plate appears. Add 5 mL of PBS buffer solution to the clear empty plate, place it in a 4 °C refrigerator overnight and then collect it. Centrifuge the obtained phage solution (5000 xg, 4 min), and obtain the phage enrichment solution through a 0.22 μm filter membrane.

[0058] (2) Preservation of phage:

[0059] Add 600 μL of phage enrichment solution to the cryotube, add 600 μL of 50% glycerol, and store it in a -80 °C refrigerator.

[0060] Result: The titer of the isolated Salmonella phage was 4.3×10 8 PFU / mL. The calculation formula for phage titer is: N = Y·X·10, (N: titer value, Y: average number of plaques per plate, X: dilution factor). The titer calculation method in the following examples refers to this example.

[0061] Example 3: Electron microscopic morphology of phage vB Sal M467

[0062] (1) Proliferation of phage:

[0063] For convenient electron microscopic observation of phage, it is necessary to proliferate the phage to improve the phage titer. Dilute the phage enrichment solution obtained in Example 2(1) by 10-fold serial dilution (here, 10-fold serial dilution is calculated by C 1 V 1 = C 2 V 2 (C 1 : titer before dilution, V 1 : volume before dilution, C 2 : titer after dilution, V 2 : volume after dilution), in this experiment, 20 μL of phage enrichment solution + 180 μL of PBS buffer were used for 10-fold serial dilution), pour double-layer plates, select the plate with a little bacterial lawn, add 5 mL of PBS buffer to the plate, place it at 4 °C overnight, collect the phage solution and filter it through a 0.22 μm filter membrane, measure the titer by the double-layer plate method, and repeat 1 - 2 times.

[0064] (2) Electron microscopic observation of phage: Take the phage proliferation solution for electron microscopic observation.

[0065] Result: See Figure 2 . The electron microscopic morphology of the phage vB Sal M467 shows that the head diameter is 52.58 nm and the tail length is 20.21 nm, and it belongs to the Caudovirales order in morphology.

[0066] Example 4: Lysis spectrum of phage vB Sal M467

[0067] (1) Activate 28 strains of Salmonella that have been stored in this laboratory for a long time respectively. The activation operation is the process of restoring Salmonella from the storage state to the physiologically active state, which is a conventional operation in this field.

[0068] (2) Take 100 μL of the activated Salmonella bacterial liquid in (1) and add it to 0.5% LB semi-solid medium, mix well, pour it onto the LB solid medium, wait for it to solidify, then add the phage-like liquid dropwise, and culture it in a 37 °C incubator for 6 h to observe whether clear plaques appear.

[0069] Results: As shown in Table 1, among the 28 strains of Salmonella selected in the experiment, the phage vB Sal M467 can lyse 19 strains of Salmonella (including 8 different serotypes), and the lysis rate for the tested strains is 67.86% (i.e., 19 strains / 28 strains), showing good broad-spectrum properties and being a broad-spectrum phage.

[0070] Table 1 Lysis effect of phage vB Sal M467 on 28 strains of Salmonella preserved in the laboratory

[0071]

[0072]

[0073]

[0074]

[0075] In the table, the meanings of + and - for the lysis effect are: + indicates having a lysis effect, and - indicates not having a lysis effect.

[0076] Example 5: Temperature stability of phage vB Sal M467

[0077] Take 100 μL of the phage liquid and add it to 900 μL of PBS buffer. Incubate it at different temperatures (-20 °C, 4 °C, 25 °C, 37 °C, 50 °C, 60 °C, 70 °C, 80 °C) for 1 h, perform 10-fold serial dilutions, take 100 μL of the phage liquid samples at different dilution gradients and mix them with 100 μL of the host bacteria, then add them to 5 mL of 0.5% LB semi-solid medium to measure their titers by the double-layer plate method, and repeat 3 times.

[0078] Results: See Figure 3 . The phage vB Sal M467 provided in this application has good temperature stability and can have good activity at -20 °C to 60 °C.

[0079] Example 6: pH stability of phage vB SalM467

[0080] HCl and NaOH were added to the PBS buffer to adjust the pH, which was adjusted to pH = 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 respectively. 900 μL was taken from each, 100 μL of phage solution was added to each, incubated at 37 °C for 1 h, serially diluted 10-fold, 100 μL of samples at different dilution gradients was taken and added to 5 mL of 0.5% LB semi-solid medium together with 100 μL of host bacteria, and the titer was determined by the double-layer plate method, repeating 3 times.

[0081] Results: See Figure 4 . The phage vB SalM467 provided in this application has good pH stability and can maintain its activity at pH = 3 - 12.

[0082] Example 7: Optimal multiplicity of infection (MOI) of phage vB Sal M467

[0083] (1) Adjust the host bacteria concentration to 1×10 7 CFU / mL.

[0084] (2) Dilute the phage solution according to the multiplicity of infection with the host bacteria (phage titer: target bacteria concentration): 0.0001, 0.001, 0.01, 0.1, 1, 10, add an equal amount, and add it to 10 mL of LB liquid medium, culture in a shaker at 37 °C for 5 h, centrifuge the sample (4000 r, 5 min), and obtain pure phage solution through a 0.22 μm filter membrane.

[0085] (3) Serially dilute the obtained phage solution, take 100 μL of phage solution at different dilution gradients and add it to 5 mL of 0.5% LB semi-solid medium together with 100 μL of host bacteria, and determine the titer by the double-layer plate method. The one with the highest titer is the optimal multiplicity of infection of the phage, repeating three times.

[0086] Results: See Figure 5 . The optimal multiplicity of infection of the phage is 0.0001, and the titer reached by phage proliferation is the highest at this time.

[0087] Example 8: One-step growth curve of phage vB Sal M467

[0088] (1) Adjust the host bacteria concentration to 1×10 8 CFU / mL.

[0089] (2) Mix 1 mL of the host bacterium with 1 mL of the phage solution at the optimal multiplicity of infection (0.0001), let it stand and incubate in a 37°C incubator for 10 min, centrifuge (5000 xg, 4 min), discard the supernatant, add 5 mL of LB liquid medium to resuspend, and place it in a 37°C shaker for shaking culture. Take samples at regular intervals. For the first 100 min, take samples every 10 min, and for 100 - 160 min, take samples every 20 min. Measure its titer and repeat three times.

[0090] Using time as the abscissa and phage titer as the ordinate, make a one-step growth curve, as shown in Figure 5 .

[0091] Calculate the burst size of the phage. The formula is: burst size (PFU / cell) = phage titer at the end of the burst (PFU / mL) / concentration of host bacteria at the initial stage of infection (CFU / mL).

[0092] Results: As shown in Figure 6 . The latent period (L) of this phage is 10 min, the lysis period (R) is 10 - 50 min, and the phage titer is stable (S) after 50 min. By calculation, the burst size of the phage is 158.83 PFU / cell.

[0093] Example 9: Genomic analysis of phage vB_Sal_M467

[0094] Send the purified phage solution in Example 1 or 2 to the company (Shanghai Vena Biotechnology Co., Ltd.) for detection.

[0095] Canu (https: / / github.com / marbl / canu), Flye (https: / / github.com / fenderglass / Flye), and SPAdes (https: / / github.com / ablab / spades) were used for sequencing assembly; Bowtie2 (http: / / bowtie-bio.sourceforge.net / bowtie2 / index.shtml) was used for analyzing the GC-depth of phage genes; Glimmer (http: / / ccb.jhu.edu / software / glimmer / index.shtml) was used for CDS prediction; barrnap (https: / / github.com / tseemann / barrnap / ) was used for rRNA prediction; tRNA-scan-SE (http: / / trna.ucsc.edu / software / ) was used for tRNA prediction; BLAST+ (ftp: / / ftp.ncbi.nlm.nih.gov / blast / executables / blast+ / 2.11.0 / ) was used for database annotation comparison analysis; NR Database (ftp: / / ftp.ncbi.nlm.nih.gov / blast / db / ), Swiss-prot (https: / / web.expasy.org / docs / swiss-prot_guideline.html), eggNOG (http: / / eggnogdb.embl.de / # / app / home), KEGG (http: / / www.genome.jp / kegg / ), Blast2go (https: / / www.blast2go.com / ), and Pfam (http: / / pfam.xfam.org / ) were used for NR annotation, Swiss-prot annotation, COG annotation, KEGG annotation, GO annotation, and Pfam annotation, respectively; VFDB (http: / / www.mgc.ac.cn / VFs / main.htm) was used for virulence gene prediction; TCDB (http: / / www.tcdb.org / ) was used for transporter prediction; and CARD (http: / / arpcard.Mcmaster.ca) was used for drug resistance gene analysis.

[0096] Results: See Figure 7The total genome length of the phage is 40,111 bp, and the G+C content is 50.1%. The total number of genes that can be encoded is 46, including proteins with lysis functions such as lysozyme and holin. Among them, the gene sequence of lysozyme is shown in SEQ.ID.No.1, and the gene sequence of holin is shown in SEQ.ID.No.2; there is no tRNA, no virulence genes, no drug resistance genes, and it has safety.

[0097] Example 10: Bacteriophage vB Sal In vitro antibacterial effect of M467 at different optimal multiplicity of infection (MOI)

[0098] (1) Adjust the concentration of the host bacteria to 10 6 CFU / mL.

[0099] (2) Add 100 μL of phage liquid and 100 μL of host bacteria liquid to the honeycomb plate according to different MOIs. The control group adds 100 μL of LB liquid medium and 100 μL of host bacteria liquid. Place the honeycomb plate in the automatic microbial growth curve analyzer Bioscreen C to measure the absorbance value of each sample at 600 nm, record it every 30 min, and observe for 12 h in total. Repeat three times.

[0100] Results: See Figure 8 . Compared with the control group (WT group, control group in the figure), when MOI = 0.0001 - 10, the phage can effectively inhibit the growth of Salmonella within 8 h, and has a prevention and control effect on Salmonella.

[0101] Example 11: Antibacterial application of bacteriophage vB Sal M467 in lettuce

[0102] (1) Treatment of lettuce. Disinfect the lettuce with alcohol and ultraviolet light for 1 h, and cut it into pieces of 1 cm × 1 cm.

[0103] (2) Antibacterial effect of bacteriophage vB Sal M467

[0104] Control group: Drop 100 μL of host bacteria in the logarithmic phase on the surface of the lettuce sample, let it stand for 10 min, and then drop 100 μL of PBS buffer solution.

[0105] Experimental group: Drop 100 μL of host bacteria in the logarithmic phase on the surface of the lettuce sample, let it stand for 10 min, and drop 100 μL of phage dilution according to the optimal multiplicity of infection (0.0001).

[0106] Cultivate at 25 °C, sample regularly for counting (0, 2, 6, 10, 24 h), place the samples in 1 mL of PBS buffer solution and vortex for 2 min after sampling. After vortexing, determine the concentration of Salmonella in the PBS buffer solution, and draw a bar chart with 3 replicates for each group.

[0107] Results: See Figure 9 . In the figure, *** indicates 0.0001 < p < 0.001, ** indicates 0.001 < p < 0.01, and ns indicates no significant difference. Calculate the concentration of Salmonella by the nine-point method, and the formula is N = X·Y·50 (N: Salmonella concentration, X: average number of Salmonella colonies, Y: dilution factor). The results show that compared with the control group, the phage can effectively control the concentration of Salmonella in lettuce, with a maximum reduction of 2.91 log, indicating that this phage can be used for the prevention and control of Salmonella in solid foods.

[0108] Example 12: Bacteriostatic application of phage vB_Sal_M467 in milk

[0109] (1) Treatment of milk. Irradiate the milk with ultraviolet light for 1 h.

[0110] (2) Bacteriostatic effect of phage vB_Sal_M467

[0111] Control group: Add 2400 μL of sterile milk to a centrifuge tube, add 300 μL of logarithmic-phase bacterial liquid, let it stand for 10 min, and add 300 μL of PBS buffer solution as a control.

[0112] Test group: Add 2400 μL of sterile milk to a centrifuge tube, add 300 μL of logarithmic-phase bacterial liquid, let it stand for 10 min, and add 300 μL of phage dilution solution according to the optimal multiplicity of infection (0.0001).

[0113] Cultivate at 25 °C, sample regularly (0, 2, 6, 10, 24 h), calculate the concentration of Salmonella by the nine-point counting method, with 3 replicates for each group.

[0114] Results: See Figure 10 . In the figure, *** indicates 0.0001 < p < 0.001, and ns indicates no significant difference. Calculate the concentration of Salmonella by the nine-point counting method, and the formula is N = X·Y·50 (N: Salmonella concentration, X: average number of Salmonella colonies, Y: dilution factor). The results show that compared with the control group, the phage can effectively control the concentration of Salmonella in milk, with a maximum reduction of 4.66 log, indicating that this phage can be used for the prevention and control of Salmonella in liquid foods.

[0115] The above description of the embodiments is to enable those of ordinary skill in the art to understand and use the invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative efforts. Therefore, the present invention is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art without departing from the scope of the present invention should be within the protection scope of the present invention.

[0116] The sequences involved in this application are as follows:

[0117] SEQ.ID.No.1 (gene sequence of lysozyme) is:

[0118] ATGGGGAGTAAGGTACAATTCAAACCACGTCAAGCTACAGACGCAATCTTCGTCCACTGTTCAGCGACACCGCCGACTATGGACATTGGTCGTGAGACCATTGAGATGTGGCATAAACAGCAGGGCTGGCTGGCAATTGGCTACCACTTTATCATCAAGCGTGATGGCACTGTGGAAGAGGGTCGACCGGTCAATGTCGTAGGGTCACACGTTAAGGATTGGAACTCACGGTCCGTAGGCGTCTGCCTTGTAGGTGGGGTCAACGCTAAGGGTCAGTTTGAAGCTAACTTCACTCCAGCCCAGATGAACTCCCTTCGCAACAAGCTGGATGACCTGAAGGTCCTGTATCCTCAGGCAGAAATCAAAGCACACCATGACATAGCACCGAAGGCGTGTCCAAGTTTCGACTTGCAACGCTGGTTGACTACCAACGAACTGGTCACTTCCGACCACGGTTAA

[0119] SEQ.ID.No.2 (gene sequence of holin) is:

[0120] ATGATTGAGTTCGACTTCAAGAATGAGGTCCTAAAAGCCTCGCCTATCGTCGGGACCGCTGCGGCTGATGGTGCCAGTCGGTTCTTCTTTGGGTTAACACTCAACGAATGGTTCTACGTCGCTGCTATCGCGTACACCGTGGTGCAGATTGGCGTCCTAATTTACAAGACGATTAAGAGCGGAGGTAAGACATGA。

Claims

1. A Manhattan Salmonella phage vB Sal M467, characterized in that The bacteriophage was deposited in the China General Microbiological Culture Collection Center on September 29, 2024, with the deposit number CGMCC No.46195.

2. A microbial preparation, characterized in that: The invention comprises the virulent bacteriophage vB Sal M467 of Salmonella Manhattan as claimed in claim 1.

3. The use of a microbial preparation as claimed in claim 2, characterized in that: As antibacterial agent, disinfectant, food additive and feed additive.

4. The use of a microbial preparation according to claim 3, characterized in that: The antibacterial agent, disinfectant, food additive and feed additive are used for inhibiting salmonella in food, medicine and environment.

5. The use of a microbial preparation according to claim 4, characterized in that: The Salmonella includes any one of the following Salmonella: Salmonella typhimurium, Salmonella Heidelberg, Salmonella Enteritidis, Salmonella Derby, Salmonella Newport, Salmonella Moscow, Salmonella Manhattan, and Salmonella typhimurium monophasic variant.

6. The use of a microbial preparation according to claim 4, characterized in that: The antibacterial agent and disinfectant include pharmaceutically acceptable adjuvants or carriers.

7. The use of a microbial preparation according to claim 4, characterized in that: The antibacterial agent and disinfectant are in the form of tablets, sprays, powders, solutions and gels.

8. The use of a microbial preparation according to claim 4, characterized in that: The bacteriophage is added to the bacteriostatic agent and disinfectant at MOI=0.0001-0.

01.

9. The use of a microbial preparation according to claim 4, characterized in that: The food additives and feed additives include auxiliary materials approved for food or feed.

10. The use of a microbial preparation according to claim 4, characterized in that: The bacteriophage is added to the food additive and feed additive at MOI=0.0001-0.01.

Images