Combination module for improving yield of actinomycetes polyketone natural products and construction and application of recombinant bacteria containing combination module

Abstract

The invention discloses a combined module for improving the yield of actinomycetes polyketone natural products and construction and application of recombinant bacteria containing the combined module, and belongs to the technical field of genetic engineering. In order to improve the yield of natural products such as polyketone, non-ribosome peptide and the like, the invention provides a combined module capable of improving the yield of actinomycetes natural products by combining and transforming a synthesis pathway of CoASH and a post-modification pathway of PPTase through a metabolic engineering strategy, and the module consists of CoASH cofactor synthesis module elements SCoaAR106A and SCoaD and a PPTase post-modification module element HPC3. By constructing a recombinant vector and recombinant bacteria containing the combined module, the yield of natural products such as actinomycetes polyketone, polyether and non-ribosomal peptide can be effectively improved by over-expression of the combined module.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a combined module for increasing the yield of polyketide natural products of actinomycetes, and the construction and application of a recombinant bacterium containing the same. Background Art

[0002] Polyketide compounds are a class of natural products with diverse structures and have a wide range of biological and pharmacological activities. The biosynthesis of polyketide compounds is assembled by successive multiple rounds of Claisen decarboxylative condensation between activated malonyl derivatives and acyl thioesters. In this process, various acyl-CoA precursors and polyketide synthase modules play important roles. Coenzyme A (CoASH) is the most common intermediate substrate in organisms and plays a central role as an acyl carrier and a carbonyl activating group in many biotransformations of central metabolism. However, in addition to this, during polyketide synthesis, CoASH not only provides cofactors for precursor synthesis and activates substrates, but also serves as a donor of the 4'-phosphopantetheine group, which is converted from an inactive acyl carrier protein (apo-ACP) to an active acyl carrier protein (holo-ACP) under the catalysis of phosphopantetheinyl transferase (PPTase). Therefore, an adequate supply of CoASH is crucial for the biosynthesis of polyketide compounds.

[0003] Phosphopantetheinyl transferase is an enzyme superfamily necessary for the synthesis of various compounds such as polyketides, polyethers, and non-ribosomal peptides. PPTases can be divided into three types according to their evolutionary characteristics: Acps type (about 120 aa, acting on the acyl carrier protein of type II FAS), Sfp type (twice the size of Acps, acting on the carrier proteins of type I PKS and NRPS), and the integrated type (incorporated as a domain at the carboxyl terminus of the fatty acid α subunit, catalyzing the autophosphoesterase acylation of the carrier protein at the amino terminus of the same polypeptide). The number, type, and efficiency of PPTases vary in different strains. The reason for this phenomenon may be precisely because actinomycetes have the potential to synthesize different types of secondary metabolites, and the evolutionary differences are generated to adapt to the substrate tolerance they need. Therefore, the universality, extensive functions, and diverse catalytic characteristics of PPTases determine its importance. The activation of ACP catalyzed by PPTase is an essential key step in the biosynthesis of polyketide compounds. Therefore, modifying the CoASH synthesis pathway and the PPTase post-modification pathway is of great significance for increasing the yields of compounds such as polyketides, polyethers, and non-ribosomal peptides of actinomycetes. Summary of the Invention

[0004] To improve the production of natural products such as polyketides, polyethers, and non-ribosomal peptides by actinomycetes, the present invention combines and modifies the synthesis pathway of CoASH and the post-modification pathway of PPTase through metabolic engineering strategies, providing a combination module that can increase the production of natural products by actinomycetes. This module consists of the CoASH cofactor synthesis module element SCoaA R106A , SCoaD, and the PPTase post-modification module element HPC3. By constructing a recombinant vector and a recombinant bacterium containing this combination module, it was found that overexpression of this combination module can effectively increase the production of natural products such as polyketides, polyethers, and non-ribosomal peptides by actinomycetes.

[0005] To solve the above technical problems and achieve the corresponding technical effects, the present invention provides the following technical solutions:

[0006] The first object of the present invention is to provide a combination module for increasing the production of natural products by actinomycetes. The combination module consists of a CoASH cofactor synthesis module and a PPTase post-modification module. The CoASH cofactor synthesis module consists of the elements SCoaA R106A and SCoaD. The nucleotide sequences of SCoaA R106A and SCoaD are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. The PPTase post-modification module is the element HPC3, and its nucleotide sequence is shown in SEQ ID NO.3; the natural products are polyketide compounds, polyether compounds, or non-ribosomal peptide compounds.

[0007] The second object of the present invention is to provide a recombinant vector containing the above combination module. The starting vector of the recombinant vector is pSET152. The promoter actⅡ-orf4p fragment is amplified using the genome of Streptomyces coelicolor M145 as a template. The promoter actⅡ-orf4p fragment is integrated with the elements SCoaA R106A , SCoaD, and HPC3 in the combination module into the starting vector to obtain the recombinant vector pSET152::orf4 SAD HPC3.

[0008] The third object of the present invention is to provide the application of the above recombinant vector pSET152::orf4 SAD HPC3 in increasing the production of actinorhodin by Streptomyces coelicolor.

[0009] The fourth object of the present invention is to provide a recombinant vector containing the above combination module. The starting vector of the recombinant vector is pSET152::ermEp*. The elements SCoaA R106A , SCoaD, and HPC3 in the combination module are integrated into the starting vector to obtain the recombinant vector pSET152::ermEp*SAD HPC3.

[0010] The fifth object of the present invention is to provide the application of the above recombinant vector pSET152::ermEp*SAD HPC3 in increasing the yield of actinomycete natural products, and the natural products are polyketide compounds, polyether compounds or non-ribosomal peptide compounds.

[0011] The sixth object of the present invention is to provide a recombinant bacterium containing the above recombinant vector pSET152::orf4 SAD HPC3, and the recombinant bacterium is obtained by taking Streptomyces coelicolor M145 as the starting strain and introducing the recombinant vector pSET152::orf4 SAD HPC3 into the starting strain.

[0012] The seventh object of the present invention is to provide the application of the above recombinant bacterium in increasing the yield of actinorhodin in Streptomyces coelicolor.

[0013] The eighth object of the present invention is to provide a recombinant bacterium containing the above recombinant vector pSET152::ermEp*SAD HPC3, and the recombinant bacterium is obtained by taking Streptomyces bingchenggensis BC-101-4, Streptomyces avermitilis S0, Streptomyces tsukubaensis NRRL18488, Streptomyces rimosus M4018, Streptomyces venezuelae ISP5230, Streptomyces albus IPPDNR, Saccharopolyspora spinosa NRRL 18395 or Streptomyces roseosporus NRRL 11379 as the starting strain and introducing the recombinant vector pSET152::ermEp*SAD HPC3 into the starting strain.

[0014] The ninth object of the present invention is to provide the application of the above recombinant bacterium in increasing the yield of actinomycete natural products, and the natural products are polyketide compounds, polyether compounds or non-ribosomal peptide compounds.

[0015] In one embodiment of the present invention, when the starting strain is Streptomyces bingchenggensis BC-101-4, the recombinant bacterium is used to increase the production of milbemycin or nanchangmycin; when the starting strain is Streptomyces avermitilis S0, the recombinant bacterium is used to increase the production of avermectin; when the starting strain is Streptomyces tsukubaensis NRRL 18488, the recombinant bacterium is used to increase the production of FK506; when the starting strain is Streptomyces rimosus M4018, the recombinant bacterium is used to increase the production of oxytetracycline; when the starting strain is Streptomyces venezuelae ISP5230, the recombinant bacterium is used to increase the production of jadomycin; when the starting strain is Streptomyces albus IPPDNR, the recombinant bacterium is used to increase the production of daunorubicin; when the starting strain is Saccharopolyspora spinosa NRRL 18395, the recombinant bacterium is used to increase the production of spinosad; when the starting strain is Streptomyces roseosporus NRRL 11379, the recombinant bacterium is used to increase the production of daptomycin.

[0016] Advantages of the present invention:

[0017] Based on the metabolic engineering strategy combination to modify the CoASH synthesis pathway and the PPTase post-modification pathway, the present invention increases the intracellular cofactor CoASH content of the strain to meet the demand for CoASH cofactor in the secondary metabolite synthesis process. At the same time, by strengthening the PPTase post-modification pathway, more precursors and cofactors are pulled towards polyketide biosynthesis, providing a combination module that can effectively increase the production of polyketide compounds, polyether compounds or non-ribosomal peptide compounds in actinomycetes. This combination module consists of a CoASH cofactor synthesis module and a PPTase post-modification module. The CoASH cofactor synthesis module consists of elements SCoaA R106A and SCoaD, and the PPTase post-modification module is element HPC3.

[0018] By constructing recombinant vectors and recombinant strains containing the above combination modules, a total of 8 high-yield recombinant strains carrying the combination modules were obtained, namely Streptomyces coelicolor M145 / ADH, Streptomyces bcunicola BC-101-4 / ADH, Streptomyces avermitilis S0 / ADH, Streptomyces tsukubaensis NRRL 18488 / ADH, Streptomyces rimosus M4018 / ADH, Streptomyces venezuelae ISP5230 / ADH, Streptomyces albus IPPDNR / ADH, Saccharopolyspora spinosa NRRL 18395 / ADH, and Nocardiopsis dassonvillei NRRL 11379 / ADH. Among them, the actinorhodin yield of the obtained recombinant strain Streptomyces coelicolor M145 / ADH was increased by 54.17% compared with the original strain M145, reaching 141.12 mg / L; the milbemycin yield of Streptomyces bcunicola BC-101-4 / ADH was increased by 39.11% compared with the original strain BC-101-4, reaching 1352.43 mg / L, and at the same time, the nanchangmycin yield was increased by 24.90% compared with the original strain BC-101-4, reaching 1400.79 mg / L; the avermectin B 1a yield of Streptomyces avermitilis S0 / ADH was increased by 38.50% compared with the original strain S0, reaching 3.11 g / L; the FK506 yield of Streptomyces tsukubaensis NRRL 18488 / ADH was increased by 45.58% compared with the original strain NRRL 18488, reaching 83.70 mg / L; the oxytetracycline yield of Streptomyces rimosus M4018 / ADH was increased by 48.52% compared with the original strain M4018, reaching 1.94 g / L; the jadomycin yield of Streptomyces venezuelae ISP5230 / ADH was increased by 15.51% compared with the original strain ISP5230, reaching 288.64 μg / mL, the daunorubicin yield of Streptomyces albus IPPDNR / ADH was increased by 56.67% compared with the original strain IPPDNR, reaching 38.20 μg / mL, the spinosyn yield of Saccharopolyspora spinosa NRRL18395 / ADH was increased by 44.64% compared with the original strain NRRL 18395, reaching 41.66 mg / L; the daptomycin yield of the recombinant strain Nocardiopsis dassonvillei NRRL 11379 / ADH was increased by 37.19% compared with the original strain NRRL 11379, reaching 334.75 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram for the construction of recombinant vector pSET152::orf4 SAD HPC3;

[0020] Figure 2 Schematic diagram for the construction of recombinant vector pSET152::ermEp*SAD HPC3;

[0021] Figure 3 Detection result graph of the actinorhodin production of Streptomyces coelicolor recombinant strains M145 / ADH, M145 / C and the original strain M145;

[0022] Figure 4 Detection result graph of the milbemycin and nanchangmycin production of Streptomyces bingchenggensis recombinant strains BC-101-4 / ADH, BC-101-4 / C and the original strain BC-101-4; among them, Figure 4 A in is the detection result graph of the milbemycin production, Figure 4 B in is the detection result graph of the nanchangmycin production;

[0023] Figure 5 Detection result graph of the avermectin B production of Streptomyces avermitilis recombinant strains S0 / ADH, S0 / C and the original strain S0 1a ;

[0024] Figure 6 Detection result graph of the FK506 production of Streptomyces tsukubaensis recombinant strains NRRL 18488 / ADH, NRRL 18488 / C and the original strain NRRL18488;

[0025] Figure 7 Detection result graph of the oxytetracycline production of Streptomyces rimosus recombinant strains M4018 / ADH, M4018 / C and the original strain M4018;

[0026] Figure 8 Detection result graph of the geldanamycin production of Streptomyces venezuelae recombinant strains ISP5230 / ADH, ISP5230 / C and the original strain ISP5230;

[0027] Figure 9 Detection result graph of the daunorubicin production of Streptomyces albus recombinant strains IPPDNR / ADH, IPPDNR / C and the original strain IPPDNR;

[0028] Figure 10 Detection result graph of the spinosad production of Saccharopolyspora spinosa recombinant strains NRRL 18395 / ADH, NRRL 18395 / C and the original strain NRRL18395;

[0029] Figure 11 Detection result graph of the daptomycin production of Streptomyces roseosporus recombinant strains NRRL 11379 / ADH, NRRL 11379 / C and the original strain NRRL11379. Detailed implementation method

[0030] To make the objectives, technical solutions, and advantages of the present invention more clearly understood, the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. It should be noted that the embodiments mentioned below are only applicable to explaining the present invention, but not for limiting the scope of the present invention. The embodiments mentioned below are only a part of the embodiments of the present invention, not all embodiments. In the art, if other technicians do not make creative efforts, the embodiments they obtain are protected by the present invention.

[0031] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified. The materials, reagents, culture media, and instruments used are all conventional materials, reagents, culture media, and instruments in the art unless otherwise specified, and those skilled in the art can obtain them through commercial channels. For the molecular biology experimental operations such as PCR amplification, restriction enzyme digestion and ligation, and transformation involved in the present invention, unless otherwise specified, they are all conventional experimental operations in the art or can be carried out in accordance with the product instructions of the corresponding reagents.

[0032] Streptomyces bingchenggensis BC-101-4 is disclosed in the following literature: Wang X, Wang X, Xiang W (2009) Improvement of milbemycin-producing Streptomyces bingchenggensis by rational screening of ultraviolet- and chemically induced mutants. World J Microbiol Biotechnol 25: 1051-1056.

[0033] Streptomyces coelicolor M145 is disclosed in the following literature: Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces genetics. John Innes Foundation, Norwich.

[0034] Streptomyces avermitilis S0 is disclosed in the patent with the application number CN202310480048.6 and the invention title "A sugar transporter TP6568 and its application in the transformation of high-yield Streptomyces".

[0035] Streptomyces rimosus M4018 was disclosed in the following literature: Yin Shouliang, Lin Zhiwei, Zhang Yuxiu, et al. Engineering Streptomyces rimosus to improve oxytetracycline production [J]. China Biotechnology, 2016, 36(7): 72-82. DOI: 10.13523 / j.cb.20160711.

[0036] Saccharopolyspora spinosa NRRL 18395 was disclosed in the following literature: Guo Hang, Bai Tingli, Tao Meifeng. Cloning and assembly of rhamnose and forosamine synthesis genes in Saccharopolyspora spinosa [J]. Journal of Huazhong Agricultural University, 2012, 31(3): 298-302. DOI: 10.3969 / j.issn.1000-2421.2012.03.007.

[0037] Streptomyces venezuelae ISP5230 was disclosed in the following literature: He Jianyong, Yao Xinsheng, LEO.C.VINING. Cloning of chloramphenicol biosynthesis genes in Streptomyces venezuelae [J]. Journal of Shenyang Pharmaceutical University, 2006, 23(11): 731-734. DOI: 10.3969 / j.issn.1006-2858.2006.11.013.

[0038] Streptomyces tsukubaensis NRRL 18488 was disclosed in the following literature: Ma Dongxu. Improving tacrolimus production by regulating the expression of BulZ and its target gene-encoded proteins [D]. Tianjin: Tianjin University, 2018. DOI: 10.7666 / d.D01679402.

[0039] Streptomyces albus IPPDNR was constructed by heterologously expressing the daunorubicin synthesis gene cluster using Streptomyces albus Del14 as the starting strain. Streptomyces albus Del14 was disclosed in the following literature: MYRONOVSKYI M, B, NADMID S, et al. Generation of a cluster - free Streptomyces albus chassis strains for improved heterologous expression of secondary metabolite clusters[J]. Metabolic Engineering, 2018, 49: 316 - 24. The synthetic gene cluster of daunorubicin was disclosed in the following literature: Lomovskaya N, Otten SL, Doi - Katayama Y, et al. Doxorubicin overproduction in Streptomyces peucetius: cloning and characterization of the dnrU ketoreductase and dnrV genes and the doxA Cytochrome P - 450 hydroxylase gene. J Bacteriol. 1999; 181(1): 305 - 318. The construction method of Streptomyces albus IPPDNR is as follows: construct an over - expression integration plasmid pSET156 - DNR containing the daunorubicin synthetic gene cluster, transform the over - expression integration plasmid into Escherichia coli, and then introduce the over - expression integration plasmid into the starting strain Del14 through a genus - indirect conjugation transfer experiment to obtain Streptomyces albus IPPDNR.

[0040] Streptomyces roseosporus NRRL 11379 was disclosed in the following literature: Yu Jisan, Hong Kui, Lin Haipeng, et al. Optimization of fermentation medium for the production of daptomycin precursor A21978C by Streptomyces roseosporus NRRL11379[J]. Journal of Anhui Agricultural Sciences, 2008, 36(19): 7974 - 7976. DOI: 10.3969 / j.issn.0517 - 6611.2008.19.012.

[0041] The above - mentioned strains are all stored in this laboratory.

[0042] The strain information involved in the following examples is shown in Table 1, the primer information is shown in Table 2, and the plasmid information is shown in Table 3.

[0043] Table 1 Strain information involved in the examples

[0044]

[0045]

[0046] Primer information involved in the examples in Table 2

[0047]

[0048] Note: Bold characters indicate homologous arm sequences; underlined characters indicate restriction enzyme sites.

[0049] Plasmid information involved in the examples in Table 3

[0050]

[0051] Example 1: Construction of a recombinant vector containing a CoASH cofactor synthesis module and a PPTase post-modification module

[0052] Based on the pSET152 vector, recombinant vectors of the CoASH cofactor synthesis module and the PPTase post-modification module for different strains were constructed. The elements CoaA R106A and CoaD involved in the CoASH cofactor synthesis module are both derived from Escherichia coli, and the original sequences can be queried in Wei et al. ACS Synth Biol. 2019, 17; 8(5). doi: 10.1021 / acssynbio.9b00042. The elements SCoaA R106A and SCoaD used in the present invention were codon-optimized in Streptomyces based on the original sequences. The nucleotide sequence of SCoaA R106A after codon optimization is shown in SEQ ID NO.1, and the nucleotide sequence of SCoaD is shown in SEQ ID NO.2. The element of the PPTase post-modification module is HPC3 derived from Streptomyces corchorusii, and the nucleotide sequence is shown in SEQ ID NO.3.

[0053] SEQ ID NO.1:

[0054] ATGTCCATCAAGGAGCAGACCCTGATGACCCCGTACCTGCAGTTCGACCGCAACCAGTGGGCCGCCCTGCGCGACTCCGTCCCGATGACCCTGTCCGAGGACGAGATCGCCCGCCTGAAGGGCATCAACGAGGACCTGTCCCTGGAGGAGGTCGCCGAGATCTACCTGCCCCTGTCGCGCCTGCTGAACTTCTACATCTCCTCCAACCTGCGCCGGCAGGCCGTCCTGGAGCAGTTCCTGGGCACCAACGGCCAGCGCATCCCGTACATCATCTCCATCGCCGGCTCCGTCGCCGTCGGCAAGTCCACCACCGCCGCCGTCCTGCAGGCCCTGCTGTCCCGCTGGCCGGAGCACCGCCGCGTCGAGCTGATCACCACCGACGGCTTCCTGCACCCCAACCAGGTCCTGAAGGAGCGCGGCCTGATGAAGAAGAAGGGCTTCCCCGAGTCCTACGACATGCACCGCCTGGTCAAGTTCGTCTCCGACCTGAAGTCCGGCGTCCCGAACGTCACCGCCCCCGTCTACTCCCACCTGATCTACGACGTGATCCCGGACGGCGACAAGACCGTCGTGCAGCCCGACATCCTGATCCTGGAGGGCCTGAACGTGCTGCAGTCCGGCATGGACTACCCGCACGACCCCCACCACGTCTTCGTCTCCGACTTCGTCGACTTCTCCATCTACGTCGACGCCCCCGAGGACCTGCTGCAGACCTGGTACATCAACCGCTTCCTGAAGTTCCGCGAGGGCGCCTTCACCGACCCCGACTCCTACTTCCACAACTACGCCAAGCTGACCAAGGAGGAGGCCATCAAGACCGCCATGACCCTGTGGAAGGAGATCAACTGGCTGAACCTGAAGCAGAACATCCTGCCCACCCGCGAGCGCGCCTCCCTGATCCTGACCAAGTCCGCCAACCACGCGGTCGAGGAGGTCCGCCTGCGCAAGTGA

[0055] SEQ ID NO.2:

[0056] ATGCAGAAGCGCGCCATCTACCCCGGCACCTTCGACCCGATCACCAACGGCCACATCGACATCGTCACCCGCGCCACCCAGATGTTCGACCACGTCATCCTGGCCATCGCCGCCTCCCCCTCCAAGAAGCCGATGTTCACCCTGGAGGAGCGCGTCGCCCTGGCCCAGCAGGCCACCGCCCACCTGGGCAACGTCGAGGTCGTCGGCTTCTCCGACCTGATGGCCAACTTCGCCCGCAACCAGCACGCCACCGTCCTGATCCGCGGCCTGCGCGCCGTCGCCGACTTCGAGTACGAGATGCAGCTGGCCCACATGAACCGGCACCTGATGCCCGAGCTGGAGTCCGTCTTCCTGATGCCCTCCAAGGAGTGGTCCTTCATCTCCTCCTCCCTGGTCAAGGAGGTCGCCCGCCACCAGGGCGACGTCACCCACTTCCTGCCCGAGAACGTCCACCAGGCCCTGATGGCCAAGCTGGCCTGA

[0057] SEQ ID NO.3:

[0058] GTGATCGAGGAGCTGCTCCCGGAGTCGGTCGTGGCCGTGGAGGCGCGCGCTGACGACCCGCTGTGGGACTCCCCGCTCTACCCGGCGGAGGAGGCGCTCGTCGTGCGCGCGGTGGCCAAGCGGCGCCGTGAGTTCGCGGCCGTCCGGGGCTGCGCCCGGCGCGCCATGGAGAAGCTCGGCGTGCCGCCGCAGCCCGTGCTCACCGGTGAGCGGGGGGCCCCGCGCTGGCCGGACGGGCTGCTCGGCAGCATGACCCACTGCGACGGCTACTGCGCCGCCGCGCTGGTCCGCGCCACCGACCTCGCCTCCCTGGGCATAGACGCCGAACCGCACGGGCCGCTGCCGGAAGGGGTGGGCTCCTCCGTCTTCCTGCCCGCCGAGGCCGAGCGCCTCGACCGGCTGGCCGCGCGGTGGCCCGCCGTGCACTGGGACCGGCTGCTGTTCAGCGCCAAGGAGTCCGTCTACAAGGCGTGGTTCCCGCTCACCCGCATGTGGCTGGACTTCTCCGAGGCCGACATCACCGTGCGGCCGGACGCCGAGGGCGAACCGTCCGGCTCCCTGCGCGCCGAGCTCCTCGTCCCCGGCCCCGTGATCGGCGGGCACCGGCTCCAGTCCTTCGAGGGCCGGTGGACCGTACGGCACGGCGTGGTGGCCACGTCGGTGGTCATACCGCACCCCGCCCCACGCCCC

[0059] (1) Construction of a recombinant vector for heterologous expression of the CoASH cofactor synthesis module and the PPTase post-modification module in Streptomyces coelicolor:

[0060] In Streptomyces coelicolor, a recombinant vector was constructed using the temporal promoter actⅡ-orf4p. The specific construction method is as follows: Primers 4-SCoaA R106A -F and SCoaA R106A -R were designed to amplify SCoaA with homologous arms from the synthetic codon-optimized gene (SEQ ID NO.1). R106AFragment; Design primers SCoaD-F and SCoaD-R with homologous arms for amplifying the SCoaD fragment with homologous arms from the synthetic codon-optimized gene (SEQ ID NO.2); design primers HPC3-F and HPC3-R with homologous arms for amplifying the HPC3 fragment with homologous arms from the synthetic gene (SEQ ID NO.3); design primers Orf4-F and Orf4-R using the Streptomyces coelicolor M145 genome as a template, and obtain the promoter (actⅡ-orf4p) fragment with homologous arms by PCR using the KOD high-fidelity enzyme system. After double-digesting the plasmid pSET152 with EcoRI and XbaI, the linear vector xSET152 is obtained. The linear vector xSET152 is subjected to Gibson assembly with the fragments actⅡ-orf4p, SCoaA R106A , SCoaD and HPC3. After the reaction is completed, transformation is carried out. Single colonies are picked for culture, and plasmids are extracted using a plasmid extraction kit. After electrophoresis detection, sequencing verification is carried out. After verification, the correct recombinant plasmid vector pSET152::orf4 SAD HPC3 is obtained. The construction schematic diagram of this recombinant plasmid vector is as shown in Figure 1 Figure.

[0061] (II) Construction of recombinant vectors for heterologous expression of the CoASH cofactor synthesis module and the PPTase post-modification module in Streptomyces iceolatus, Streptomyces avermitilis, Streptomyces rimosus, Saccharopolyspora spinosa, Streptomyces tsukubaensis, Streptomyces venezuelae, Streptomyces albus and Streptomyces roseosporus:

[0062] In Streptomyces iceolatus BC-101-4, Streptomyces avermitilis S0, Streptomyces tsukubaensis NRRL 18488, Streptomyces rimosus M4018, Streptomyces venezuelae ISP5230, Streptomyces albus IPPDNR, Saccharopolyspora spinosa NRRL 18395 and Streptomyces roseosporus NRRL11379, the recombinant vector is constructed using the constitutive strong promoter ermEp* as the promoter. The specific construction method is as follows: Design primers E-SCoaA R106A -F and SCoaA R106A -R for amplifying the SCoaA with homologous arms from the synthetic codon-optimized gene (SEQ IDNO.1). R106AFragment; Design primers SCoaD-F and SCoaD-R with homologous arms for amplifying the SCoaD fragment with homologous arms from the synthetic codon-optimized gene (SEQ ID NO.2); design primers HPC3-F and HPC3-R with homologous arms for amplifying the HPC3 fragment with homologous arms from the synthetic gene (SEQ ID NO.3). After double digestion of the plasmid pSET152::ermEp* with two restriction endonucleases KpnI and BamHI, the linear vector backbone xSET152-2 was obtained. The linear vector xSET152-2 was Gibson assembled with the fragments SCoaA R106A , SCoaD and HPC3. After the reaction, transformation was carried out. Monoclonal colonies were picked and cultured, and the plasmids were extracted using a plasmid extraction kit. After electrophoresis detection, sequencing verification was carried out. After verification, the correct recombinant plasmid vector pSET152::ermEp*SAD HPC3 was obtained. The construction schematic diagram of this recombinant plasmid vector is as shown in Figure 2 Figure...

[0063] Example 2: Construction of a recombinant bacterium containing a CoASH cofactor synthesis module and a PPTase post-modification module

[0064] (I) Construction of a recombinant strain overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module heterologously

[0065] The recombinant plasmid vector pSET152::orf4 SAD HPC3 obtained in Example 1 was transformed into Escherichia coli competent cells ET12567(pUZ8002), and then the plasmid was introduced into Streptomyces coelicolor M145 through a genus indirect conjugation transfer experiment (see the following literature: Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces genetics. The John Innes Foundation, Norwich.). After the conjugants grew out, they were picked onto MS medium containing apramycin (Apr) and nalidixic acid (Nal). After resistance verification and PCR verification, the recombinant Streptomyces coelicolor strain M145 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module heterologously was obtained.

[0066] The recombinant plasmid vector pSET152::ermEp*SAD HPC3 obtained in Example 1 was transformed into Escherichia coli competent cells ET12567(pUZ8002), and then the plasmid was introduced into Streptomyces bingchenggensis BC-101-4, Streptomyces avermitilis S0, Streptomyces tsukubaensis NRRL 18488, Streptomyces rimosus M4018, Streptomyces venezuelae ISP5230, Streptomyces albus IPPDNR, Saccharopolyspora spinosa NRRL 18395, and Saccharopolyspora roseosporus NRRL 11379 through intergeneric conjugation transfer experiments. The intergeneric conjugation transfer experiment of Streptomyces bingchenggensis BC-101-4 was referred to the following literature: Zhang Y, He H, Liu H, Wang H, Wang X, Xiang W. Characterization of a pathway-specific activator of milbemycin biosynthesis and improved milbemycin production by its overexpression in Streptomyces bingchenggensis. Microb Cell Fact. 2016;15(1):152. doi:10.1186 / s12934-016-0552-1; The intergeneric conjugation transfer experiment of Streptomyces avermitilis S0 was referred to the following literature: DONG et al. Applied Microbiology and Biotechnology, 2024, 108(1). DOI:10.1007 / s00253-023-12964-9; The intergeneric conjugation transfer experiment of Streptomyces tsukubaensis NRRL 18488 was referred to the following literature: Martínez-Castro M et al. Appl Microbiol Biotechnol. 2013 Mar;97(5):2139-52. DOI:10.1007 / s00253-012-4364-x; The intergeneric conjugation transfer experiment of Streptomyces rimosus M4018 was referred to the following literature: Yin et al. Microb Cell Fact. 2015 Apr 2;14:46. DOI:10.1186 / s12934-015-0231-7; The intergeneric conjugation transfer experiment of Streptomyces venezuelae ISP5230 was referred to the following literature: Zhang et al. Mol Microbiol. 2013 Nov;90(4):884-97. DOI:10.1111 / mmi.12406 and Doull et al. J Ind Microbiol. 1994 Mar;13(2):120-5. DOI:10.1007 / BF01584109. After resistance verification and PCR verification, recombinant Streptomyces iceonus strains BC-101-4 / ADH, Streptomyces avermitilis strains S0 / ADH, Streptomyces tsukubaensis strains NRRL18488 / ADH, Streptomyces rimosus strains M4018 / ADH, Streptomyces venezuelae strains ISP5230 / ADH, Streptomyces albus strains IPPDNR / ADH, Saccharopolyspora spinosa strains NRRL 18395 / ADH and Streptomyces roseosporus strains NRRL 11379 / ADH overexpressing the heterologous CoASH cofactor synthesis module and the PPTase post-modification module were obtained.

[0067] (II) Construction of control recombinant strains containing empty vectors:

[0068] The empty vector pSET152 was introduced into Escherichia coli ET12567 / pUZ8002 by transformation. Then, in the same way of intergeneric conjugation transfer, pSET152 was introduced into Streptomyces coelicolor M145, Streptomyces iceonus BC-101-4, Streptomyces avermitilis S0, Streptomyces tsukubaensis NRRL 18488, Streptomyces rimosus M4018, Streptomyces venezuelae ISP5230, Streptomyces albus IPPDNR, Saccharopolyspora spinosa NRRL 18395 and Streptomyces roseosporus NRRL 11379 to obtain the control strains Streptomyces coelicolor M145 / C, Streptomyces iceonus BC-101-4 / C, Streptomyces avermitilis S0 / C, Streptomyces tsukubaensis NRRL 18488 / C, Streptomyces rimosus M4018 / C, Streptomyces venezuelae ISP5230 / C, Streptomyces albus IPPDNR / C, Saccharopolyspora spinosa NRRL 18395 / C and Streptomyces roseosporus NRRL 11379 / C.

[0069] Example 3: Application of Streptomyces coelicolor M145 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in increasing the production of actinorhodin

[0070] The recombinant Streptomyces coelicolor strains M145 / ADH, M145 / C obtained in Example 2 and the original strain M145 were respectively inoculated on MS solid medium and cultured at 28 °C for 5 days. Spores were collected and transferred to Streptomyces coelicolor fermentation medium at an inoculum concentration of 4×10 6 cells / mL, and 0.5 mL of the fermentation broth was taken after culturing at 28 °C and 250 rpm for 5 days.

[0071] The sporulation medium was MS medium, and its specific composition was as follows: 20 g / L soybean cake powder, 20 g / L mannitol, 20 g / L agar powder, and the balance was water.

[0072] Composition of the fermentation medium: 50 g / L PEG6000, 1.23 g / L magnesium sulfate heptahydrate, 10 g / L glucose, 2 g / L acid-hydrolyzed casein, 1 mL / L dipotassium hydrogen phosphate trihydrate, 25 mM 5×TES buffer, 1 mM sodium dihydrogen phosphate, 1 mM potassium hydrogen phosphate, trace elements: ZnSO 4 ·7H 2 O, NaCl, FeSO 4 ·7H 2 O, MnCl 2 ·4H 2 O, CaCl 2 ·6H 2 O, 0.1 g / L each, and the balance is water.

[0073] Detection method of actinorhodin: Treat with 0.5 mL of 1 M NaOH, centrifuge, and measure the OD 608nm of the supernatant to detect the yield of actinorhodin (Act).

[0074] The detection results of actinorhodin yield are as Figure 3 shown. Compared with the starting strain M145, the actinorhodin yield of the Streptomyces coelicolor recombinant strain M145 / ADH increased by 54.17% to reach 141.12 mg / L, and the empty vector control strain M145 / C had no effect on the actinorhodin yield.

[0075] Example 4: Application of Streptomyces bc-101-4 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving the yields of milbemycin and nanchangmycin

[0076] The Streptomyces bc-101-4 / ADH, bc-101-4 / C recombinant strains obtained in Example 2 and the starting strain bc-101-4 were respectively inoculated on the SKYM solid medium and cultured at 28 °C for 9 days. Scrape about 1 square centimeter of spores and inoculate them in the Streptomyces bc-101-4 seed medium, and culture at 28 °C, 250 rpm for 46 h. Then, inoculate them into the Streptomyces bc-101-4 fermentation medium at an inoculation amount of 6% and culture at 28 °C, 250 rpm for 9 days.

[0077] The sporulation medium is the SKYM medium, and the specific composition is as follows: 4 g / L sucrose, 1 g / L skim milk powder, 2 g / L yeast extract powder, 5 g / L malt extract powder, 20 g / L agar powder, and the balance is water.

[0078] Composition of the seed medium: 5 g / L yeast extract powder, 10 g / L sucrose, 1 g / L skim milk powder, 3.5 g / L bacteriological peptone, 0.5 g / L dipotassium hydrogen phosphate, and the balance is water.

[0079] Composition of the fermentation medium: 80 g / L sucrose, 20 g / L soybean cake powder, 1 g / L skim milk powder, 0.1 g / L ferrous sulfate, 1 g / L dipotassium hydrogen phosphate, 3 g / L calcium carbonate, and the balance is water.

[0080] Detection method for milbemycin and nanchangmycin: Take 0.5 mL of the fermentation broth of Streptomyces bingchenggensis and mix it thoroughly with 1.5 mL of ethanol. Invert and shake the treated sample for 30 min to extract milbemycin from the fermentation broth. Subsequently, the preliminarily treated sample is centrifuged at a high speed of 12,000 rpm for 15 min. The upper-layer milbemycin extract is taken and filtered through a 0.22-μm organic filter membrane, and then subjected to liquid-phase detection. The detection instrument is an Agilent 1260 high-performance liquid chromatograph (HPLC), the chromatographic column is a C18 column (Zorbax, 4.6 mm × 250 mm, 5 μm), the detection wavelength is 242 nm, the injection volume is 20 μL, the flow rate of the mobile phase is 1.0 mL / min. The specific chromatographic conditions are as follows: within 0 - 15 min, mobile phase A (methanol) is eluted from 0% to 100%, and mobile phase B (volume ratio of acetonitrile:methanol:water = 7:2:1) is gradient eluted from 100% to 0%; from 15 - 17 min, mobile phase A is maintained at 100%; from 17 - 25 min, mobile phase A (methanol) is eluted from 100% to 0%, and mobile phase B is gradient eluted from 0% to 100%; from 25 - 27 min, mobile phase B is maintained at 100%, and the column temperature is 28°C.

[0081] The detection results of milbemycin production are as Figure 4 shown. Compared with the starting strain BC-101-4, the milbemycin production of the recombinant strain BC-101-4 / ADH of Streptomyces bingchenggensis increased by 39.11% to reach 1352.43 mg / L. At the same time, the production of nanchangmycin increased by 24.90% to reach 1400.79 mg / L, and the empty vector control strain BC-101-4 / C had no effect on the production of milbemycin and nanchangmycin.

[0082] Example 5: Application of Streptomyces avermitilis S0 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving avermectin production

[0083] The recombinant strains S0 / ADH, S0 / C of Streptomyces avermitilis obtained in Example 2 and the starting strain S0 were respectively inoculated on YMS solid medium and incubated at 28°C for 7 days. Use an inoculation spatula to pick up a bacterial slice of about 1 square centimeter and inoculate it into the Streptomyces avermitilis seed medium, and incubate at 28°C, 250 rpm for 48 h. Then, inoculate it into the Streptomyces avermitilis fermentation medium at an inoculation amount of 6% and incubate at 28°C, 250 rpm for 10 days.

[0084] The sporulation medium is YMS medium, and its specific composition is as follows: 4 g / L soluble starch, 4 g / L yeast extract powder, 10 g / L malt extract powder, 20 g / L agar powder, and the balance is water.

[0085] The composition of the seed medium: 25 g / L corn starch, 2 g / L soybean cake powder, 15 g / L peanut cake powder, 4 g / L yeast extract powder, 0.026 g / L cobalt chloride hexahydrate, 0.03 g / L α-amylase, and the balance is water.

[0086] The composition of the fermentation medium: 120 g / L corn starch, 38 g / L soybean cake powder, 0.8 g / L calcium carbonate, 8 g / L yeast extract powder, 0.02 g / L cobalt chloride hexahydrate, 0.1 g / L α-amylase, 0.3 g / L ammonium sulfate, 0.022 g / L sodium molybdate monohydrate, 0.0023 g / L manganese sulfate monohydrate, and the balance is water.

[0087] Detection method of avermectin: Take 0.25 mL of the fermentation broth or the supernatant of the fermentation broth of Streptomyces avermitilis and mix it fully with 1.20 mL of methanol. Ultrasonically treat the sample for 40 min to extract the total avermectin and extracellular avermectin in the fermentation broth. Subsequently, centrifuge the preliminarily treated sample at 12000 rpm for 10 min, aspirate the upper-layer avermectin extract, filter it through a 0.22 μm organic filter membrane, and then perform liquid-phase detection. The detection instrument is Shimadzu HPLC (Shimadzu LC), the chromatographic column is a C18 column (Zorbax, 4.6 mm × 250 mm, 5 μm), the detection wavelength is 246 nm, the injection volume is 20 μL, the mobile phase is 90% methanol, the flow rate is 1.0 mL / min, and the column temperature is 35 °C.

[0088] Avermectin B 1a The detection results of the yield are as Figure 5 shown. Compared with the original strain S0, the avermectin B 1a yield of the recombinant strain S0 / ADH of Streptomyces avermitilis increased by 38.50% and reached 3.11 g / L, and the empty vector control strain S0 / C had no effect on the 1a yield of avermectin B.

[0089] Example 6: Application of Streptomyces tsukubaensis NRRL18488 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving the FK506 yield

[0090] The recombinant Streptomyces tsukubaensis strains NRRL 18488 / ADH, NRRL 18488 / C obtained in Example 2 and the original strain NRRL 18488 were respectively inoculated onto a sporulation solid medium. After culturing at 28 °C for 14 days, the spores were scraped and inoculated into the Streptomyces tsukubaensis YEME seed medium, and cultured at 28 °C and 220 rpm for 48 h. Then, they were transferred to the MGm fermentation medium at an inoculation amount of 6%, and cultured at 28 °C and 220 rpm for 10 days.

[0091] The composition of the sporulation solid medium is as follows: 10 g / L soluble starch, 1 g / L NaCl, 2 g / L (NH 4 ) 2 SO 4 , 1 g / L K 2 HPO 4 , 2 g / L CaCO 3 , 1 g / L MgSO 4 ·7H 2 O, 0.001 g / L FeSO 4 ·7H 2 O, 0.001 g / L MnCl 2 ·4H 2 O, 0.001 g / L ZnSO 4 ·7H 2 O, 20 g / L agar, the balance is water, pH 7.0.

[0092] The composition of the YEME seed medium is as follows: 3 g / L yeast extract powder, 5 g / L peptone, 3 g / L malt extract powder, 10 g / L glucose, 340 g / L sucrose, the balance is water, pH 7.0.

[0093] The composition of the MGm fermentation medium is as follows: 50 g / L soluble starch, 8.83 g / L glutamic acid, 2.5 mM K 2 HPO 4 , 0.2 g / L MgSO 4 ·7H 2 O, 1 mg / L CaCl 2 , 1 mg / L NaCl, 0.009 g / L FeSO 4 ·7H 2 O, 21 g / L MOPS, 0.45 ml / L trace elements. Every 10 ml of trace elements contains 39.0 mg CuSO 4 ·5H 2 O, 5.7 mg H 3 PO 3 , 3.7 mg (NH 4 ) 6 MO 7 O24 ·4H 2 O, 6.1 mg of MnSO 4 ·H 2 O, 880.0 mg of ZnSO 4 ·7H 2 O, with the balance being water, pH 6.5.

[0094] Detection method of FK506: Take 0.5 mL of the fermentation broth and place it in 0.75 mL of methanol. Keep it in a constant temperature water bath at 50 °C for 2.5 hours, shake it once every 30 minutes, centrifuge it, take the supernatant, filter it through a membrane, and perform HPLC detection. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) chromatographic column. The volume ratio of the mobile phase is acetonitrile: 0.1% phosphoric acid solution = 65:35, the flow rate is 1.0 mL / min, the column temperature is 50 °C, the detection wavelength is 210 nm, and the injection volume is 20 μL.

[0095] The detection results of FK506 production are as Figure 6 shown. Compared with the original strain NRRL 18488, the FK506 production of the Streptomyces tsukubaensis recombinant strain NRRL 18488 / ADH increased by 45.58% and reached 83.70 mg / L, and the empty vector control strain NRRL18488 / C had no effect on the FK506 production.

[0096] Example 7: Application of Streptomyces rimosus M4018 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving oxytetracycline production

[0097] Inoculate the Streptomyces rimosus recombinant strains M4018 / ADH, M4018 / C obtained in Example 2 and the original strain M4018 on the MS solid medium respectively. After culturing at 30 °C for 5 days, scrape the spores, inoculate them into the Streptomyces rimosus seed medium, place it at 30 °C, and culture it under the condition of 250 rpm for 24 h. Then transfer it to the Streptomyces rimosus fermentation medium with an inoculation amount of 5%, and culture it at 28 °C and 250 rpm for 8 days.

[0098] The sporulation medium is the MS medium, and the specific composition is as follows: 20 g / L of soybean cake powder, 20 g / L of mannitol, 20 g / L of agar powder, with the balance being water.

[0099] Composition of the seed medium: 30 g / L of starch, 3 g / L of soybean cake powder, 4 g / L of ammonium sulfate, 5 g / L of calcium carbonate, 4 g / L of corn steep liquor, 5 g / L of sodium chloride, 0.15 g / L of potassium dihydrogen phosphate, with the balance being water.

[0100] Composition of the fermentation medium: 150 g / L starch, 20 g / L soybean cake powder, 14 g / L ammonium sulfate, 14 g / L calcium carbonate, 4 g / L corn steep liquor, 4 g / L sodium chloride, 0.1 g / L potassium dihydrogen phosphate, 10 μg / L cobalt chloride, 0.1%-0.2% amylase, and the balance is water.

[0101] Detection method of oxytetracycline: Take 1.5 mL of the fermentation broth, acidify it to pH 1.5 - 1.7 with 9 mol / L hydrochloric acid, centrifuge to obtain the supernatant, filter it through a membrane, and perform HPLC detection. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) chromatographic column, the volume ratio of the mobile phase is water:methanol:acetonitrile:2 mM phosphoric acid solution = 60:10:20:10, the flow rate is 1.0 mL / min, the detection wavelength is 350 nm, and the injection volume is 10 μL.

[0102] The detection results of oxytetracycline production are as Figure 7 shown. Compared with the starting strain M4018, the oxytetracycline production of the Streptomyces rimosus recombinant strain M4018 / ADH increased by 48.52% and reached 1.94 g / L, and the empty vector control strain M4018 / C had no effect on the oxytetracycline production.

[0103] Example 8: Application of Streptomyces venezuelae ISP5230 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving jadomycin production

[0104] Inoculate the Streptomyces venezuelae recombinant strains ISP5230 / ADH, ISP5230 / C obtained in Example 2 and the original strain ISP5230 on the MYM solid medium respectively, culture at 30 °C for 5 days, scrape the spores, inoculate them into the seed medium, culture with shaking at 30 °C for 20 hours, then transfer them to the fermentation medium, and continue to culture with shaking at 30 °C for 48 hours.

[0105] The sporulation medium is the MYM medium, and the specific composition is as follows: 10 g / L malt extract powder, 4 g / L yeast extract powder, 4 g / L maltose, 20 g / L agar powder, and the balance is water.

[0106] The seed medium is the liquid MYM medium.

[0107] The fermentation medium is composed of the MSM liquid medium, glucose and the phosphate buffer stock solution. The final concentration of glucose is 33 mM, and the final concentration of the phosphate buffer is 50 μM. Each liter of the MSM liquid medium (pH 7.5) contains MgSO 4 0.4 g, MOPS 1.9 g, 9 mL of the salt solution (the salt solution contains 1 g / 100 mL NaCl and 1 g / 100 mL CaCl 2aqueous solution), 4.5 mL of 0.2 g / 100 mL FeSO 4 ·7H 2 O aqueous solution, 4.5 mL of trace element solution, and 7.8 g of L-isoleucine. Each liter of the trace element solution contains 880 mg of ZnSO 4 ·7H 2 O, 39 mg of CuSO 4 ·5H 2 O, 6.1 mg of MnSO 4 ·4H 2 O, 5.7 mg of H 3 BO 3 and 3.7 mg of (NH 4 ) 6 Mo 7 O 24 ·4H 2 O. Each liter of the phosphate buffer stock solution (9 mM) contains 10.5 g of K 2 HPO 4 and 4.5 g of KH 2 PO 4 .

[0108] Jedomycin detection method: Take 1 mL of the fermentation broth, centrifuge and filter to remove the cells, add an equal volume of ethyl acetate for extraction, and take the upper organic phase; evaporate the extraction product to dryness in a fume hood at room temperature, dissolve it with a certain volume of methanol or DMSO, and perform HPLC detection. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) chromatographic column, the mobile phase is A: water, B: acetonitrile + 0.1% trifluoroacetic acid, gradient elution, flow rate 1.0 mL / min, detection wavelength 316 nm, injection volume 20 μL.

[0109] The detection results of jedomycin production are as Figure 8 shown. Compared with the starting strain ISP5230, the jedomycin production of the recombinant strain Streptomyces venezuelae ISP5230 / ADH increased by 15.51% to reach 288.64 μg / mL, and the empty vector control strain ISP 5230 / C had no effect on the jedomycin production.

[0110] Example 9: Application of Streptomyces albus IPPDNR / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving daunorubicin production

[0111] The recombinant Streptomyces albus strains IPPDNR / ADH, IPPDNR / C obtained in Example 2 and the starting strain IPPDNR were respectively inoculated on MS solid medium. After culturing at 30°C for 3 days, 1 cm × 2 cm spores were scraped and inoculated into the first-stage seed medium (tryptone soy broth TSB). They were cultured at 30°C and 220 rpm for 30 hours, then transferred to the second-stage seed medium at an inoculation amount of 5%, cultured at 30°C and 220 rpm for 24 h, and then transferred to the fermentation medium at an inoculation amount of 10%. They were cultured at 30°C and 250 rpm for 10 days.

[0112] The sporulation medium was MS medium, and its specific composition was as follows: 20 g / L soybean cake powder, 20 g / L mannitol, 20 g / L agar powder, and the balance was water.

[0113] The composition of the second-stage seed medium: 1 g / L yeast extract, 4 g / L glucose, 3 g / L soybean powder, 0.2 g / L calcium carbonate, and the balance was water.

[0114] The composition of the fermentation medium: 4 g / L glucose, 0.4 g / L yeast extract, 1 g / L malt extract, 5 g / L dextrin, 5 mL / L soybean oil, and the balance was water.

[0115] Detection method for daunorubicin: Take 1 mL of the fermentation broth, add 9 mL of methanol, let it stand for 12 h and then centrifuge. Take the supernatant and filter it through a membrane for HPLC detection. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) chromatographic column, XDB-C18. Mobile phase A: 0.01 M ammonium acetate aqueous solution (pH = 4.2), mobile phase B: acetonitrile, flow rate 1.0 mL / min, detection wavelength 254 nm, column temperature 37°C, gradient elution, injection volume 20 μL.

[0116] The detection results of daunorubicin production are as Figure 9 shown. Compared with the starting strain IPPDNR, the daunorubicin production of the recombinant Streptomyces albus strain IPPDNR / ADH increased by 56.67% and reached 38.20 μg / mL, and the empty vector control strain IPPDNR / C had no effect on the daunorubicin production.

[0117] Example 10: Application of Saccharopolyspora spinosa NRRL18395 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving the production of spinosad

[0118] The recombinant Saccharopolyspora spinosa strains NRRL 18395 / ADH and NRRL 18395 / C obtained in Example 2 and the original strain NRRL 18395 were respectively inoculated onto a sporulation solid medium and cultured at a constant temperature of 30 °C for 7 days. The spores were scraped and inoculated into a Saccharopolyspora spinosa seed medium, incubated at 28 °C and 250 rpm for 72 h, and then transferred to a Saccharopolyspora spinosa fermentation medium at an inoculation amount of 10% and cultured at 28 °C and 250 rpm for 8 days.

[0119] The composition of the sporulation medium is as follows: 20 g / L of whole milk powder, 3 g / L of yeast extract, 5 g / L of glucose, 20 g / L of agar, and the balance is water.

[0120] The composition of the seed medium is as follows: 10 g / L of whole milk powder, 10 g / L of glucose, 5 g / L of yeast extract powder, and 5 g / L of peptone.

[0121] The composition of the fermentation medium is as follows: 10 g / L of whole milk powder, 100 g / L of glucose, 5 g / L of yeast extract powder, 10 g / L of peptone, 10 g / L of soybean oil, K 2 HPO 4 1 g / L, CaCO 3 5 g / L.

[0122] Method for detecting spinosad: Take 2 mL of the fermentation broth, add 4 mL of anhydrous methanol, ultrasonically treat for 1 h, centrifuge at 12000 rpm for 10 min, and take the supernatant directly for HPLC analysis. HPLC analysis conditions: Agilent Zorbax Eclipse XDB-C8 (4.6 mm × 150 mm, 5 μm; part number: 993967-906) chromatographic column, detection wavelength 246 nm; the volume ratio of the mobile phase is methanol: acetonitrile: water (containing 0.05% ammonium acetate) = 45:45:10; flow rate 1.0 mL / min, injection volume 20 μL.

[0123] The detection results of spinosad production are as Figure 10 shown. Compared with the original strain NRRL 18395, the spinosad production of the recombinant Saccharopolyspora spinosa strain NRRL 18395 / ADH increased by 44.64% to reach 41.66 mg / L, and the empty vector control strain NRRL 18395 / C had no effect on spinosad production.

[0124] Example 11: Application of Streptomyces roseosporus NRRL 11379 / ADH overexpressing the CoASH cofactor synthesis module and the PPTase post-modification module in improving daptomycin production

[0125] The recombinant Streptomyces roseosporus strains NRRL 11379 / ADH, NRRL 11379-C obtained in Example 2 and the original strain NRRL 11379 were respectively inoculated on DAI solid medium and cultured at 28°C for 7 days. Then the spores were scraped and inoculated into the first-stage seed medium for Streptomyces roseosporus, cultured at 28°C and 250 rpm for 60 h. After that, they were transferred to the second-stage seed medium at an inoculation amount of 5% and cultured at 28°C and 250 rpm for 36 h. Then they were transferred to the fermentation medium for Streptomyces roseosporus at an inoculation amount of 5% and cultured at 28°C and 250 rpm for 10 days. Starting from 48 h, 0.5 mL of 2% (W / V) sterile sodium caprylate solution was added every 12 h.

[0126] The sporulation medium was DAI medium, and its specific composition was as follows: 4 g / L glucose, 4 g / L yeast extract, 10 g / L malt extract, 2 g / L calcium carbonate, 20 g / L agar powder, and the balance was water.

[0127] The composition of the seed medium: 5 g / L glucose, 15 g / L dextrin, 5 g / L peptone, 5 g / L yeast extract, 5 g / L peanut cake powder, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate, 0.2 g / L calcium carbonate, and the balance was water.

[0128] The composition of the fermentation medium: 50 g / L soluble starch, 10 g / L glucose, 10 g / L dextrin, 10 g / L tryptone, 0.3 g / L dipotassium hydrogen phosphate, 0.3 g / L magnesium sulfate heptahydrate, 0.2 g / L calcium carbonate, and the balance was water.

[0129] Method for detecting daptomycin: Take 1 mL of the fermentation broth, centrifuge it at 13,000 rpm and 4°C for 15 minutes twice, take the supernatant and filter it through a membrane for HPLC detection. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) chromatographic column, the volume ratio of the mobile phase is water:acetonitrile = 56:44, the flow rate is 1.0 mL / min, the detection wavelength is 218 nm, and the injection volume is 20 μL.

[0130] The detection results of daptomycin production are as Figure 11 shown. Compared with the starting strain NRRL 11379, the daptomycin production of the recombinant Streptomyces roseosporus strain NRRL 11379 / ADH increased by 37.19% and reached 334.75 mg / L, and the empty vector control strain NRRL 11379 / C had no effect on the daptomycin production.

[0131] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A combined module for increasing the yield of natural products from actinomycetes, characterized in that: The combined module consists of a CoASH cofactor synthesis module and a PPTase post-modification module. The CoASH cofactor synthesis module consists of the element SCoaA R106A and SCoaD, SCoaA R106A The nucleotide sequences of SCoaD and SCoaD are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, the PPTase post-modification module is element HPC3, and its nucleotide sequence is shown in SEQ ID NO.3; the natural product is a polyketide compound, a polyether compound or a non-ribosomal peptide compound.

2. A recombinant vector containing the combined module according to claim 1, characterized in that: The starting vector of the recombinant vector is pSET152, and the promoter actⅡ-orf4p fragment is amplified using the genome of Streptomyces coelicolor M145 as a template, and the promoter actⅡ-orf4p fragment is combined with the element SCoaA in the combination module. R106A , SCoaD and HPC3 are integrated into the starting vector to obtain the recombinant vector.

3. Use of the recombinant vector according to claim 2 in increasing the yield of actinomycetinorubin in Streptomyces coelicolor.

4. A recombinant vector containing the combined module according to claim 1, characterized in that: The starting vector of the recombinant vector is pSET152::ermEp*, and the element SCoaA in the combined module R106A , SCoaD and HPC3 are integrated into the starting vector to obtain the recombinant vector.

5. Use of the recombinant vector according to claim 4 in increasing the yield of natural products from actinomycetes, characterized in that: The natural product is a polyketide compound, a polyether compound or a non-ribosomal peptide compound.

6. A recombinant bacterium containing the recombinant vector according to claim 2, characterized in that: The recombinant bacteria is obtained by taking Streptomyces coelicolor M145 as the starting strain and introducing the recombinant vector described in claim 2 into the starting strain.

7. Use of the recombinant bacteria according to claim 6 in increasing the production of actinomycetinorubin in Streptomyces coelicolor.

8. A recombinant bacterium containing the recombinant vector according to claim 4, characterized in that: The recombinant bacteria are obtained by introducing the recombinant vector described in claim 4 into the starting strain, using Streptomyces bingchenggensis BC-101-4, Streptomyces avermitilis S0, Streptomyces tsukubaensis NRRL 18488, Streptomyces rimosus M4018, Streptomyces venezuelae ISP5230, Streptomyces albus IPPDNR, Saccharopolyspora spinosa NRRL 18395 or Streptomyces roseosporus NRRL 11379 as the starting strain.

9. Use of the recombinant bacteria according to claim 8 in increasing the yield of natural products from actinomycetes, characterized in that: The natural product is a polyketide compound, a polyether compound or a non-ribosomal peptide compound.

10. The use according to claim 9, characterized in that: When the starting strain is Streptomyces bingchengensis BC-101-4, the recombinant bacteria is used to increase the production of milbemycin or nanchangmycin; when the starting strain is Streptomyces avermitilis S0, the recombinant bacteria is used to increase the production of avermectin; when the starting strain is Streptomyces tsukuba NRRL 18488, the recombinant bacteria is used to increase the production of FK506; when the starting strain is Streptomyces crassa M4018, the recombinant bacteria is used to increase the production of oxytetracycline; when the starting strain is Streptomyces venezuelae ISP5230, the recombinant bacteria is used to increase the production of jedomycin; when the starting strain is Streptomyces albus IPPDNR, the recombinant bacteria is used to increase the production of daunorubicin; when the starting strain is Saccharopolyspora spinosa NRRL 18395, the recombinant bacteria is used to increase the production of spinosad; when the starting strain is Streptomyces roseosporus NRRL 11379, the recombinant bacteria is used to increase the production of daptomycin.

Images