Quantitative detection method of transgenic event
By designing a high-sensitivity and specific probe and primer combination, combined with Real-time PCR detection method, the problem of low sensitivity of RN85N-e3 detection of rice transformants in the prior art was solved, and high sensitivity and specific detection was achieved, which can effectively distinguish RN85N-e3 from other rice materials.
Patent Information
- Application Number
- CN202510515039.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art detects the rice transformant RN85N-e3 with low sensitivity and cannot monitor the PCR process in real time, and quantitative detection cannot be performed.
A high-sensitivity, specific probe and primer combination was designed, combined with Real-time PCR detection method, and the signal was monitored in real time during PCR using fluorescent labeled probes to achieve quantitative detection.
High sensitivity and specificity detection of rice RN85N-e3 transformants is achieved, which can effectively distinguish RN85N-e3 from other RN85N-e3-free rice materials, with extremely high sensitivity and specificity.
Smart Images

Figure CN120060244A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biotechnology, and particularly relates to a probe for detecting a nucleic acid sample, a probe and primer combination, a standard product, a Real-time PCR detection kit, and a detection method. Background Art
[0002] The rice transformant RN85N-e3 is a transgenic rice material resistant to insects and glufosinate herbicide. It has excellent resistance to Lepidoptera pests such as Chilo suppressalis and good tolerance to glufosinate. Using this transformant can cultivate rice varieties resistant to insects and herbicides. Establishing a transformant-specific detection method can provide an effective detection means for the identification and supervision of genetically modified organisms and provide technical support for the safety management of agricultural genetically modified organisms.
[0003] The detection of transformant specificity mainly uses the conventional PCR method, but its disadvantage is low sensitivity, and it cannot monitor the PCR process in real time and cannot be quantified. With the development of molecular biology technology, Real-time PCR (real-time fluorescence quantitative PCR) has been widely used in transgenic detection. Compared with the conventional PCR technology, it has the characteristics of short time consumption, simple operation, good specificity, and high sensitivity. The process can be monitored in real time, the results can be directly observed, and quantitative detection can be carried out.
[0004] The Real-time PCR method can be divided into two types: the dye method and the probe method. The fluorescent dye in the dye method Real-time PCR can bind to double-stranded DNA and emit fluorescence, and its binding is non-specific. Primer dimers, DNA templates, etc. in the system will all bind to it, so the specificity of the dye method is not high. The probe in the probe method can specifically bind to the template, and its amplification curve reflects the accumulation of specific products and does not contain components of non-specific amplification. The sensitivity is 10 times higher than that of the dye method. In addition, the dye method only supports single-channel reactions. If multi-channel experiments are required, or different targets of the same sample are to be detected, the most commonly used method is still the probe method.
[0005] The rice transformant RN85N-e3 and its detection method have been patented, with the application number 2025100877666. The detection method used is conventional PCR, and the length of the PCR products between the designed detection primers is too large (717 bp and 694 bp), which is not suitable for direct use in real-time PCR. Summary of the Invention
[0006] To solve the above problems, the present invention provides probes for detecting nucleic acid samples, probe and primer combinations, standards, detection kits, and Real-time PCR detection methods. The above nucleic acid samples can be genomic DNA of rice RN85N-e3 transformants, or genomic DNA of RN85N-e3 transformant derivative lines, or genomic DNA of mixed rice materials containing RN85N-e3 transformants, or nucleic acid samples containing RN85N-e3 identity information isolated from the above samples by methods such as PCR amplification. Since the sequence shown in SEQ ID NO. 1 is a specific sequence for confirming the identity information of RN85N-e3 transformants, any sample containing the nucleic acid molecule with the sequence shown in SEQ ID NO. 1 can be detected by the method provided by the present invention.
[0007] By designing highly sensitive and specific probes and primer pairs, the present invention can accurately identify rice RN85N-e3 transformants and distinguish them from conventional rice without RN85N-e3 and other transgenic rice materials. This detection method has the advantages of high specificity, sensitivity, and operational convenience, making up for the disadvantages of the conventional PCR method, such as cumbersome procedures and low detection sensitivity.
[0008] The present invention provides a probe, characterized in that the nucleotide sequence of the probe is 5'-TCTAAAAACACCTCCACCCCCACGC-3'.
[0009] In some embodiments, the 5' end of the probe is labeled with a fluorescent group and the 3' end is labeled with a quenching group. When the probe is in the free state, the fluorescence emitted by the fluorescent group will be absorbed by the quenching group; during the PCR amplification process, the 5' end fluorescent group of the probe tightly bound to the template will be cleaved by Taq enzyme, thus moving away from the 3' end quenching group, and the fluorescence emitted by the fluorescent group can be received by the instrument, and the generated fluorescence signal is proportional to the amount of amplification product in the sample.
[0010] In some embodiments, the fluorescent group includes any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA, or Texas; the quenching group includes any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL, or MGB; In some embodiments, the combination of the fluorescent group / quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2; In the randomly selected fluorescence group and quenching group test experiments, the probes labeled with the above fluorescence group and quenching group can all obtain specific detection results. At the same time, the probe labeled with FAM at the 5' end and BHQ1 at the 3' end has the lowest labeling cost and can be used as the most preferred probe labeling scheme.
[0011] The present invention also provides a primer and probe combination, which is characterized in that: it includes the above-mentioned probe and two primers, and the nucleotide sequences of the primers are 5'-GCCGCATTACCCTGTTATCC-3' and 5'-GAGGGAATGGAAGAATGTAACTACTATTG-3'; The above-mentioned probe and the probe and primer combination are selected through software design, experimental screening and verification, and are located at the upstream boundary of the exogenous insertion sequence in the RN85N-e3 transformant.
[0012] The present invention also provides a standard product, which is characterized in that: the standard product is one or more nucleic acid samples with a concentration of not less than 20 copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1; In some embodiments, the standard product is 5 concentrations of 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL and 2×10 copies / μL of RN85N-e3 genomic DNA; the DNA sample contains the nucleic acid molecule shown in SEQ ID NO. 1; In some embodiments, the preparation method of the standard product is: take the RN85N-e3 genomic DNA sample with a concentration of 1.0 μg / μL and dilute it 10 times, 10 2 times, 10 3 times, 10 4 times, 10 5 times.
[0013] The present invention also provides a detection kit, which is characterized in that: the detection kit includes the above-mentioned probe and primer combination and the above-mentioned standard product; In some embodiments, the detection kit includes: Primer 1, with the sequence of 5'-GCCGCATTACCCTGTTATCC-3'; Primer 2, with the sequence of 5'-GAGGGAATGGAAGAATGTAACTACTATTG-3'; Probe, with the sequence of 5'-TCTAAAAACACCTCCACCCCCACGC-3'; The reference standards are genomic DNA samples of RN85N-e3 with 5 concentrations of 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL and 2×10 copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1; Among them, the 5' end of the probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ1.
[0014] The present invention also provides a Real-time PCR detection method, which is characterized in that: the above detection kit is used for Real-time PCR detection, wherein the final concentrations of primer 1 and primer 2 in the PCR reaction system are both 0.4 μM, and the final concentration of the probe is 0.2 μM.
[0015] The present invention also provides the application of the above probe, probe and primer combination, reference standards, detection kit, and detection method in qualitatively or quantitatively detecting nucleic acid samples; among them, the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1.
[0016] The beneficial effects of the present invention are: through software design and multiple experimental screenings, a combination of 1 probe and 2 primers was obtained from a large number of probe primer combinations. On this basis, a Real-time PCR detection method was established and optimized using reference standards with appropriate concentration gradients. The above probe, probe and primer combination, reference standards, detection kit, and Real-time PCR detection method can specifically detect nucleic acid samples containing SEQ ID NO. 1 with a concentration of not less than 20 copies / μL, and can effectively distinguish RN85N-e3 materials from other rice materials without RN85N-e3, with extremely high sensitivity and specificity. Description of the Drawings
[0017] By reading the detailed description of the non-restrictive embodiments with reference to the following drawings, other features, objectives, and advantages of the present application will become more obvious: Figure 1 Standard curve and linear equation.
[0018] Figure 2 Specific sample detection test. Among them, 1: a mixed sample of Nipponbare and RN85N-e3 (sample 1); 2: a mixed sample of Nipponbare and RN85N-e1 (sample 2); 3: blank control water. Detailed Embodiments
[0019] The present invention will be further described below in conjunction with the accompanying drawings. The following examples are only used to illustrate the present invention but do not limit the scope of the present invention.
[0020] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, shoots, fruits, stalks, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, shoots, fruits, leaves, and roots, where the above plant parts are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of the present invention and are thus at least partially composed of transgenic cells.
[0021] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences (5' non-coding sequences) before the coding sequence and regulatory sequences (3' non-coding sequences) after the coding sequence. A "natural gene" refers to a gene that is naturally found with its own regulatory sequences. A "chimeric gene" refers to any gene that is not a natural gene and contains regulatory and coding sequences that are not naturally found. An "endogenous gene" refers to a natural gene that is located at its natural position in the genome of an organism. An "exogenous gene" is a foreign gene that currently exists in the genome of an organism and did not originally exist, and also refers to a gene introduced into a recipient cell through a transgenic step. An exogenous gene can contain a natural gene or a chimeric gene inserted into a non-natural organism. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be referred to as the "insertion site" or "target site".
[0022] Transformation procedures that cause random integration of exogenous DNA can result in transformants containing different flanking regions, which are specific to each transformant. When recombinant DNA is introduced into a plant through traditional hybridization, its flanking regions usually do not change. Transformants will also contain unique junctions between segments of heterologous insert DNA and genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. A "junction" is the point where two specific DNA fragments are joined. For example, a junction exists at the position where the insert DNA joins the flanking DNA. Junctions also exist in the transformed organism where two DNA fragments are joined together in the manner found in a natural organism. "Junction DNA" refers to DNA that contains a junction point.
[0023] The RN85N-e3 transformant is a plant and seed comprising the transgenic rice RN85N-e3 and its plant cells or its renewable parts. The plant parts of RN85N-e3 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves, and products from the rice plant RN85N-e3, such as rice, straw, rice husk, rice oil, cooked rice, rice flour, rice bran, rice bran layer, and biomass left in the rice crop field.
[0024] The term "probe" refers to a segment of isolated nucleic acid molecule to which a conventional detectable label or reporter molecule is attached, such as a radioisotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to one strand of the target nucleic acid. In the present invention, the probe is complementary to a DNA strand from the genome of the transgenic rice RN85N-e3, regardless of whether the genomic DNA is from the transgenic rice RN85N-e3 or its seed, or from the plant or seed or extract of the transgenic rice RN85N-e3 and other derivative lines, or a nucleic acid molecule containing the identity information of RN85N-e3 isolated from RN85N-e3. The probes of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of the target DNA sequence.
[0025] The term "primer" refers to a segment of isolated nucleic acid molecule that anneals and binds to the complementary target DNA strand through nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (such as DNA polymerase). The primer pairs of the present invention relate to their application in the amplification of target nucleic acid sequences, such as by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods. Example 1 Design and screening of specific primer / probe combinations The specific detection method of the transformant requires designing primers and probes at the boundary sequences upstream and downstream of the insertion site, and the PCR amplification product needs to include the foreign sequence and the rice genomic sequence. Therefore, primers and probes should be designed first according to the boundary sequences of the RN85N-e3 insertion site in rice.
[0026] 1. Design primer and probe combinations A part (100 - 600 bp) of the upstream or downstream boundary sequence (or its reverse complementary sequence) is used as a template and input into software (such as ABI Primer Express 3.0). This template sequence must contain both the rice genomic sequence (with a length of at least 50 bp) and the foreign insertion sequence (with a length of at least 50 bp). Two of the template sequences are shown as SEQ ID NO. 2 and SEQ ID NO. 3.
[0027] After setting the relevant parameters in the software according to the following requirements, dozens of primer and probe combinations were obtained. Each combination contains 2 primers and 1 probe.
[0028] The probes and primers meet all of the following requirements: (1) The length of the primers is between 18 and 30 bp, and the length of the probe is between 18 and 30 bp; (2) The Tm value of the primers is between 58 and 60 °C, and the Tm value of the probe is 8 - 10 °C higher than that of the primers; (3) Avoid generating complementary sequences of more than 3 bases inside the probe, inside the primers, or between the probe and the primers; (4) The first base at the 5' end of the probe is not G; (5) The amplification products of the 2 primers should contain at least 11 bp of rice genomic sequence and at least 11 bp of exogenous inserted sequence.
[0029] (6) The length of the PCR product is between 80 - 300 bp.
[0030] Finally, 5 groups of primers and probes with higher software scores were selected as candidate combinations for further screening. The candidate combinations are shown in Table 1.
[0031] Table 1 5 groups of candidate primers and probes with higher software design scores Combination Primer 1 Primer 2 Probe P A1 GCCGCATTACCCTGTTATCC GAGGGAATGGAAGAATGTAACTACTATTG TCTAAAAACACCTCCACCCCCACGC A2 GAAGTTATGGGCCGCATTACC GAGGGAATGGAAGAATGTAACTACTATTG TCTAAAAACACCTCCACCCCCACGCT A3 GTATTCTAGCAGAGGCGGAGACA TGTTATCCCTAGGCCGCATAA ACCATTAGAGCCCTCATAATACCCCCACCT A4 GCTGAGGGAATGGAAGAATGTAACT TGTTATCCCTAGGCCGCATAA ACCATTAGAGCCCTCATAATACCCCCACCT A5 ATGGCTGAGGGAATGGAAGA CTGTTATCCCTAGGCCGCATAA CCATTAGAGCCCTCATAATACCCCCACCTT 2. Primer synthesis and screening Synthesize the 5 groups of primers shown in Table 1 and conduct specific primer screening. The screening process is as follows: (1) Use ordinary PCR amplification reaction to detect Primer 1 and Primer 2 of the 5 candidate combinations. The electrophoresis results are shown in Table 2. The results show that Combinations A4 and A5 amplified 2 bands, that is, there was non-specific amplification; Combinations A1, A2, and A3 amplified a single specific band of the expected size. Therefore, Combinations A4 and A5 were eliminated; Primer 1 and Primer 2 of Combinations A1, A2, and A3 met the requirements and were further tested.
[0032] Table 2 Screening specific primers by ordinary PCR Combination Number of amplified bands Band size (bp) Whether it meets the requirements A1 1 100-250 Yes A2 1 100-250 Yes A3 1 100-250 Yes A4 2 <100,100-250 No A5 2 100-250,>250 No (2) Use SYBR Green dye method Real-time PCR reaction to detect Primer 1 and Primer 2 of Combinations A1, A2, and A3. The Real-time PCR reaction results are shown in Table 3. The results show that: the amplification curves of the 3 combinations were normal, and the Ct value < 35. Among them, the melting curves of A1 and A2 were both single peaks, while that of A3 was a double peak. Therefore, Combination A3 was eliminated, and Primer 1 and Primer 2 of A1 and A2 met the requirements and could be further tested.
[0033] Table 3 SYBR Green dye method Real-time PCR screening of specific primers Combination Amplification curve Ct value Melting curve Whether it meets the requirements A1 Yes 24.16 Single peak Yes A2 Yes 25.41 Single peak Yes A3 Yes 28.22 Double peak No 3. Probe synthesis and screening The probes of the synthesis combinations A1 and A2 were modified with the fluorescent labeling group FAM at the 5' end and the fluorescent quenching group BHQ1 at the 3' end.
[0034] The primers and probes of combinations A1 and A2 were tested by real-time PCR reaction using the probe method, and the reaction results are shown in Table 4. The results showed that combinations A1 and A2 were successfully amplified, with Ct values of 24.77 and 28.03, respectively, and combination A1 had the highest fluorescence signal value.
[0035] Therefore, combination A1 with the smallest Ct value and the highest fluorescence signal value was selected as the primers and probe for quantitative detection of rice transformant RN85N-e3.
[0036] Table 4 Probe method Real-time PCR screening specific primers and probe combinations Combination Amplification curve Ct value Screening result A1 Yes 24.77 √ A2 Yes 28.03 Eliminate The probe and primer of combination A1 are located at the downstream boundary of the exogenous insertion sequence. The specific sequences and positions are as follows (lowercase letters are vector sequences, uppercase letters are genome sequences, underlined sequences represent primers, and bold sequences represent probes): gccgcattaccctgttatcc ctaggccgcataacttcgtatagcctacattataggatggagggatatcctctcttaaggtGGGGGTATTATGAGGGCTCTAATGGTCTATTAGAGGGTACGGGGGTCTAAAAACACCTCCACCCCCACGCTGTCTCCGCCTCTGCTAGAATACAATAATA CAATAGTAGTTACATTCTTCCATTCCCTC The primer and probe sequences are as follows: Primer 1: 5′-GCCGCATTACCCTGTTATCC-3′ Primer 2: 5′-GAGGGAATGGAAGAATGTAACTACTATTG-3′ Probe P: FAM-TCTAAAAACACCTCCACCCCCACGC-BHQ1 Example 2 Preparation of Standards To quantitatively analyze the initial template amount of a sample using Real-time PCR, a standard curve needs to be made with a standard product of known copy number. Then, the Ct value of the sample to be tested is obtained through PCR, and finally, the copy number of the sample is calculated from the standard curve. Therefore, an appropriate standard product needs to be prepared first, and the preparation method is as follows: I. Extraction of genomic DNA of rice RN85N-e3 The CTAB method is used for extraction, and the specific steps are as follows: 1) Take 0.2 g of rice RN85N-e3 leaves, grind them into powder, and add 500 - 800 μL of CTAB, then incubate at 65 °C for 0.5 h; 2) Add 700 μL of chloroform or chloroform:isoamyl alcohol (24:1), shake gently, centrifuge at 12000 rpm for 15 min, and take 400 - 700 μL of the supernatant; 3) Add 1 mL of pre-cooled absolute ethanol or isopropanol, mix well, centrifuge at 12000 rpm for 10 min, and discard the supernatant; 4) Wash the precipitate with 75% alcohol, centrifuge at 12000 rpm for 5 min, discard the alcohol, and invert to absorb and dry; 5) Dissolve the DNA with 50 μL of ddH 2 O. After taking 5 μL for electrophoresis detection, measure the DNA concentration with a UV spectrophotometer to be 1.0 μg / μL.
[0037] II. Preparation of standard products with a series of concentration gradients When performing Real-time PCR, the standard product template concentration needs to be in the unit of "copy / μL".
[0038] Calculation formula: Template concentration (copy / μL) = Avogadro's constant × template mole number, where Avogadro's constant = 6.02×10 23 copies / mol, and template molecular weight = template DNA length (number of bases) × 660 (average molecular weight of bases).
[0039] According to the above formula, the 1.0 μg / μL RN85N-e3 genomic DNA solution is 6.02×10 23 copies / mol × (1.0×10 -6 g / μL) / (460×10 6 × 660 g / mol), which is 2×10 6 copies / μL Take 1 μL of the above solution and perform 10-fold serial dilution to obtain concentrations of 2×10 5 copies / μL, 2×10 4Copies / μL, 2×10 3 Copies / μL, 2×10 2 Copies / μL, 2×10 copies / μL and 2 copies / μL of standards. Store at -20 °C for later use. Example 3 Establishment and Optimization of Probe-based Real-time PCR Reaction System In the present invention, available probe and primer combinations were obtained through the operations of Example 1, and a series of standard products with concentration gradients were obtained through Example 2. However, whether the specific Real-time PCR reaction system can have better effects is also affected by factors such as primer and probe concentrations. Therefore, in order to obtain efficient and accurate quantitative results, it is necessary to further optimize the PCR reaction system.
[0040] I. Establish a preliminary Real-time PCR reaction system By diluting the primer and probe combination A1 screened in Example 1 and adding deionized water to dilute its concentration to a working solution of 10 μM, probe-based Real-time PCR amplification was carried out to establish a reaction system.
[0041] The PCR reaction system was: 2×qPCR Mix 10 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, 10 μM probe 0.25 μL, template DNA 1 μL, ddH 2 O was supplemented to a total volume of 20 μL. Using RN85N-e3 genomic DNA as the template, ddH 2 O was used as a blank control.
[0042] The Real-time PCR reaction program was: 95 °C for 10 min; 95 °C for 10 s, 60 °C for 20 s, 72 °C for 40 s (collect fluorescence signal), and a total of 40 - 45 cycles were carried out.
[0043] II. Optimize the Real-time PCR reaction system Five concentration gradients were set for the final primer concentration, which were 0.2, 0.3, 0.4, 0.5, and 0.6 μM respectively, and the corresponding probe concentration was 1 / 2 times the primer concentration. The Real-time PCR test results of each treatment are shown in Table 5.
[0044] Table 5 Tests of Different Primer and Probe Concentrations Final concentration of primer (μM) Final concentration of probe (μM) Ct 0.2 0.1 33.00 0.3 0.15 30.45 0.4 0.2 25.62 0.5 0.25 29.95 0.6 0.3 31.10 The results showed that: the Ct value of the PCR reaction system with a primer concentration of 0.4 μM and a probe concentration of 0.2 μM was the smallest, and the fluorescence signal value was the highest. Therefore, it was determined that the final primer concentration for subsequent experiments was 0.4 µM and the probe concentration was 0.2 µM.
[0045] The optimized reaction system is as follows: 2×qPCR Mix 10 μL, 10 μM forward primer 0.8 μL, 10 μM reverse primer 0.8 μL, 10 μM probe 0.4 μL, template DNA 1 μL, ddH 2 O is supplemented to a total volume of 20 μL. Using RN85N-e3 genomic DNA as the template and ddH 2 O as the blank control. Example 4 Sensitivity Test Sensitivity refers to the lowest copy number of a sample that can be detected by a PCR amplification reaction, that is, the lowest detection limit. When detecting standard products with different concentrations by Real-time PCR, when a standard product at a certain concentration does not show a typical amplification curve, or can form an amplification curve but the Ct value > 35, it is considered that the standard product at this concentration exceeds the lowest detection limit of the PCR system.
[0046] Using the probe and primer combination A1 described in Example 1, the reaction system optimized in Example 3, and using the standard products in Example 2 (concentrations of 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL, 2×10 copies / μL and 2 copies / μL) as templates (3 parallel tests for each concentration), and ddH 2 O as the blank control, perform Real-time PCR amplification to determine the lowest detection limit of the detection method of the present invention. Obtain the amplification curve according to the fluorescence signal detected by the instrument and record the Ct value (Table 6). The results show that when the concentration of the standard product < 20 copies / μL, the Ct value of the amplification curve > 35. Therefore, the lower detection limit of Real-time PCR is 20 copies / μL.
[0047] The above sensitivity detection results show that when the concentration of the transformant in the sample is lower than 20 copies / μL, the Ct value of the amplification curve is greater than 35, that is, it is considered that the RN85N-e3 transformant is not detected in the sample, and the detection result is negative.
[0048] Table 6 Sensitivity Test Results Sample 1 2 3 4 5 6 Template concentration (copies / μL) <![CDATA[2×10 5 > <![CDATA[2×10 4 > <![CDATA[2×10 3 > <![CDATA[2×10 2 > 2×10 2 Ct 20.42 22.84 24.72 28.66 33.52 35.57 Example 5 Plotting the Standard Curve Using multiple standards with gradient concentrations as templates for Real-time PCR and recording the Ct values, a standard curve is plotted based on the initial template amount (logarithm of the copy number) and the Ct value to obtain a standard equation. When quantifying the initial template of the sample to be tested, only the amplification curve needs to be obtained, the Ct value read, and the initial template amount of the sample to be tested can be calculated by substituting it into the standard equation.
[0049] Using the standards of Example 2 (concentrations of 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL, 2×10 copies / μL) as templates (3 parallel tests for each concentration), ddH 2 O as the blank control, using the primer / probe combination A1 of Example 1, and adopting the reaction system in Example 2, Real-time PCR amplification is carried out.
[0050] Taking the logarithm of the standard concentration as the abscissa and the Ct value as the ordinate, a standard curve is plotted, as shown in Figure 1 . The standard curve equation of the present invention is y = -3.0383x + 35.853 (y represents the Ct value, x is the logarithm of the copy number), the standard curve shows a good linear relationship, R² = 0.9504, the correlation coefficient is high, and it meets the requirements of Real-time PCR quantitative detection. Example 6 Detection Kit Prepare a kit for detecting rice RN85N-e3 according to the following composition: 2×qPCR Mix, 10 μM forward primer, 10 μM reverse primer, 10 μM probe, the standard of Example 2, and ddH 2 O.
[0051] The primers and probes are the combination A1 described in Example 1.
[0052] The reaction system of this kit can be: 2×qPCR Mix 10 μL, 10 μM forward primer 0.8 μL, 10 μM reverse primer 0.8 μL, 10 μM probe 0.4 μL, template DNA 1 μL, ddH 2 O 7 μL, and the total reaction volume is 20 μL.
[0053] The reaction program of this kit for Real-time PCR is: 95°C for 10 min; 95°C for 10 s, 60°C for 20 s, 72°C for 40 s (collecting fluorescence signals), for a total of 40 - 45 cycles.
[0054] When using the kit to detect a sample, an amplification curve is obtained from the fluorescence signal detected by the instrument, and the copy number of the sample is calculated according to the standard equation established with the standard product and the Ct value of the sample to be detected. Example 7 Specificity Test and Sample Detection Extract the genomic DNA of rice transformant RN85N-e3, receptor control Nipponbare, and other transformant material RN85zN-eJ using the DNA extraction method (CTAB method) of Example 2. Mix the genomic DNA of Nipponbare and RN85N-e3 as Sample 1, and mix the genomic DNA of Nipponbare and RN85N-e1 as Sample 2. Use water as the blank control, and perform Real-time PCR amplification using the kit described in Example 6 and the reaction system of Example 3 for specificity test detection. Obtain the amplification curve according to the fluorescence signal detected by the instrument, as Figure 2 shown.
[0055] Calculate the copy number according to the Ct value of each sample in the amplification curve. The results are shown in Table 7: The Ct value of the amplification curve of Sample 1 is 22.49, and the copy number is 25014, and the test result is positive; the Ct value of the amplification curve of Sample 2 is greater than 35, and the copy number is lower than the lowest detection limit of 20 copies / μL. Therefore, the test result is negative. Thus, it can be seen that the detection system established by the present invention has good specificity.
[0056] Table 7 Detection Results of Specificity Test of Test Samples Sample Ct Copy number 1 22.49 25014 2 35.81 1.03 <![CDATA[ddH 2 O]]> - - The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make changes or modifications to equivalent embodiments by using the technical content disclosed above within the scope of the technical solution of the present invention. However, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A probe and primer combination, characterized in that The nucleotide sequence of the probe is 5'-TCTAAAAACACCTCCACCCCCACGC-3', and the nucleotide sequences of the primers are 5'-GCCGCATTACCCTGTTATCC-3' and 5'-GAGGGAATGGAAGAATGTAACTACTATTG-3'.
2. The probe and primer combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group; The fluorescent group is any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA or Texas; the quenching group is any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL or MGB.
3. The probe and primer combination according to claim 2, characterized in that: The combination of the fluorescent group and the quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA or VIC / BHQ2.
4. The probe and primer combination according to claim 3, characterized in that: The fluorescent group is FAM; the quenching group is BHQ1.
5. A kit, characterized in that: The kit comprises the probe and primer combination according to any one of claims 1 to 4 and a standard; Wherein, the standard is a RN85N-e3 sample with a concentration of not less than 20 copies / μL; Among them, the RN85N-e3 sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO.
1.
6. The kit according to claim 5, characterized in that: The standard substances are 5 kinds of concentrations, 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL and 2×10 copies / μL of RN85N-e3 genomic DNA.
7. Real-time PCR detection method, characterized in that: Real-time PCR detection is performed using the kit described in any one of claims 5 to 6, wherein the final concentration of primers in the PCR reaction system is 0.4 μM, and the final concentration of the probe is 0.2 μM.
8. Use of the probe and primer combination according to any one of claims 1 to 4, the kit according to any one of claims 5 to 6, and the detection method according to claim 7 in detecting RN85N-e3 samples; in, The RN85N-e3 sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1.
Citation Information
Patent Citations
Specific probe, primer, kit and method for detecting nucleic acid sample
CN119433095A
Insect-resistant and herbicide-resistant transgenic rice RN85N-e3 and detection method thereof
CN119530216A