LncRNA and application thereof
By targeting the lncRNA Myh6-AS1, Myh6-AS1, and Myh6-AS1 interact with Upf1, destroying the stability of Egr1 mRNA and downregulating Egr1 expression, solving the problem of difficulty in inhibiting Egr1 expression in the prior art, significantly improving depression-like behavior and hippocampal neuroplasticity.
Patent Information
- Application Number
- CN202510215573.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-26
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to effectively inhibit the expression of early growth response factor 1 (Egr1) in hippocampal tissue, thereby improving depressive behavior.
By targeting the long-chain non-coding RNA (lncRNA) Myh6-AS1 that inhibits Egr1 expression in hippocampal tissue, Myh6-AS1 destroys the stability of Egr1 mRNA by interacting with Upf1, thereby downregulating the expression level of Egr1.
Overexpression of Myh6-AS1 significantly improved chronic unpredictable mild stress (CUMS)-induced depressive-like behavior in rats and repaired hippocampal neuroplastic damage.
Smart Images

Figure CN120060253A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a long non-coding RNA drug, in particular to a LncRNA and its application in antidepressant drugs. Background Art
[0002] Depression is a common neurological and psychiatric disease that is caused by the interaction of social, psychological, and biological factors and poses a serious threat to human physical and mental health. According to statistics, by 2022, the number of people suffering from major depression worldwide had reached 322 million, accounting for approximately 3.1% of the population. Although a large number of studies have been devoted to revealing the pathophysiological basis of depression, its exact mechanism remains to be fully elucidated. Chronic stress is considered to be a major cause of depression. Long-term exposure to stressful environments can lead to apoptosis of hippocampal neurons and damage synaptic plasticity, which in turn triggers depressive-like behaviors.
[0003] Long noncoding RNAs (lncRNAs), the most diverse class of noncoding RNAs, have garnered significant attention in depression research. Studies have found that lncRNAs are abundantly expressed in various brain tissues, including the hippocampus, prefrontal cortex, hypothalamus, and striatum. These lncRNAs may contribute to the pathogenesis and treatment of depression by influencing various processes, including inflammation, oxidative stress, apoptosis, and autophagy, in neurons and glial cells. Postmortem brain tissue studies of patients with depression have revealed abnormal expression of lncRNAs in the prefrontal cortex and hippocampus. Clinical studies have found decreased expression of the lncRNA RMRP in peripheral blood leukocytes of patients with depression, with RMRP levels correlating with depression severity. Animal studies have shown an increase in M1 microglia and a decrease in M2 microglia in the hippocampus of depressed rats. Expression of the lncRNA uc.80 is also downregulated, and overexpression of lncRNA uc.80 can mitigate apoptosis in rat hippocampal neurons. Numerous studies have elucidated the role of lncRNAs in the development and progression of depression, demonstrating their potential as clinical diagnostic and therapeutic targets for depression.
[0004] LncRNAs interact with RNA-binding proteins (RBPs) to exert diverse functions, including transcriptional regulation, chromatin modification, protein localization and activity, and mRNA stability and translation. Nonsense-mediated mRNA degradation factor 1 (Upf1) is a common RNA-binding protein and a key molecule in RNA decay pathways. The most common RNA decay pathways involved in Upf1 are nonsense-mediated mRNA decay (NMD) and staufen (STAU)-mediated mRNA decay (SMD). Recent studies have shown that NMD not only degrades aberrant transcripts but also regulates the expression of normal genes, with the stability of 5-10% of normal physiological mRNAs regulated by NMD. For example, Upf1 can bind to ZFPM2-AS1 and the 3'UTR region of ZFPM2 mRNA, forming a binding complex in lung adenocarcinoma cells. The synergistic action of ZFPM2-AS1 and UPF1 destabilizes ZFPM2 mRNA, downregulating ZFPM2 expression and promoting proliferation, invasion, and epithelial-mesenchymal transition (EMT) in lung adenocarcinoma cells. However, the roles of lncRNA and Upf1 in depression remain unclear.
[0005] Early growth response 1 (Egr1) is a nuclear transcription factor involved in cell proliferation and differentiation, and is involved in the regulation of the expression of multiple target genes in the human body. Studies have found that Egr1 expression levels are increased in the brains of AD patients, and Egr1 protein is enriched in neurons with high neurofibrillary tangle density. Chronic stress, such as restraint, immobilization, or forced swimming, leads to increased Egr1 mRNA levels throughout the brain, including the neocortex, hippocampus, lateral septum, caudate putamen, nucleus accumbens, amygdala, and paraventricular nucleus of the hypothalamus. In addition, exposure to forced swimming stress or activation of the glucocorticoid receptor (GR) upregulates Egr1 expression in the hippocampus of rats or mice, thereby mediating stress-related fear memory. Summary of the Invention
[0006] Objectives of the Invention: This invention aims to provide a long noncoding RNA (LncRNA) that specifically inhibits the expression of early growth response factor 1 (EGR1) in hippocampal tissue, addressing the problem of how to improve depressive behavior by inhibiting Egr1. Another objective of the invention is to propose the use of this LncRNA in antidepressant medications, addressing the problem of how to obtain these medications. A third objective of the invention is to provide an antidepressant pharmaceutical composition, addressing the problem of how to prepare these medications.
[0007] Technical solution: The present invention discloses a LncRNA that targets and inhibits the expression of early growth response factor 1 in hippocampal tissue.
[0008] Preferably, the LncRNA comprises the nucleotide sequence shown in SEQ ID No. 1. The LncRNA is called Myh6-AS1, and the expression of Myh6-AS1 is significantly downregulated in the hippocampus of rats with depression induced by chronic unpredictable mild stress (CUMS).
[0009] Another aspect of the present invention discloses the use of the above-mentioned LncRNA in antidepressant drugs.
[0010] The target gene of Myh6-AS1 in the present invention is early growth response factor 1 (Egr1). Myh6-AS1 interacts with Upf1 to destroy the stability of Egr1 mRNA, thereby downregulating the expression level of Egr1 in hippocampal tissue and exerting an antidepressant effect.
[0011] Preferably, the antidepressant drug is a vector that overexpresses the LncRNA in living cells.
[0012] The present invention demonstrates that overexpression of Myh6-AS1 improves CUMS-induced depressive-like behavior in rats by restoring hippocampal neuroplasticity. Conversely, silencing Myh6-AS1 exacerbates CUMS-induced depressive-like behavior. At the cellular level, overexpression of Myh6-AS1 improves corticosterone (CORT)-induced damage in PC12 cells.
[0013] Preferably, the vector comprises at least one of a plasmid, a virus, and a liposome.
[0014] Preferably, the virus comprises at least one of a recombinant adeno-associated virus, a recombinant lentivirus, and a recombinant adenovirus.
[0015] Preferably, the living cells are nerve cells in the hippocampus tissue of the brain.
[0016] The third aspect of the present invention discloses an antidepressant pharmaceutical composition comprising the aforementioned LncRNA and pharmaceutically acceptable excipients.
[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:
[0018] The lncRNA Myh6-AS1 in this study effectively improves CUMS-induced depressive-like behavior in rats by restoring hippocampal neuroplasticity. Furthermore, the study also demonstrates that Myh6-AS1 exerts its antidepressant effects by interacting with Upf1 and inhibiting Egr1 expression, revealing the important role of Myh6-AS1 in depression and providing a new target for the treatment of depression. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 Effects of chronic stress on lncRNA expression in rat hippocampus;
[0020] Figure 2 To investigate the effects of Myh6-AS1 overexpression on CUMS-induced hippocampal plasticity impairment and depressive-like behavior in rats;
[0021] Figure 3 To investigate the effects of down-regulating Myh6-AS1 expression on CUMS-induced hippocampal plasticity impairment and depressive-like behavior in rats;
[0022] Figure 4 Effects of overexpression of Myh6-AS1 on CORT-induced damage in PC12 cells;
[0023] Figure 5 Screening and finding results for Myh6-AS1 target genes;
[0024] Figure 6 Target validation results for Myh6-AS1's cytoprotective effects;
[0025] Figure 7 The results of the research on the mechanism of protection of Myh6-AS1. DETAILED DESCRIPTION
[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0027] Example 1: A LncRNA Myh6-AS1 that targets and inhibits early growth response factor 1 (Egr1) in hippocampal tissue, the nucleic acid sequence of which is as follows:
[0028] GGAAATCAGAAGGAGCCGGCCTCACCTTGTTCTCTGTTGCGTGCTTTTCCTTCTCC
[0029] ACCTTGGCCAGGGTCAGCTCCAGGTCATCGATATCTTTCTTGAGCTCTGAGCACTC
[0030] GTCTTCCAGCTTGCCGCTTCTTGGCCGTGAGCTCGGCGTTCATCTCCTCCTCGTCCTC
[0031] CAGCCTCTCGGTCATCTCCTTCACCTTGGCCTCCAGCTGGATCTTGTTCTTGATCAG
[0032] CTGGTCGCAGCGCTCCTCGGCATCTGCCAGGTTGTCTTGTTCCTGGGGGCGAGGG
[0033] ACAGGGTCAAGGATCAAAGAGATTAAAGAGAGGGAAGATGCAGGGTCTGGCAA
[0034] AGGGCTGGAGCTTCCAGATTCCCAGACTCTGGGGATGAGGTGGGCAAAGGATCCA
[0035] GGAGACAGGAAAGGAGAGAGACGAGAGAGCCATGTGGCCTCACCGCCTGCACTT
[0036] GGAGCTGCAGGTCATTCTTCTCCTGCAGCAGGGACACCATCTTCTCCTCCAGCTCC
[0037] TTGCGGCGAGCCTCAGACTTCTCTAGTGCATC
[0038] The study on the association between Myh6-AS1 and CUMS-induced depressive-like behavior in rats is as follows:
[0039] Materials and methods
[0040] animal
[0041] Adult male Sprague-Dawley rats (weighing 170-200 g) were purchased from Nanjing Qinglongshan Animal Farm (Nanjing, China). They were housed under standard laboratory conditions (12-h light / 12-h dark cycle, temperature 23 ± 2°C, relative humidity 50 ± 10%). After acclimation for 7 days, the rats were randomly divided into different groups for the experiment.
[0042] Establishment of a rat depression model using chronic unpredictable mild stress (CUMS)
[0043] Refer to CUMS. Stimuli include: water and food deprivation (24 hours), swimming in 10°C ice water (5 minutes), tail pricking (3 times / 3-5 seconds), day and night reversal, tail suspension (3 times / 1 minute), moist bedding for 24 hours, and 45° tilted cage (24 hours). CUMS group rats were housed individually in cages, and a randomized, unpredictable stimulation method was used daily. Control group rats were placed in a separate, quiet room, four per cage, without any stimulation.
[0044] Behavioral testing
[0045] Open field test (OFT)
[0046] The rats were slowly placed in a homemade 100cm×100cm×50cm open field experimental behavior observation box. The rats' movement status within 5 minutes was captured by a camera, and data such as the total movement distance and number of standing times of the rats were recorded.
[0047] Sucrose preference test (SPT)
[0048] A complete SPT experiment lasted four days: On day 1, each rat was given two bottles of 1% sucrose water; on day 2, each rat was given one bottle of 1% sucrose water and one bottle of pure water (the bottles were rotated every two hours); on day 3, the rats were not given any food or water; on day 4, the weight of each bottle of sucrose water and pure water was weighed and recorded. Subsequently, each rat was given one bottle of 1% sucrose water and one bottle of pure water, and the weight of each bottle was weighed two hours later. Sucrose preference (%) = sucrose consumption / (sucrose water consumption + pure water consumption) × 100%.
[0049] Forced swim test (FST)
[0050] The rats were placed in a cylindrical resin glass barrel with a water depth of 45 cm. The movement state of the rats was captured by a camera. The rats were allowed to move freely for 1 minute, and the data such as the immobility time of the rats were recorded for the following 4 minutes.
[0051] FISH and immunofluorescence
[0052] Cells were fixed with 4% PFA in PBS (pH 7.4) and incubated on ice for 10 minutes with 0.3% Triton X-100 in PBS. Cells were washed three times with 1× PBS for 5 minutes each, then a FISH probe targeting Myh6-AS1 (RiboBio, China) was added and incubated overnight at 37°C in the dark. Following incubation, cells were washed three times with 2× SSC at 42°C for 5 minutes each. Anti-Upf1 (A5071, ABclonal, China) was then added and incubated in the dark for 2 hours at room temperature. After washing with 1× PBS, Goat Anti-Rabbit IgG Fluor488 (S0018, Proteintech, China) was added and incubated in the dark for 1 hour at room temperature. After washing again, cells were counterstained with DAPI for 10 minutes and imaged using a laser scanning confocal microscope.
[0053] Transcriptome sequencing
[0054] Total RNA was isolated from PC12 cells using TRNzol reagent (DP424, TIANGEN, China). Transcriptome sequencing was performed by Shanghai Bohao Biotechnology Co., Ltd. (Shanghai, China), and heat maps were generated and visualized using Cluster 3.0 software. The thresholds for up- and down-regulated genes were log2FC ≥ 2.0 and P ≤ 0.01.
[0055] Statistical analysis
[0056] All data are expressed as standard deviation ± mean Data were analyzed using SPSS 22.0 software, and visualization was performed using GraphPad Prism 9.0 software. Differences between groups were compared using one-way or multiway analysis of variance, followed by the Student-Newman-Keuls test. P < 0.05 indicated statistical significance.
[0057] Experimental results: LncRNA Myh6-AS1 is downregulated in the hippocampus of male rats by chronic stress
[0058] The present invention used the widely used CUMS depression rat model. Behavioral tests such as OFT, SPT, and FST showed that the model was successfully constructed. Then, transcriptome sequencing was performed on the hippocampal tissues of the normal group and the CUMS group rats to identify differentially expressed lncRNAs. The lncRNAs with significant differential expression were screened under the conditions of log2FC≥0 and P≤0.01. It was found that compared with the normal group, 37 lncRNAs were upregulated and 53 lncRNAs were downregulated in the hippocampus of the CUMS rats. Figure 1 As shown in Figure AB and Tables 1 and 2. Combining qRT-PCR verification and sequence conservation analysis, it was found that lncRNA NONRATT010417.2 was significantly low-expressed in the hippocampus of CUMS rats and was highly homologous to human lncRNA NONHSAT168178.1, as shown in Figure AB and Tables 1 and 2. Figure 1 As shown in Figures C and D, NONRATT010417.2 was selected for subsequent research. NONRATT010417.2 is located in rat chr15:33,617,844-33,618,376, has only one exon, and is 532 nucleotides long. It is the antisense lncRNA of the rat myosin heavy chain 6 (Myh6) gene, so it was named lncRNA Myh6-AS1. Myh6-AS1 is expressed throughout the body and is enriched in the brain and heart, as shown in Figures C and D. Figure 1As shown in Figure E. Compared with normal rats, the expression level of Myh6-AS1 in the hippocampus of CUMS-stimulated rats was significantly decreased, slightly decreased in the prefrontal cortex, but no significant changes were found in the striatum, midbrain and cerebellum. Figure 1 As shown in Figures F, J. These results indicate that chronic stress inhibits the expression of Myh6-AS1 in the hippocampus of CUMS rats.
[0059] Table 1. Genes with significantly upregulated lncRNA expression
[0060]
[0061]
[0062] Table 2 Genes with significantly downregulated lncRNA expression
[0063]
[0064]
[0065] Among them, group C is the blank control group and group M is the model group.
[0066] Example 2: LncRNA Myh6-AS1 was used to improve CUMS-induced depressive-like behavior in rats, as follows:
[0067] Stereotaxic injection of AAV vectors
[0068] Rats were anesthetized with an intraperitoneal injection of 3% sodium pentobarbital solution (0.2 mL / 100 g) and placed in a stereotaxic apparatus. Adeno-associated virus (1.5 μL) was stereotaxically injected into the bilateral hippocampus at the following coordinates: anterior-posterior, -3.24 mm; medial-lateral, ±1.8 mm; dorsal-ventral, -3.0 mm. The virus was injected at a rate of 0.3 μL / min and left in place for 5 min to ensure viral diffusion. Adeno-associated viruses for Myh6-AS1 overexpression and silencing were purchased from GeneGene (Shanghai, China). The shRNA sequence targeting Myh6-AS1 was CGAGCCUCAGACUUCUCUATT.
[0069] TUNEL staining
[0070] TUNEL staining was performed using a TUNEL apoptosis detection kit (C1089, Beyotime, China) purchased from Beyotime Biotechnology Co., Ltd. according to the manufacturer's instructions. After all behavioral tests were completed, the rats were anesthetized and perfused with 4% paraformaldehyde (PFA). The brains were fixed in PFA at 30°C overnight, graded and dehydrated, and then cut into serial coronal frozen sections (10 μm). Tissue sections were incubated with TUNEL detection solution at 37°C for 60 min, then counterstained with DAPI (C1005, Beyotime, China) for 10 min, and images were captured using a laser scanning confocal microscope.
[0071] Golgi staining
[0072] Golgi staining was performed by Sevier Biotechnology Co., Ltd. (Wuhan, China) to examine changes in dendritic spines in rat hippocampal neurons. Briefly, rats were anesthetized and the brains were quickly removed and immersed in Golgi staining fixative. The brains were stained with Golgi staining solution in the dark for 14 days. The brain samples were cut into 100 μm coronal slides, washed with xylene, and mounted. Images were acquired using a slide scanner. At least five neurons per rat were analyzed, and at least four to six dendritic segments per neuron were randomly selected. The number of dendritic spines was analyzed using ImageJ software.
[0073] Western blot detection
[0074] Tissue and cell samples were sonicated in RIPA lysis buffer (P0013B, Beyotime, China) containing protease inhibitors (P1005, Beyotime, China). Samples were centrifuged at 12,000 g for 20 minutes at 4°C. The supernatant was aspirated and the protein concentration was determined using a BCA protein assay kit (P0010, Beyotime, China). Protein samples were added with an appropriate amount of 5× loading buffer (P0286, Beyotime, China) and heated in water at or above 90°C for 10 minutes. Electrophoresis was performed on a SDS-PAGE gel and subsequently transferred to a PVDF membrane. The PVDF membrane was incubated with anti-PSD95 (20665-1-AP, Proteintech, China), anti-Syn (17785-1-AP, Proteintech, China), anti-BDNF (25699-1-AP, Proteintech, China), anti-Bax (AF0120, Proteintech, China), anti-Bcl-2 (AF6139, Proteintech, China), anti-Cleaved caspase3 (AF7022, Affinity, China), anti-Upf1, anti-Egr1 (22008-1-AP, Proteintech, China), and anti-β-actin (AC006, ABclonal, China) at 4°C overnight, and then developed after incubation with Goat Anti-Rabbit IgG (SA00001-2, Proteintech, China) at room temperature for 2 h.
[0075] To determine the effect of Myh6-AS1 on depressive-like behavior in rats, the inventors microinjected a recombinant adeno-associated virus encoding Myh6-AS1 (AAV-Myh6-AS1) into the bilateral hippocampus. Six weeks later, behavioral tests were performed. The results showed that overexpression of Myh6-AS1 significantly improved the depressive-like behavior of CUMS rats, including increased movement distance, number of stances, and sucrose preference, and reduced forced swimming immobility time. Figure 2 As shown in Figures AD. There is increasing evidence that hippocampal function is abnormal in depression, including neuronal apoptosis and synaptic plasticity impairment. Therefore, further investigation was conducted to determine whether the antidepressant effect of Myh6-AS1 involves the regulation of hippocampal neuroplasticity. TUNEL staining showed that the apoptosis level in the hippocampus of CUMS rats was significantly increased, while it was significantly inhibited after the use of AAV-Myh6-AS1. Figure 2As shown in Figure EG. Western blot results showed that the expression of Bax and Cleaved caspase3 proteins in the hippocampus of CUMS rats was upregulated, and the expression of Bcl-2 protein was decreased. However, overexpression of Myh6-AS1 reversed the expression levels of these apoptosis-related proteins. Figure 2 Next, the dendritic spine density of hippocampal neurons was observed using the Golgi staining method. Compared with normal rats, the dendritic spine density of hippocampal neurons in CUMS rats was reduced, while overexpression of Myh6-AS1 restored the number of dendritic spines to a certain extent, as shown in Figure 5. Figure 2 Western blot results showed that the expression levels of synaptic-related proteins such as PSD95, Syn, and BDNF in the hippocampus of CUMS rats were decreased, which was significantly reversed after overexpression of Myh6-AS1. Figure 2 These results indicate that overexpression of Myh6-AS1 in the hippocampus can ameliorate CUMS-induced hippocampal plasticity impairment and depressive-like behavior in rats.
[0076] Silencing Myh6-AS1 exacerbates CUMS-induced depressive-like behavior in rats
[0077] Given that overexpression of Myh6-AS1 significantly improved the depressive-like behavior of CUMS rats, whether silencing Myh6-AS1 would lead to aggravation of depressive-like behavior, an effective shRNA was constructed for bilateral hippocampal microinjection of adeno-associated virus (AAV-shMyh6-AS1) to specifically knock down Myh6-AS1. Six weeks later, behavioral tests showed that silencing Myh6-AS1 did not induce depressive-like behavior in normal rats, but knocking down Myh6-AS1 while the rats were receiving CUMS stimulation significantly aggravated their depression, as manifested by a decrease in sucrose preference and a prolonged forced swimming immobility time. Figure 3 As shown in Figures AD. TUNEL staining showed that silencing Myh6-AS1 further increased the apoptosis level in the hippocampus of CUMS rats. Figure 3 As shown in Figure EG. Western blot results showed that compared with the CUMS group, silencing Myh6-AS1 upregulated the protein expression levels of Bax and Cleavedcaspase3 and downregulated the protein expression level of Bcl-2. Figure 3 Similarly, Golgi staining showed that after silencing Myh6-AS1, the density of dendritic spines in hippocampal neurons of CUMS rats was further reduced, as shown in Figure 5. Figure 3 As shown in the middle LM figure. Western blot results showed that compared with the CUMS group, the expression levels of synaptic-related proteins such as PSD95, Syn and BDNF decreased after silencing Myh6-AS1. Figure 3 These results indicate that decreased Myh6-AS1 expression in the hippocampus exacerbates CUMS-induced depression in rats.
[0078] Example 3: Overexpression of Myh6-AS1 ameliorates CORT-induced PC12 cell damage as follows:
[0079] In order to clarify the specific molecular mechanism of Myh6-AS1, the present invention used PC12 cell line for further research and observed its protective effect on PC12 cells by overexpressing Myh6-AS1.
[0080] Cell culture
[0081] Rat adrenal pheochromocytoma PC12 cell line was purchased from Pusino Life Science Co., Ltd. (Wuhan, China). PC12 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum, 1% penicillin and streptomycin in a cell culture incubator with 5% CO2 and 37°C.
[0082] PC12 cells were stimulated with corticosterone (CORT) to simulate neuronal apoptosis and synaptic damage. Overexpression plasmids targeting Myh6-AS1 and Egr1 were purchased from Ruibo Biotechnology Co., Ltd. (Guangzhou, China). After transfection with the overexpression plasmids, PC12 cells were stimulated with CORT for 24 hours and then harvested for subsequent experiments.
[0083] Flow cytometry showed that CORT induced apoptosis in PC12 cells, while overexpression of Myh6-AS1 significantly decreased the apoptosis rate. Figure 4 As shown in Figures AB. Western blot results showed that CORT stimulation increased the expression levels of Bax and Cleavedcaspase3 in PC12 cells, and decreased the expression levels of Bcl-2, PSD95, Syn, and BDNF, while overexpression of Myh6-AS1 significantly reversed the expression levels of apoptosis and synapse-related proteins. These results indicate that overexpression of Myh6-AS1 improves CORT-induced damage in PC12 cells. Figure 4 As shown in Figure CJ.
[0084] Example 4: Study on the target gene and antidepressant molecular mechanism of Myh6-AS1, the method is as follows:
[0085] RNA pull-down and mass spectrometry analysis
[0086] RNA pull-down assays of biotinylated Myh6-AS1 were performed using a biotin RNA pull-down kit (FI8702, FITGENE, China) according to the manufacturer's instructions. Biotinylated Myh6-AS1 was mixed with proteins obtained from PC12 cell lysates, and the RNA-protein complex was captured by streptavidin magnetic beads. The protein was then eluted from the complex and subjected to mass spectrometry analysis and Western blot detection by Guangzhou Huijun Biotechnology Co., Ltd.
[0087] RIP detection
[0088] According to the manufacturer's instructions, use The binding of Upf1 to Myh6-AS1 and Egr1 mRNAs was detected using an RNA Immunoprecipitation Kit (P0101, GENESEED, China). Magnetic beads were linked to anti-Upf1 and anti-IgG (2 μg) and incubated with PC12 cell lysate overnight at 4°C, 10 rpm, and then washed three times. RNA-protein complexes bound to the beads were eluted and analyzed by qRT-PCR and Western blot, respectively.
[0089] qRT-PCR detection
[0090] Total RNA was extracted from various tissues and cell lines using TRNzol reagent. RNA was reverse-transcribed into cDNA using the RevertAid First-Strand cDNA Synthesis Kit (K16225, Thermo Fisher, Canada). PCR amplification was performed using the QuantiNova SYBR Green PCR Kit (208052, QIAGEN, Germany) in a real-time quantitative PCR instrument (Bio-Rad, America). PCR primer sequences are shown in Table 3.
[0091] Table 3 PCR primer sequences
[0092]
[0093]
[0094] F represents the upstream primer and R represents the downstream primer.
[0095] Here are the results:
[0096] Egr1 is a target gene of Myh6-AS1
[0097] Only a small number of lncRNAs can be translated into polypeptides, while most lncRNAs play an indirect regulatory role by affecting the expression of downstream genes. lncRNAs can usually affect the expression levels of their own neighboring genes. The inventors tested the neighboring genes of Myh6-AS1, Myh6, Myh7, Cmtm5 and IL25, and the results showed that overexpression of Myh6-AS1 did not affect the expression of these genes. Figure 5 As shown in Figures AD. To identify the target genes of Myh6-AS1, the inventors performed transcriptome sequencing on PC12 cells transfected with negative control and Myh6-AS1 overexpression plasmids to identify differentially expressed mRNAs. Using log2FC ≥ 2.0 and P ≤ 0.01 as the criteria for screening significantly differentially expressed mRNAs, it was found that after Myh6-AS1 overexpression, 26 mRNAs were upregulated and 38 mRNAs were downregulated, as shown in Figures AD. Figure 5 As shown in Figure E. The Q-PCR verification results are largely consistent with the transcriptome data. Given that Egr1 has the largest copy number variation, the inventors selected Egr1 as the target gene of Myh6-AS1. Figure 5 As shown in Figure F. qRT-PCR and Western blot results showed that Myh6-AS1 downregulated the expression level of Egr1. Figure 5 As shown in the GI diagram.
[0098] Myh6-AS1 exerts a protective effect by inhibiting Egr1 expression
[0099] To verify whether Myh6-AS1 plays a role by regulating Egr1, the inventors designed a rescue experiment in which Egr1 was overexpressed simultaneously with Myh6-AS1. The results showed that overexpression of Egr1 caused apoptosis in PC12 cells to increase again. Figure 6 As shown in Figures AB, it reversed the effects of Myh6-AS1 on the expression levels of apoptosis- and synapse-related proteins such as Bax, Cleaved caspase3, Bcl-2, PSD95, Syn, and BDNF. Figure 6 These results indicate that Myh6-AS1 protects PC12 cells by inhibiting Egr1 expression.
[0100] Myh6-AS1 interacts with Upf1 and destabilizes Egr1 mRNA
[0101] The inventors further explored how Myh6-AS1 regulates Egr1 expression. LncRNAs exert different functions by interacting with proteins to form RNA-protein complexes. Therefore, the inventors conducted RNA pull-down experiments and then performed mass spectrometry analysis to identify the interacting proteins of Myh6-AS1. The results showed that Myh6-AS1 specifically binds to 238 proteins in vitro, such as Figure 7 As shown in Figure A. The subcellular localization of lncRNAs determines whether they function inside or outside the nucleus and bind to proteins with the same localization. The inventors found through FISH experiments that Myh6-AS1 is distributed in both the nucleus and the cytoplasm, but is mainly located in the cytoplasm, as shown in Figure 4. Figure 7 As shown in Figure B. Given that Myh6-AS1 can downregulate the expression level of Egr1 mRNA, the inventors further screened the interacting proteins of Myh6-AS1 and found that Upf1 is mainly localized in the cytoplasm and exerts its effect by destroying the stability of mRNA. Immunofluorescence results showed that Myh6-AS1 and Upf1 co-localized in the cytoplasm, as shown in Figure 2. Figure 7 Then, the interaction between Upf1 and Myh6-AS1 and Egr1 mRNA was further demonstrated by RIP experiments. The results showed that the pull-down product of Upf1 contained Myh6-AS1 and Egr1 mRNA, as shown in Figure 1. Figure 7 Finally, the actinomycin D experiment showed that overexpression of Myh6-AS1 significantly shortened the half-life of Egr1 mRNA, as shown in Figure EG. Figure 7 As shown in Figure H, where oe- represents overexpression, these results indicate that Myh6-AS1 interacts with Upf1 to destabilize Egr1 mRNA and downregulate Egr1 expression.
[0102] In this study, the inventors identified a role for the previously unidentified lncRNA Myh6-AS1 in depressive-like behavior in male rats. CUMS-induced decreased expression of Myh6-AS1 in the rat hippocampus, and overexpression of Myh6-AS1 improved depressive-like behavior in CUMS rats by restoring hippocampal neuroplasticity. Further studies demonstrated that Myh6-AS1 interacts with Upf1, destabilizing Egr1 mRNA and thereby downregulating Egr1 expression. This study highlights the role of lncRNAs in depressive-like behavior and provides a new target for the treatment of depression.
[0103] Through transcriptome sequencing, the inventors found that Myh6-AS1 was lowly expressed in the hippocampus of CUMS rats, and the expression level of Myh6-AS1 was negatively correlated with the depressive-like behavior of rats. Overexpression of Myh6-AS1 in the hippocampus significantly improved the depressive-like behavior of CUMS rats. Conversely, decreased expression of Myh6-AS1 in the hippocampus exacerbated the depressive-like behavior of CUMS rats. However, the exact mechanism by which chronic stress induces decreased Myh6-AS1 expression is still unclear. It has been shown that epigenetic regulation such as DNA methylation and chromatin remodeling plays an important role in behavioral changes induced by chronic stress. The overall level of DNA methylation in the brain increases in depression and inhibits the normal expression of a large number of genes.
[0104] To investigate whether Myh6-AS1 has a human lncRNA homolog, the inventors performed conservation analysis of rat and human lncRNAs. The predicted lncRNA, NONHSAT168178.1, is located at chr14:23386029–23416576 in the human genome, with a total length of 370 nucleotides. Sequence alignment revealed that the nucleotide sequences of Myh6-AS1 and NONHSAT168178.1 share approximately 40% similarity, indicating that Myh6-AS1 is at least partially conserved between rats and humans.
[0105] Most lncRNAs have only indirect regulatory effects, influencing the expression of downstream genes through multiple pathways. Therefore, the functions of lncRNAs are closely related to their target genes. The inventors used transcriptome sequencing to identify target genes of Myh6-AS1, and the results showed that the expression level of Egr1 was most significantly altered. Previous studies have shown that Egr1 is involved in the development and progression of depression. Egr1 inhibits activation of the PI3K / AKT signaling pathway, promoting hippocampal neuronal apoptosis and the release of inflammatory factors, thereby causing depressive-like behavior in mice. Furthermore, NMDA receptors control synaptic plasticity and memory function. Knockout of Egr-1 blocked NMDAR-induced PSD-95 downregulation and AMPA receptor endocytosis in the mouse hippocampus. These studies suggest that Egr1 can broadly influence hippocampal neuroplasticity. The inventors' results showed that overexpression of Myh6-AS1 inhibited neuronal apoptosis and synaptic damage, while simultaneous overexpression of Egr1 reversed the protective effects of Myh6-AS1 on neurons.
[0106] Although several lncRNAs have been functionally annotated in the central nervous system, most remain to be characterized. The specific regulatory mechanisms of lncRNAs can be predicted by their cellular localization. lncRNAs located in the nucleus can participate in transcriptional regulation, epigenetic modification, and alternative splicing. In the cytoplasm, lncRNAs are closely associated with mRNA stability, mRNA translation into protein, and various protein modifications. In our research, FISH results showed that Myh6-AS1 is primarily distributed in the cytoplasm, demonstrating that Myh6-AS1 functions there. RNA pull-down is widely used to identify lncRNA-interacting proteins. We discovered that Myh6-AS1 interacts with Upf1, a finding confirmed by RIP experiments. Upf1 can mediate the degradation of some mRNAs in cells, thereby regulating the expression of related genes. For example, Upf1 interacts with Tet2 to regulate the mRNA stability of stress-related genes such as Unc5b, thereby affecting the neurodevelopment of CMS mice. The results of the actinomycin D experiment showed that overexpression of Myh6-AS1 significantly shortened the half-life of Egr1 mRNA, proving that Myh6-AS1 destroyed the stability of Egr1 mRNA by interacting with Upf1.
[0107] In summary, Myh6-AS1 interacts with Upf1, destabilizing Egr1 mRNA and inhibiting Egr1 expression, thereby improving depressive-like behavior in male CUMS rats by restoring hippocampal neuroplasticity. This study identifies Myh6-AS1 as a therapeutic target for depression and reveals the specific molecular mechanism by which Myh6-AS1 regulates chronic stress-induced neuroplasticity impairment. The mechanism is as follows:
[0108] Under normal conditions, Myh6-AS1 interacts with Upf1, destabilizing Egr1 mRNA. Decreased Egr1 protein expression prevents it from acting as a transcription factor to regulate the transcription of downstream genes, thereby inhibiting neuronal apoptosis and synaptic plasticity impairment. However, after chronic stress, Myh6-AS1 expression significantly decreases, preventing Upf1 from degrading Egr1 mRNA. Egr1 then activates or inhibits the expression of apoptosis- and synaptic-related proteins, leading to neuronal damage.
Claims
1. A LncRNA that targets and inhibits the expression of early growth response factor 1 in hippocampal tissue.
2. The LncRNA according to claim 1, characterized in that It includes the nucleotide sequence shown in SEQ ID No.
1.
3. Use of the LncRNA according to claim 1 or 2 in antidepressant drugs.
4. The use according to claim 3, characterized in that: The antidepressant drug is a vector that overexpresses the LncRNA in living cells.
5. The use according to claim 4, characterized in that: The vector comprises at least one of a plasmid, a virus, and a liposome.
6. The use according to claim 5, characterized in that: The virus includes at least one of a recombinant adeno-associated virus, a recombinant lentivirus, and a recombinant adenovirus.
7. The use according to claim 4, characterized in that: The living cells are nerve cells in the hippocampus tissue of the brain.
8. An antidepressant pharmaceutical composition, characterized in that: Comprising the LncRNA according to claim 1 or 2 and pharmaceutically acceptable excipients.