Jasmine VIGS silencing system as well as construction method and application thereof

By designing specific nucleotide fragments and constructing VIGS silencing vectors, and infecting jasmine flowers with vacuum permeation, the problem of immature jasmine VIGS silencing system in the existing technology was solved, and efficient silencing and gene function research of JsPDS genes was achieved.

CN120060291APending Publication Date: 2025-05-30JIANGSU ACAD OF AGRI SCI
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510298888.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The mature jasmine VIGS silencing system has not yet been formed in the prior art, and it is difficult to efficiently study jasmine gene function.

Method used

A specific nucleotide fragment based on the JsPDS gene was designed, and a VIGS silencing vector pTRV2-JsPDS for jasmine was constructed. The jasmine plants were invaded by vacuum permeation to achieve efficient silencing of the JsPDS gene.

Benefits of technology

The simple, fast and low-cost identification of the jasmine JsPDS gene was achieved, which significantly reduced the expression level and chlorophyll synthesis of the JsPDS gene, and provided an efficient gene function research tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060291A_ABST
    Figure CN120060291A_ABST
Patent Text Reader

Abstract

The invention provides a jasmine VIGS silencing system as well as a construction method and application thereof, and belongs to the technical field of plant genetic engineering. The method comprises the following steps: firstly, providing a specific nucleotide fragment for silencing the arabian jasmine flower PDS gene, and inserting the specific nucleotide fragment into a pTRV2 vector through homologous recombination by taking a tobacco embrittlement virus (TRV) as the vector, so as to construct a silencing vector pTRV2-JsPDS; a vector pTRV1, a vector pTRV2 and a silence vector pTRV2-JsPDS are respectively transferred into agrobacterium to obtain a VIGS silence system of the jasmine flower PDS gene, the silence system is adopted to infect a jasmine flower plant, experiments prove that the silence system can induce silence of the jasmine flower JsPDS gene, the total chlorophyll content in jasmine flower leaves after gene silence is reduced by 34.98-63.79%, and the total chlorophyll content in the jasmine flower leaves after gene silence is reduced by 34.98-63.79%. And the relative expression quantity of the endogenous JsPDS gene is reduced by 56.38%-85.79%. The method has the advantages of being easy and convenient to operate, short in period, high in silencing efficiency, free of complete gene sequence information and genetic transformation systems and the like, and an efficient and reliable technical means is provided for arabian jasmine flower gene function research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a jasmine VIGS silencing system and a construction method and application thereof. Background Art

[0002] Jasmine (Jasminum sambac (L.) Aiton), also known as jasmine and tea flower, is an evergreen shrub of the genus Jasminum in the family Oleaceae. It is native to India, Pakistan, and other regions and was introduced to my country during the Han Dynasty over 1,700 years ago. Known as the "world's most fragrant flower," jasmine has important ornamental, tea-making, medicinal, and economic value. my country's jasmine cultivation area accounts for approximately two-thirds of the world's total, with an annual output exceeding 60% of the world's total, making it a key player in the global jasmine industry. However, the genetic transformation system for jasmine is immature, and callus differentiation is difficult, severely hindering research on its gene function and related mechanisms. Therefore, there is an urgent need to develop an efficient and reliable technology system for studying jasmine gene function.

[0003] Virus-induced gene silencing (VIGS) is a post-transcriptional gene silencing mechanism that belongs to the RNA-mediated defense mechanism. This technology uses a viral vector carrying a target gene fragment to infect plants, inducing the RNA-specific degradation of the plant's endogenous gene, thereby achieving gene silencing and causing phenotypic changes, providing an effective tool for gene function research. VIGS technology does not require a genetic transformation system and has the advantages of simple operation, short cycle time, high efficiency, and strong specificity. It has been widely used in plants such as Arabidopsis, petunia, tobacco, and tomato, mainly for research in the fields of metabolic regulation and growth and development. Tobacco Rattle Virus (TRV) is currently the most widely used VIGS vector. Its advantages include the ability to infect plant meristems, high silencing efficiency, long duration, and mild host plant virus symptoms.

[0004] The phytoene desaturase (PDS) gene is the rate-limiting enzyme in the carotenoid biosynthesis pathway. Silencing the PDS gene blocks carotenoid biosynthesis and causes photobleaching in plants. Therefore, it is widely used in VIGS systems. Existing techniques primarily construct VIGS silencing systems by injecting jasmine buds or seedling petioles, but a mature technical solution has yet to be established (Wang Yuting. Gene Expression Analysis of Key Jasmine Fragrance Enzymes and Application of VIGS Technology [D]. Fujian Agriculture and Forestry University, 2017; Long Siyu. Survey of the Fujian Jasmine Industry and Preliminary Exploration of the Establishment of a VIGS Technology System [D]. Fujian Agriculture and Forestry University, 2017). Currently, there is an urgent need to establish an efficient VIGS silencing system for jasmine to provide new technical means for studying gene function in jasmine. Summary of the Invention

[0005] In view of some problems existing in the prior art, the object of the present invention is to provide a jasmine VIGS silencing system and its construction method and application, thereby realizing the simple, rapid and low-cost identification of the jasmine JsPDS gene.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention first provides a specific nucleotide fragment for silencing the PDS gene of jasmine. The sequence of the specific nucleotide fragment is shown in SEQ ID No: 2.

[0008] SEQ ID No: 2:

[0009] GCCGGAGAAAGTCAAGTTTGCTATTGGACTCTTGCCTGCAATAGTTGGTGGACAGGCTTATGTTGAGGCTCAAGATGGTATAACTGTTAAAGATTGGATGAGGAAACAAGGTATACCAGATCGAGTAACTGATGAGGTGTTTATAGCCAT GTCTAAGGCACTGAACTTCATCAACCCCGATGAACTTTCAATGCAGTGCATTTTAATTGCTTTGAATCGATTTCTCAGGAGAAGCATGGTTCAAAGATGGCATTTTTAGATGGCAACCCACCAGAAAGACTTTGCATGCCAATTGTTGA

[0010] The present invention also provides a VIGS silencing vector of the jasmine PDS gene, wherein the VIGS silencing vector comprises the specific nucleotide fragment.

[0011] The present invention also provides a method for constructing a VIGS silencing vector for the jasmine PDS gene, the construction method comprising:

[0012] The specific nucleotide fragment was connected to the pTRV2 vector to construct the silencing vector pTRV2-JsPDS.

[0013] The specific nucleotide fragment is obtained by PCR amplification; the amplification primers of the specific nucleotide fragment are shown in SEQ ID No: 3-4.

[0014] pTRV2-JsPDS-F (SEQ ID No: 3): tgagtaaggttaccgaattcGCCGGAGAAAGTCAAGTTT

[0015] pTRV2-JsPDS-R (SEQ ID No: 4): ggacatgcccgggcctcgagTCAACAATTGGCATGCAAA

[0016] The present invention also provides a VIGS silencing system for the PDS gene of jasmine. The VIGS silencing system comprises: Agrobacterium containing a pTRV1 vector, Agrobacterium containing a pTRV2 vector, and Agrobacterium containing the VIGS silencing vector according to claim 2.

[0017] The present invention also provides application of the specific nucleotide fragment, the VIGS silencing vector, or the VIGS silencing system in silencing the jasmine PDS gene or identifying the function of the jasmine PDS gene.

[0018] The application includes: using the VIGS silencing system to infect jasmine plants, washing the infected plants and transferring them to a substrate for further cultivation, observing leaf phenotypic changes, and detecting PDS gene expression.

[0019] Furthermore, in the VIGS silencing system, Agrobacterium containing the pTRV1 vector, Agrobacterium containing the pTRV2 vector, and Agrobacterium containing the VIGS silencing vector according to claim 2 were cultured in LB liquid medium containing kanamycin and rifampicin, and the cells were collected and resuspended in the infection solution to an OD of 0. 600 ≈1.2, obtaining an Agrobacterium infection solution containing the pTRV1 vector, an Agrobacterium infection solution containing the pTRV2 vector, and an Agrobacterium infection solution containing the VIGS silencing vector, and mixing the Agrobacterium infection solution containing the pTRV1 vector with the Agrobacterium infection solution containing the pTRV2 vector and the Agrobacterium infection solution containing the VIGS silencing vector, respectively, and then infecting;

[0020] The infection solution used for resuspending the bacteria includes 10 mM MES, 200 μM AS and 10 mM MgCl 2 , and the pH value is 5.6.

[0021] Furthermore, the cleaning includes washing with distilled water, and the continued cultivation includes: dark cultivation at 20°C for 2 days, weak light cultivation for 3 days, and then normal cultivation; the weak light cultivation includes: daytime temperature of 25°C, nighttime temperature of 20°C, light intensity of 2000Lux, light duration of 16h / d, and relative air humidity of 60%; the normal cultivation includes: daytime temperature of 30°C, nighttime temperature of 25°C, light intensity of 4000Lux, light duration of 16h / d, and relative air humidity of 60%; the substrate is preferably a mixed substrate with a volume ratio of 80% peat soil: 20% perlite.

[0022] Furthermore, the Agrobacterium infection solution containing the pTRV1 vector is mixed with the Agrobacterium infection solution containing the pTRV2 vector and the Agrobacterium infection solution containing the VIGS silencing vector in equal volume ratios and then allowed to stand at room temperature in the dark; the mixed infection solution is allowed to stand at room temperature in the dark for 4-6 hours.

[0023] Furthermore, the jasmine plant is a double-petal jasmine plant that has been rooted by cuttings and has no axillary buds. Before infection, the rooted jasmine plant is washed, the surface moisture is sucked dry, some leaves and roots are cut off, and a hole is pierced near the axillary bud with a sterile syringe needle;

[0024] The infection is performed under vacuum conditions: vacuum degree 0.095 MPa, infection time 10-20 min, followed by slow deflation to restore normal pressure, repeated twice. Preferably, the infection time is 15 min.

[0025] Preferably, the Agrobacterium is strain GV3101.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] (1) The present invention designs a specific nucleotide fragment based on the JsPDS gene, and designs primers for amplifying the specific nucleotide fragment based on the specific nucleotide fragment. Furthermore, a silencing vector is constructed using the amplified product, and the VIGS silencing system based on the JsPDS gene is constructed for the first time using the silencing vector. The VIGS silencing system constructed by the present invention has a simpler and shorter plant infection process than traditional genetic transformation methods, which makes up for the shortcomings of the immature genetic transformation system of jasmine and the lagging research on gene function.

[0028] (2) The present invention provides a specific nucleotide fragment for silencing the JsPDS gene of jasmine. The nucleotide sequence of the specific nucleotide fragment is shown in SEQ ID No: 2. The fragment can effectively interfere with the expression of the endogenous JsPDS gene of jasmine, thereby silencing the endogenous JsPDS gene of the plant. Experimental results show that compared with the control group, the relative expression of the endogenous JsPDS gene in the silenced plants decreased by 56.38%-85.79%, the chlorophyll a content in the leaves decreased by 28.06%-59.55%, the chlorophyll b content decreased by 46.91%-71.09%, and the total chlorophyll content decreased by 34.98%-63.79%, providing a reliable technical means for the study of gene function in jasmine.

[0029] (3) This study utilizes VIGS technology to overcome the challenges of immature genetic transformation systems in jasmine. By using vacuum infiltration to transiently transform jasmine cuttings and combining it with a TRV vector, the study achieves efficient silencing of endogenous genes. This method is simple to operate, has a short cycle, and is highly efficient, providing new insights and approaches for studying gene function in jasmine. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the PCR amplification result of the specific nucleotide fragment of the JsPDS gene in Example 1; wherein Marker represents DNA ladder DL2000, and 1 and 2 represent the specific nucleotide fragments of the JsPDS gene.

[0031] Figure 2 This is a schematic diagram of the pretreatment of jasmine cuttings before vacuum infection in Example 1, including cutting off old leaves (A), trimming the roots to 4-5 cm (B), and piercing the axillary buds with a sterile syringe needle (C).

[0032] Figure 3 The phenotypes of the axillary buds of jasmine cuttings after branching after infection in the control group and experimental group in Example 1; the control group was infected with an infection solution containing the pTRV1 vector and the pTRV2 vector, and the experimental group was infected with an infection solution containing the pTRV1 vector and the pTRV2-JsPDS vector.

[0033] Figure 4 The results are as follows: the chlorophyll content in the leaves of the axillary buds of the jasmine cuttings after branching after infection in the control group and the experimental group in Example 1, including chlorophyll a content (A), chlorophyll b content (B), and total chlorophyll content (C); the control group was infected with an infection solution containing the pTRV1 vector and the pTRV2 vector, and the experimental group was infected with an infection solution containing the pTRV1 vector and the pTRV2-JsPDS vector.

[0034] Figure 5The results of qRT-PCR detection of the relative expression level of the JsPDS gene in the leaves of the jasmine cuttings after branching after the axillary buds of the control group and the experimental group were infected in Example 1; the control group was infected with an infection solution containing the pTRV1 vector and the pTRV2 vector, and the experimental group was infected with an infection solution containing the pTRV1 vector and the pTRV2-JsPDS vector.

[0035] Figure 6 The phenotypes of the axillary buds of jasmine cuttings after branching after the control group and experimental group were infected in Comparative Example 1; the control group was infected with an infection solution containing pTRV1 vector and pTRV2 vector, and the experimental group was infected with an infection solution containing pTRV1 vector and pTRV2-JsPDS2 vector.

[0036] Figure 7 The results of qRT-PCR detection of the relative expression level of JsPDS gene in the leaves of jasmine cuttings after branching after the axillary buds of the control group and the experimental group were infected in comparative example 1; the control group was infected with an infection solution containing the pTRV1 vector and the pTRV2 vector, and the experimental group was infected with an infection solution containing the pTRV1 vector and the pTRV2-JsPDS2 vector. DETAILED DESCRIPTION

[0037] In order to enable those skilled in the art to better understand the technical solutions of the present invention, preferred embodiments of the present invention are described in detail below. However, the following embodiments do not limit the scope of protection of the present invention.

[0038] In the embodiments of the present invention, all procedures not described in detail are performed using conventional experimental methods. All processes involved in the embodiments that are not described in detail are understandable and easily implemented by those skilled in the art based on the product instructions or basic knowledge in the field. Unless otherwise specified, the experimental materials, carriers, and reagents involved in the following embodiments are all commercially available and therefore will not be described in detail.

[0039] The double-petal jasmine plant described in Example 1 is a 5-year-old jasmine plant from the jasmine germplasm resource garden of Jiangsu Academy of Agricultural Sciences, which is a publicly known and used material.

[0040] The primer sequences involved in Example 1 are shown in Table 1.

[0041] Table 1. Primer sequences

[0042]

[0043] Note: Lowercase letters represent adapter primers.

[0044] Example 1: A Jasmine VIGS Silencing System and Its Construction Method and Application

[0045] S1. Construction of VIGS silencing expression vector pTRV2-JsPDS:

[0046] (1) Cloning of JsPDS gene-specific fragments:

[0047] The CDS sequence of the JsPDS gene was searched in the jasmine genome (NCBI database, accession number PRJNA690159) (see SEQ ID No: 1 in the sequence listing for the JsPDS gene sequence). The JsPDS gene-specific nucleotide fragment was selected using SGN VIGS Tool online software analysis (see SEQ ID No: 2 in the sequence listing for the JsPDS gene-specific fragment sequence). Primers for amplification of the JsPDS gene-specific nucleotide fragment were designed using PrimerPremier 5.0. EcoR I and Xba I restriction sites were introduced upstream and downstream of the amplification primers, respectively. Sequences flanking the restriction site of the viral vector pTRV2 (5'-tgagtaaggttaccgaattc-3' and 5'-ggacatgcccgggcctcgag-3') were also added to the primers to obtain the final primer sequence, designated pTRV2-JsPDS-F / R (see SEQ ID Nos: 3-4 in Table 1 for the sequence).

[0048] Plant RNA extraction kit ( Plant RNA Kit, YEASEN) to extract total RNA from jasmine leaves and reverse transcription kit ( Ⅲ1 st The cDNA was reverse transcribed into cDNA using the Strand cDNA Synthesis Kit (YEASEN). PCR amplification was performed using the cDNA as a template using primers pTRV2-JsPDS-F / R. The reaction system is shown in Table 2.

[0049] Table 2. PCR amplification reaction system

[0050]

[0051] The PCR amplification program was as follows: pre-denaturation at 98°C for 3 min; 35 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 20 s, and extension at 72°C for 15 s; and final extension at 72°C for 5 min.

[0052] The PCR products were detected by agarose gel electrophoresis. Figure 1 As shown in the figure, the target bands obtained in lanes 1 and 2 are 300 bp in size. The target bands were recovered and sequenced to obtain a JsPDS gene-specific nucleotide fragment (see SEQ ID No: 2 in the sequence listing).

[0053] SEQ ID No: 1:

[0054]

[0055] SEQ ID No: 2:

[0056] GCCGGAGAAAGTCAAGTTTGCTATTGGACTCTTGCCTGCAATAGTTGGTGGACAGGCTTATGTTGAGGCTCAAGATGGTATAACTGTTAAAGATTGGATGAGGAAACAAGGTATACCAGATCGAGTAACTGATGAGGTGTTTATAGCCAT GTCTAAGGCACTGAACTTCATCAACCCCGATGAACTTTCAATGCAGTGCATTTTAATTGCTTTGAATCGATTTCTCAGGAGAAGCATGGTTCAAAGATGGCATTTTTAGATGGCAACCCACCAGAAAGACTTTGCATGCCAATTGTTGA

[0057] (2) Double enzyme digestion of pTRV2 vector:

[0058] The empty vector pTRV2 plasmid was double-digested with restriction endonucleases EcoR I and Xba I. The reaction system is shown in Table 3. The reaction system was digested at 37°C for 3 h. The digestion product was detected by agarose gel electrophoresis and the target band was recovered to obtain the linearized pTRV2 vector.

[0059] Table 3. Double enzyme digestion reaction system

[0060] Components Addition amount 10×M Buffer 5μL pTRV2 plasmid 2 μg EcoRI (15U / μL) 2.5 μL Xba I (15 U / μL) 2.5 μL <![CDATA[ddH2O]]> Fill to 50 μL total 50 μL

[0061] (3) Homologous recombination ligation:

[0062] The JsPDS gene-specific nucleotide fragment was ligated to the linearized pTRV2 vector using a homologous cloning kit (Seamless Cloning Master Mix, Shanghai Bioengineering). The reaction system is shown in Table 4. The reaction system was incubated at 50°C for 20 minutes and then cooled on ice for 2 minutes to obtain a ligation product.

[0063] Table 4. Homologous recombination reaction system

[0064] Components Addition amount 2×Seamless Cloning Master Mix 5μL Linearized vector 50ng Destination fragment 150ng <![CDATA[ddH2O]]> Fill to 10 μL total 10 μL

[0065] (4) Screening of recombinant plasmids:

[0066] The ligation product was transformed into Escherichia coli DH5α and shaken at 37°C for 50 minutes. Positive single colonies were screened by plating on LB solid medium containing 50 mg / L kanamycin. PCR was performed using the pTRV2 vector universal primers pTRV2-F / R (sequence shown in SEQ ID Nos. 5-6 in Table 1). Positive clones were selected and sequenced. The cultures containing the correct sequences were shaken and the recombinant plasmid pTRV2-JsPDS was extracted for future use.

[0067] S2. Preparation of Agrobacterium infection solution:

[0068] (1) Plasmid transformation into Agrobacterium:

[0069] Take 500 ng of recombinant plasmids pTRV2-JsPDS, pTRV2 and pTRV1 and add them into 50 μL of Agrobacterium GV3101 competent cells pre-thawed on ice, ice bath for 20 minutes, quick-freeze in liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, ice bath for 3 minutes, add 700 μL of LB liquid culture medium, and shake the culture at 200 rpm in a 28°C shaking incubator for 4 hours to obtain a bacterial solution.

[0070] The resulting bacterial suspension was plated onto LB solid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin to screen for positive single colonies. PCR was performed using pTRV2 vector primers pTRV2-F / R (sequence shown in SEQ ID Nos: 5-6 in Table 1) to obtain Agrobacterium GV3101 containing the pTRV2-JsPDS vector and Agrobacterium GV3101 containing the pTRV2 vector. PCR was performed using pTRV1 vector primers pTRV1-F / R (sequence shown in SEQ ID Nos: 7-8 in Table 1) to obtain Agrobacterium GV3101 containing the pTRV1 vector.

[0071] (2) Preparation of Agrobacterium tumefaciens liquid:

[0072] Agrobacterium GV3101 containing pTRV2-JsPDS vector, pTRV2 vector and pTRV1 vector were transferred into LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at a volume ratio of 1:50, and the culture was shaken at 28°C overnight until the OD 600 The bacterial suspension was transferred to a 50 mL centrifuge tube and centrifuged at 6000 rpm for 10 min. The supernatant was discarded and the cells were collected. The cells were resuspended in infection solution (containing 10 mM MES, 200 μM AS and 10 mM MgCl2, with sterile water as solvent, freshly prepared and used, pH 5.6) and the OD was adjusted. 600 is 1.2, and an infection solution containing pTRV1, pTRV2 vector or pTRV2-JsPDS vector is obtained.

[0073] (3) Infection solution mixing:

[0074] The infection solution containing the pTRV1 vector was mixed with the infection solution containing the pTRV2 vector and the infection solution containing the pTRV2-JsPDS vector in a volume ratio of 1:1 to obtain the infection solution containing the pTRV1 vector and the pTRV2 vector, and the infection solution containing the pTRV1 vector and the pTRV2-JsPDS vector. The mixture was allowed to stand in the dark for 4-6 hours for later use.

[0075] S3. Agrobacterium infection of jasmine:

[0076] (1) Preparation of plant materials:

[0077] Select healthy, pest-free, double-petal jasmine plants and cut semi-lignified to lignified branches with full axillary buds as cuttings. The volume ratio of the cutting medium is 40% peat soil: 30% perlite: 30% vermiculite. The culture conditions are 70% relative humidity, 25℃ / 20℃ day / night temperature, and 8h / 16h light / dark cycle. After six weeks, the cuttings were used for infection experiments. Before infection, wash the jasmine plants, dry the surface moisture, and cut off the old leaves ( Figure 2 A), trim the roots to 4-5cm ( Figure 2 B), use a sterile syringe needle to puncture the axillary bud ( Figure 2 C).

[0078] (2) Vacuum penetration infection of jasmine:

[0079] Jasmine cuttings were randomly divided into two groups (control and experimental), with 30 plants in each group. The experimental group was immersed in an infection solution containing the pTRV1 and pTRV2-JsPDS vectors; the control group was immersed in an infection solution containing both the pTRV1 and pTRV2 vectors. The jasmine plants were then inoculated using a vacuum infiltration device (SHZ-III, Shanghai Yarong) using a vacuum suction method. The method involved maintaining a vacuum of 0.095 MPa for 15 minutes, then slowly releasing the air to restore normal pressure. This step was repeated twice to achieve successful inoculation. After infection, the excess infection liquid on the surface of the plant was washed with distilled water, and then transferred to the substrate (volume ratio of 80% peat soil: 20% perlite), placed in a light incubator for culture, cultured in the dark at 20℃ for 2 days, then cultured in weak light for 3 days (daytime temperature 25℃, nighttime temperature 20℃, light intensity of 2000Lux, light time 16h / d, relative air humidity of 60%), and finally cultured normally (daytime temperature 30℃, nighttime temperature 25℃, light intensity of 4000Lux, light time 16h / d, relative air humidity of 60%).

[0080] S4. Phenotypic observation and effect statistics of silenced plants:

[0081] (1) Phenotypic observation after silencing:

[0082] After 3-4 weeks of normal cultivation, the color of the new leaves of the experimental group and the control group was observed. Figure 3 As shown in the figure, the leaves of the jasmine plants in the control group did not show the yellowing phenotype, while the leaves of some plants in the experimental group showed varying degrees of chlorosis, indicating that the TRV virus-mediated VIGS system can successfully silence the jasmine JsPDS gene.

[0083] (2) Chlorophyll content determination:

[0084] The chlorophyll content was determined by referring to the method in Li Hesheng (2000) on the principles and techniques of plant physiology and biochemistry experiments and improving it. The specific method is as follows:

[0085] Leaves from plants with a silent phenotype in the control group and the experimental group were taken respectively, rinsed with deionized water, and excess water was absorbed with filter paper. About 0.05 g of fresh leaves were chopped and placed in 5 ml of 95% ethanol solution at room temperature in the dark for more than 48 h. When the leaves turned white, the absorbance values ​​at wavelengths of 665 nm and 649 nm were measured. The concentration of each pigment in the extract (mg / L) was calculated using the following formula, and then converted into the content of each pigment in the unit fresh sample (mg / g FW).

[0086] Chlorophyll a concentration = 13.95 × A 665 –6.88×A 649

[0087] Chlorophyll b concentration = 24.96 × A 649 –7.32×A 665

[0088] Chloroplast pigment content = (pigment concentration × extract volume) / sample fresh weight

[0089] The results showed that the chlorophyll a, chlorophyll b and total chlorophyll contents in the leaves of the silenced plants in the experimental group were significantly reduced compared with those in the control group (Table 5 and Figure 4 The chlorophyll a content in the leaves of the experimental group plants decreased by 28.06%-59.55%, the chlorophyll b content decreased by 46.91%-71.09%, and the total chlorophyll content decreased by 34.98%-63.79%.

[0090] Table 5. Chlorophyll content determination results in leaves of silenced plants constructed with the pTRV2-JsPDS vector

[0091]

[0092] Note: Different letters indicate extremely significant differences, p < 0.01; silenced plants 1-3 in the table are three typical phenotypes of the experimental group.

[0093] (3) qRT-PCR detection of silencing effect:

[0094] PrimerPremier 5.0 software was used to design quantitative primers JsPDS-qF / qR (sequences are shown in SEQ ID No: 9-10 in Sequence Table 1) outside the JsPDS gene silencing nucleotide fragment, and the jasmine JsEF1α gene was used as an internal reference gene (the sequence of JsEF1α used for quantification is shown in SEQ ID No: 13 in the sequence table; the internal reference gene primer is JsEF1α-qF / qR, the sequence is shown in SEQ ID No: 11-12 in Sequence Table 1). Leaves of plants in the control group and leaves of plants with silencing phenotype in the experimental group were taken, and total RNA from the leaves was extracted using a plant RNA extraction kit and reverse transcribed into cDNA using a reverse transcription kit. The cDNA was diluted 10 times for qRT-PCR detection. The reaction system is shown in Table 6 and the reaction procedure is shown in Table 7. The qRT-PCR experiment was performed on ROCHE ( The operation was performed on a 480II) real-time quantitative PCR instrument.

[0095] Table 6. qRT-PCR reaction system

[0096] Components Addition volume (μL) TB Green Premix Ex Taq(Tli RNaseH Plus)(2×) 10 Primer-F (10 μM) 0.4 Primer-R (10 μM) 0.4 cDNA 2 <![CDATA[ddH2O]]> 7.2 total 20

[0097] Table 7. qRT-PCR reaction procedure

[0098]

[0099] Data processing uses 2 -ΔΔCt The relative expression of JsPDS gene was calculated by the method. Compared with the control group, the relative expression of JsPDS gene in jasmine was reduced by 56.38%-85.79% (Table 8 and Figure 5 The results showed that VIGS technology in jasmine could effectively silence the JsPDS gene, and this method can be used to study the gene function in jasmine.

[0100] Table 8. Relative expression levels of JsPDS genes in silenced plants constructed using the pTRV2-JsPDS vector

[0101] sample Relative expression of JsPDS gene Decrease ratio (%) Control group (TRV2) 1.000±0.026A / Silenced plant 1 (TRV2-JsPDS-1) 0.436±0.009B 56.38 Silenced plant 2 (TRV2-JsPDS-2) 0.142±0.011C 85.79 Silenced plant 3 (TRV2-JsPDS-3) 0.154±0.002C 84.51

[0102] Note: Different letters indicate extremely significant differences, p < 0.01.

[0103] SEQ ID No: 13:

[0104] TGGTCGTTTTGCTGTGAGGGATATGCGACAGACTGTTGCTGTTGGAGTCATCAAGA ATGTGGACAAGAAGGACCCATCTGGTGCAAAGGTGACCAAGGCTGC

[0105] Comparative Example 1:

[0106] This comparative example conducted a comparative experiment by designing different specific nucleotide fragments. The specific process of this comparative example is as follows:

[0107] S1. Construction of VIGS silencing expression vector pTRV2-JsPDS2;

[0108] S2. Preparation of Agrobacterium infection solution;

[0109] S3. Agrobacterium infection of jasmine flowers;

[0110] S4. Phenotypic observation and effect statistics of silenced plants

[0111] Wherein step S1, step S2 and step S3 are the same as the operating steps of the corresponding parts in Example 1; the sequence of the specific nucleotide fragment used in the comparative example is shown in SEQ ID No: 14, and the nucleotide sequences of the primers for constructing the pTRV2-JsPDS2 vector are shown in SEQ ID Nos: 15-16 in Table 9.

[0112] Table 9. Primers for cloning specific silent fragment JsPDS2

[0113]

[0114] SEQ ID No: 14:

[0115] ATCAAGAAAAGGCGCGTCTTCTTTAAAGGTTGTTTGCATTGACTATCCAAGACCCGAGATTGATAATACAGTCAATTATTTGGAAGCCGCTTATTTATCGTCATCCTTTCTAGTGCTCCACGTCCAAACAAGCAATTAAAGATAGTCAT TGCGGGCGCAGGTTTGGCTGGTTTGTCTACGGCAAAATATTTGGCAGATGCAGGTCATAAACCAATATTGTTGGAAGGAAGGGATGTGCTAGGTGGAAAGGTGGCTGCTTGGAAAGATGATGATGGAGACTGGTATGAGACTGGTTTACA

[0116] In this comparative example, the plants in the control group were infected with an infection solution containing the pTRV1 vector and the pTRV2 vector, and the plants in the experimental group were infected with an infection solution containing the pTRV1 vector and the pTRV2-JsPDS2 vector.

[0117] Step S4. Observation of silenced plant phenotypes and statistical analysis of effects:

[0118] (1) Phenotypic observation after silencing:

[0119] After 3-4 weeks of normal cultivation, the color of the new leaves of the experimental group and the control group was observed. Figure 6 As shown in the figure, there was no obvious yellowing phenotype in the leaves of the jasmine plants in the control group and the experimental group.

[0120] (2) qRT-PCR detection of silencing effect:

[0121] The leaves of the control group and the experimental group were taken respectively, and the total RNA of the leaves was extracted using a plant RNA extraction kit, and reverse transcribed into cDNA using a reverse transcription kit. The cDNA was diluted 10 times for qRT-PCR detection. The specific steps were the same as in Example 1. Compared with the control group, the relative expression of the endogenous JsPDS gene in jasmine was reduced by 12.41%-16.84% (Table 10 and Figure 7 The results showed that pTRV2-JsPDS2 could silence the JsPDS gene, but the silencing efficiency was low and did not cause the chlorotic phenotype of the leaves in the plants.

[0122] Table 10. Relative expression levels of JsPDS genes in silenced plants constructed using the pTRV2-JsPDS2 vector

[0123] sample Relative expression of JsPDS gene Decrease ratio (%) Control group (TRV2) 1.000±0.036A / Silenced plant 1 (TRV2-JsPDS2-1) 0.876±0.015B 12.41 Silenced plant 3 (TRV2-JsPDS2-2) 0.832±0.029B 16.84

[0124] Note: Different letters indicate extremely significant differences, p < 0.01.

[0125] Implementation effect analysis:

[0126] The present invention constructs a jasmine JsPDS gene silencing system. The silencing effect of the silencing system constructed using the pTRV2-JsPDS vector in Example 1 is significantly better than the silencing effect of the silencing system constructed using the pTRV2-JsPDS2 vector in Comparative Example 1. The silencing system constructed in Example 1 has the advantages of simple operation, short cycle, high silencing efficiency, and no need for complete gene sequence information and genetic transformation system. The pTRV2-JsPDS silencing system of the present invention can effectively reduce the expression level of the jasmine JsPDS gene, hinder chlorophyll synthesis, and cause a leaf chlorosis phenotype. The system can be used as a reporter gene for the VIGS silencing system in jasmine applications.

[0127] The embodiments described are preferred implementations of the present invention, but the present invention is not limited to the above implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention are within the scope of protection of the present invention.

Claims

1. A specific nucleotide fragment for silencing the PDS gene of Jasmine, characterized in that: The sequence of the specific nucleotide fragment is shown in SEQ ID No:

2.

2. VIGS silencing vector of jasmine PDS gene, characterized in that: The VIGS silencing vector comprises the specific nucleotide fragment according to claim 1.

3. The method for constructing the VIGS silencing vector of the jasmine PDS gene according to claim 2, characterized in that: The construction method comprises: The specific nucleotide fragment according to claim 1 is connected to the pTRV2 vector to construct the silencing vector pTRV2-JsPDS.

4. The method for constructing the VIGS silencing vector of the jasmine PDS gene according to claim 3, characterized in that: The specific nucleotide fragment is obtained by PCR amplification; the amplification primers of the specific nucleotide fragment are shown in SEQ ID No: 3-4.

5. The VIGS silencing system of the Jasmine PDS gene is characterized by: The VIGS silencing system comprises: Agrobacterium containing a pTRV1 vector, Agrobacterium containing a pTRV2 vector, and Agrobacterium containing the VIGS silencing vector of claim 2.

6. Use of the specific nucleotide fragment according to claim 1, or the VIGS silencing vector according to claim 2, or the VIGS silencing vector constructed by the method according to claim 3 or 4, or the VIGS silencing system according to claim 5 in silencing the jasmine PDS gene or identifying the function of the jasmine PDS gene.

7. The use according to claim 6, characterized in that: include: The VIGS silencing system of claim 5 is used to infect jasmine plants, and the infected plants are washed and transferred to a matrix for further cultivation, and the phenotypic changes of leaves are observed and the expression of the PDS gene is detected.

8. The use according to claim 7, characterized in that: In the VIGS silencing system, Agrobacterium containing the pTRV1 vector, Agrobacterium containing the pTRV2 vector, and Agrobacterium containing the VIGS silencing vector according to claim 2 are cultured in LB liquid medium containing kanamycin and rifampicin, and the cells are collected and resuspended to OD 600 ≈1.2, obtaining an Agrobacterium infection solution containing a pTRV1 vector, an Agrobacterium infection solution containing a pTRV2 vector, and an Agrobacterium infection solution containing a VIGS silencing vector, and mixing the Agrobacterium infection solution containing a pTRV1 vector with the Agrobacterium infection solution containing a pTRV2 vector and the Agrobacterium infection solution containing a VIGS silencing vector, respectively, and then infecting; The infection solution used for resuspending the bacteria includes 10 mM MES, 200 μM AS and 10 mM MgCl2, and the pH value is 5.

6.

9. The use according to claim 7, characterized in that: The cleaning includes cleaning with distilled water, and the continued cultivation includes: 20°C dark cultivation for 2 days, weak light cultivation for 3 days, and then normal cultivation; the weak light cultivation includes: daytime temperature of 25°C, nighttime temperature of 20°C, light intensity of 2000Lux, light duration of 16h / d, and relative air humidity of 60%; the normal cultivation includes: daytime temperature of 30°C, nighttime temperature of 25°C, light intensity of 4000Lux, light duration of 16h / d, and relative air humidity of 60%; the matrix is ​​preferably a mixed matrix, with a volume ratio of 80% peat soil: 20% perlite.

10. The use according to claim 8, characterized in that: The Agrobacterium infection solution containing the pTRV1 vector is mixed with the Agrobacterium infection solution containing the pTRV2 vector and the Agrobacterium infection solution containing the VIGS silencing vector in equal volume ratios and then left to stand in the dark at room temperature; the mixed infection solution is left to stand in the dark at room temperature for 4-6 hours; the jasmine plants are double-petal jasmine plants with rooting from cuttings and ungerminated axillary buds; the infection is vacuum infection, and the conditions for the vacuum infection are: a vacuum degree of 0.095 MPa, an infection time of 10-20 minutes, followed by slow deflation to restore normal air pressure, and repeated twice; preferably, the infection time is 15 minutes.

Citation Information

Cited By

  • VIGS (Vinyl Insulin Growth Sulfate) silencing vector and silencing system of aquilegia serotina and application of VIGS silencing system

    CN120866409A