Application of vitamin K in transformation of synechococcus culture

Abstract

The invention discloses application of vitamin K in transformation of synechococcus culture, and belongs to the technical field of synechococcus cell culture. The vitamin K is used for culturing the modified synechococcus cells, so that the growth of the modified synechococcus cells can be remarkably promoted, and the content of synthetic lactic acid is increased; wherein the modified synechococcus is formed by introducing a lactic dehydrogenase gene into synechococcus for gene modification.

Description

Technical Field

[0001] The present invention belongs to the technical field of Synechococcus cultivation, and particularly relates to the application of vitamin K in the cultivation of genetically modified Synechococcus. Background Art

[0002] Synechococcus elongatus PCC 7942 is a commonly used cyanobacterial chassis bacterium, which is widely used due to its good adaptability, rapid growth and easy cultivation; Synechococcus itself does not produce lactic acid. The genetically modified Synechococcus used in the present invention is a genetically engineered chassis bacterium into which the lactate dehydrogenase gene has been introduced and can be used for lactic acid production. The genetically modified Synechococcus mainly relies on CO 2 in the air as a raw material, and can synthesize products in some specific metabolic flux directions by using the principle of photosynthesis. At present, the main factor limiting the lactic acid production of genetically modified Synechococcus is the low photosynthesis efficiency. Improving the photosynthesis efficiency can effectively increase the lactic acid content. Summary of the Invention

[0003] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide the application of vitamin K in the cultivation of genetically modified Synechococcus, and solve the problems in the prior art.

[0004] The purpose of the present invention can be achieved by the following technical solutions:

[0005] The application of vitamin K in the cultivation of genetically modified Synechococcus, and the genetically modified Synechococcus is genetically modified by introducing the lactate dehydrogenase gene into Synechococcus.

[0006] Further, the preparation process of the genetically modified Synechococcus is as follows:

[0007] 1) Obtain lactate dehydrogenase from Weizmannia coagulans;

[0008] 2) Design upstream and downstream primers, obtain the lactate dehydrogenase DNA fragment by PCR amplification, and verify by sequencing;

[0009] 3) Select plasmid pSyn as the lactate dehydrogenase cloning vector, which contains a spectinomycin resistance gene and restriction enzyme sites;

[0010] 4) Design primer pairs containing homologous arms according to the insertion position of lactate dehydrogenase in Synechococcus for PCR amplification of lactate dehydrogenase;

[0011] 5) Transduce lactate dehydrogenase onto plasmid pSyn by the principle of homologous recombination, and amplify it through competent cell TOP10;

[0012] 6) Extract the amplified plasmid and perform an agarose gel electrophoresis verification experiment;

[0013] 7) Transform the plasmid containing the homologous arms with Synechococcus and select positive clones on the resistant plate;

[0014] 8) Perform PCR amplification and sequencing detection on the positive clone single colonies.

[0015] Furthermore, the culture process of the modified Synechococcus is as follows:

[0016] Step 1, dissolve vitamin K in absolute ethanol to prepare a vitamin K stock solution;

[0017] Step 2, prepare BG-11 medium using deionized ultrapure water, inoculate the modified Synechococcus into the BG-11 medium to form a modified Synechococcus seed solution;

[0018] Step 3, add the vitamin K stock solution to the BG-11 medium to obtain a medium containing vitamin K, and inoculate the modified Synechococcus seed solution into the medium containing vitamin K for light culture.

[0019] Furthermore, the concentration of the vitamin K stock solution is 1 g / L.

[0020] Furthermore, the BG-11 medium includes: 1.5 g / L of NaNO 3 , 40 mg / L of K 2 HPO 4 , 75 mg / L of MgSO 4 ·7H 2 O, 36 mg / L of CaCl 2 ·2H 2 O, 6 mg / L of citric acid, 6 mg / L of ammonium ferric citrate, 1 mg / L of disodium ethylenediaminetetraacetate, 20 mg / L of Na 2 CO 3 , 2.86 mg / L of H 3 BO 3 , 1.86 mg / L of MnCl 2 ·4H 2 O, 0.22 mg / L of ZnSO 4 ·7H 2 O, 0.39 mg / L of Na 2 MoO 4 ·2H 2 O, 0.08 mg / L of CuSO 4 ·5H 2 O and 0.05 mg / L of Co(NO 3 ) 2 ·6H 2 O.

[0021] Furthermore, the pH value of the BG-11 medium is 7.1.

[0022] Furthermore, in the medium containing vitamin K, the concentration of vitamin K is 1 - 10 μg / L.

[0023] Furthermore, in step 3, the inoculation amount of the genetically modified Synechococcus sp. seed liquid is 1%.

[0024] Furthermore, in step 3, the light intensity is 11000 lux and the culture temperature is 30°C.

[0025] The application of vitamin K in the preparation of lactic acid using genetically modified Synechococcus sp., wherein the genetically modified Synechococcus sp. is obtained by genetically modifying Synechococcus sp. by introducing the lactate dehydrogenase gene.

[0026] Advantages of the present invention:

[0027] The present invention uses vitamin K for the culture of genetically modified Synechococcus sp. cells, which can significantly promote the growth of genetically modified Synechococcus sp. cells and increase the content of synthesized lactic acid; for example, in the culture solution containing 8 μg / L vitamin K, the growth amounts of Synechococcus sp. on the 2nd, 4th, 6th, 8th, 10th, 12th, and 15th days of culture are increased by 142%, 126%, 191.7%, 126.8%, 67%, 43.2%, and 43.5% respectively compared with the control example; in the culture solution containing 5 μg / L vitamin K, the lactic acid contents of the genetically modified Synechococcus sp. on the 2nd, 4th, 6th, 8th, 10th, 12th, and 15th days of culture are increased by 120%, 150%, 170%, 117.9%, 122.4%, 133.2%, and 145.5% respectively compared with the control example. Description of the drawings

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0029] Figure 1 It is a comparison chart of OD730 between Example 2 and Comparative Example 1 of the present invention;

[0030] Figure 2 It is a comparison chart of lactic acid production between Example 2 and Comparative Example 1 of the present invention. Detailed implementation manners

[0031] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.

[0032] Example 1

[0033] In this embodiment, the process of genetically modifying Synechococcus (introducing the lactate dehydrogenase gene to genetically modify Synechococcus) is introduced; it includes the following steps:

[0034] 1) Obtaining the lactate dehydrogenase (ldh) gene sequence: The lactate dehydrogenase gene is derived from Weizmannia coagulans;

[0035] 2) Designing upstream and downstream primers, obtaining the lactate dehydrogenase (ldh) DNA fragment by PCR amplification, and verifying it by sequencing;

[0036] 3) Selecting the appropriate plasmid pSyn as the lactate dehydrogenase cloning vector, which contains the spectinomycin resistance gene and restriction enzyme sites;

[0037] 4) Designing primers containing homologous arms according to the insertion position of lactate dehydrogenase in Synechococcus to perform PCR amplification on lactate dehydrogenase;

[0038] 5) Transducing lactate dehydrogenase onto the plasmid pSyn by the principle of homologous recombination, and amplifying it through competent cells TOP10;

[0039] 6) Extracting the amplified plasmid and performing double digestion to linearize the plasmid;

[0040] 7) Transforming the linearized plasmid containing homologous arms with Synechococcus, and selecting positive clones on the resistance plate;

[0041] 8) Performing PCR amplification and sequencing detection on the positive clone single colonies.

[0042] Among them, the lactate dehydrogenase DNA sequence (SEQ ID NO.1):

[0043] atgaaaaaggtcaatcgtattgcagtggttggaacgggtgcagttggtacaagttactgctacgccatgattaatcagggtgttgcagaagagcttgttttaatcgatattaacgaagcaaaagcagaaggggaagccatggacctgaaccacggcctgccatttgcgcctacgccgacccgcgtttggaaaggcgattattccgattgcggcactgccgatcttgttgtcattacggcaggttccccgcaaaaaccgggcgaaacaaggcttgatcttgttgccaaaaacgcaaaaatttttaaaggcatgattaagagcatcatggacagcggctttaacgggatttttcttgttgccagcaacccggttgacattttgacatatgtaacttggaaagagtccggcctgccgaaagaacatgttatcggttcgggcacagtgcttgactccgcgcgtctccgcaactctttaagcgcccacttcggaattgacccgcgcaatgtccatgccgcaattatcggcgaacacggcgacacggaacttccggtttggagccatacaacgatcggttatgacaccattgaaagctatctgcaaaagggaaccattgaccaaaaaacattagatgatatttttgtcaacacgagagatgcggcttaccatatcattgaacgaaaaggggccacattttacggcatcgggatgtctctgacccggatcacaagagcgatcctgaacaatgaaaacagtgttttgacagtctctgcctttttggaaggccagtacggaaacagcgatgtgtacattggtgttcctgccgttattaaccgccaaggcgtccgtgaagtggttgaaatcgagctgaacgacaaagaacaggaacaatttagccattctgttaaagtattaaaagaaacgatggcacctgtattgtaa

[0044] The DNA sequence of the upstream primer (SEQ ID NO.2) is: 5’-atgaaaaaggtcaatcgtattgcagtggt-3’;

[0045] The DNA sequence of the downstream primer (SEQ ID NO.3) is: 5’

[0046] -ttacaatacaggtgccatcgtttcttttaatactttaacag-3’;

[0047] The DNA sequence of the verification upstream primer (SEQ ID NO.4) is: 5’-ttgagcactgtagccttggg-3’;

[0048] The DNA sequence of the verification downstream primer (SEQ ID NO.5) is: 5’-acttctgagttcggcatggg-3’.

[0049] Example 2

[0050] In this example, the application of vitamin K in the cultivation of genetically modified Synechococcus and related experiments are introduced; the specific steps include:

[0051] Step 1, prepare the vitamin K stock solution

[0052] Dissolve vitamin K in absolute ethanol to prepare a vitamin K stock solution with a concentration of 1 g / L, and store it in the dark at 4 °C for subsequent use in the experiment. This vitamin K stock solution ensures the repeatability and accuracy of the experiment.

[0053] Step 2, prepare the seed solution of genetically modified Synechococcus

[0054] Use deionized ultrapure water to prepare BG-11 medium, which includes: 1.5 g / L of NaNO 3 , 40 mg / L of K 2 HPO 4 , 75 mg / L of MgSO 4 ·7H 2 O, 36 mg / L of CaCl 2 ·2H 2 O, 6 mg / L of citric acid, 6 mg / L of ammonium ferric citrate, 1 mg / L of disodium ethylenediaminetetraacetate, 20 mg / L of Na 2 CO 3 , 2.86 mg / L of H 3 BO 3 , 1.86 mg / L of MnCl 2 ·4H 2 O, 0.22 mg / L of ZnSO 4 ·7H2 O, Na at 0.39 mg / L 2 MoO 4 ·2H 2 O, CuSO at 0.08 mg / L 4 ·5H 2 O and Co(NO 3 ) 2 ·6H 2 O, the pH value of BG-11 medium is 7.1; inoculate the genetically modified Synechococcus elongatus strain into BG-11 medium and activate it until the logarithmic growth phase to form an active genetically modified Synechococcus elongatus seed solution.

[0055] Step 3, cultivate genetically modified Synechococcus elongatus with vitamin K

[0056] Add vitamin K stock solution to BG-11 medium, and the final concentrations are set to 1, 3, 5, 7, 9, 10 μg / L respectively, cultivate for 15 days, and detect every two days; inoculate the genetically modified Synechococcus elongatus seed solution into the medium containing vitamin K, the inoculation amount is 1%, the light intensity is 11000 lux, and the cultivation temperature is 30 °C.

[0057] Step 4, measure the cell density of genetically modified Synechococcus elongatus

[0058] After the start of cultivation, sample every two days to measure the cell density of genetically modified Synechococcus elongatus; use an ultraviolet spectrophotometer to measure the absorbance value of the algal solution at OD730nm.

[0059] Step 5, use the phenolphthalein indicator titration method (GB2023-80) to measure the lactic acid synthesis content of genetically modified Synechococcus elongatus.

[0060] Comparative Example 1

[0061] The difference between Comparative Example 1 and Example 2 is only that: in Step 3, vitamin K was not added to the BG-11 medium; the rest of the process is the same.

[0062] Figure 1 Shows the growth of genetically modified Synechococcus elongatus in BG-11 medium containing different concentrations of vitamin K. The results show that different concentrations of vitamin K have a significant promoting effect on the growth of Synechococcus elongatus, and the promoting effect is the best when the concentration is 8 μg / L. On the 2nd, 4th, 6th, 8th, 10th, 12th, and 15th days of cultivation, the growth of genetically modified Synechococcus elongatus increased by 142%, 126%, 191.7%, 126.8%, 67%, 43.2%, and 43.5% respectively compared with the comparative example, and the maximum increase occurred on the 6th day.

[0063] Figure 2The change in lactic acid production of the engineered Synechococcus in BG-11 medium containing different concentrations of vitamin K was shown. The results indicated that vitamin K could significantly enhance the ability of the engineered Synechococcus cells to produce lactic acid. The best effect occurred at a concentration of 5 μg / L, and the enhancing effects at other concentrations were also very significant. At 2, 4, 6, 8, 10, 12, and 15 days of cultivation, compared with the comparative example, the increases were 120%, 150%, 170%, 117.9%, 122.4%, 133.2%, and 145.5% respectively, and the maximum increase occurred on the 6th day.

[0064] In the description of this specification, the descriptions referring to the terms "one embodiment", "example", "specific example", etc. mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples.

[0065] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art of this industry should understand that the present invention is not limited by the above embodiments. The above embodiments and the descriptions in the specification only illustrate the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed.

Claims

1. The application of vitamin K in the transformation of Synechococcus culture, characterized in that: The modified Synechococcus is obtained by introducing lactate dehydrogenase gene into Synechococcus for genetic modification.

2. The use according to claim 1, characterized in that: The preparation process of the modified Synechococcus is as follows: 1) Obtaining lactate dehydrogenase from Weizmann's bacterium; 2) Design upstream and downstream primers, obtain lactate dehydrogenase DNA fragments by PCR amplification, and sequence verification; 3) Select plasmid pSyn as the lactate dehydrogenase cloning vector, which contains the spectinomycin resistance gene and restriction sites; 4) designing primers containing homology arms according to the designed insertion position of lactate dehydrogenase in Synechococcus to perform PCR amplification of lactate dehydrogenase; 5) Lactate dehydrogenase was transduced into the plasmid pSyn by homologous recombination and amplified by competent cell TOP10; 6) Extract the amplified plasmid and perform agarose gel electrophoresis verification experiment; 7) Transform the plasmid containing the homology arms into Synechococcus sp., and select positive clones on a resistance plate; 8) Perform PCR amplification and sequencing on positive clones.

3. The use according to claim 1, characterized in that: The culture process of the modified Synechococcus is as follows: Step 1, dissolving vitamin K in anhydrous ethanol to prepare a vitamin K stock solution; Step 2, using deionized ultrapure water to prepare BG-11 culture medium, inoculating the modified Synechococcus into the BG-11 culture medium to form a modified Synechococcus seed solution; Step 3, adding vitamin K stock solution to BG-11 medium to obtain a medium containing vitamin K, and inoculating the modified Synechococcus seed solution into the medium containing vitamin K for light culture.

4. The use according to claim 3, characterized in that: The concentration of the vitamin K stock solution is 1 g / L.

5. The use according to claim 3, characterized in that: The BG-11 culture medium includes: 1.5g / L NaNO3, 40mg / L K2HPO4, 75mg / L MgSO4·7H2O, 36mg / L CaCl2·2H2O, 6mg / L citric acid, 6mg / L ammonium ferric citrate, 1mg / L disodium ethylenediaminetetraacetate, 20mg / L Na2CO3, 2.86mg / L H3BO3, 1.86mg / L MnCl2·4H2O, 0.22mg / L ZnSO4·7H2O, 0.39mg / L Na2MoO4·2H2O, 0.08mg / L CuSO4·5H2O and 0.05mg / L Co(NO3)2·6H2O.

6. The use according to claim 3, characterized in that: The pH value of the BG-11 culture medium is 7.

1.

7. The use according to claim 3, characterized in that: In the vitamin K-containing culture medium, the concentration of vitamin K is 1-10 μg / L.

8. The use according to claim 3, characterized in that: In step 3, the inoculation amount of the modified Synechococcus algae seeds in liquid contact is 1%.

9. The use according to claim 3, characterized in that: In step 3, the light intensity is 11000 lux and the culture temperature is 30°C.

10. The use of vitamin K in preparing lactic acid by using modified Synechococcus, characterized in that: The modified Synechococcus is obtained by introducing lactate dehydrogenase gene into Synechococcus for genetic modification.

Images