An engineered strain expressing human Cu / Zn superoxide dismutase, its construction method and application

Abstract

The present invention discloses an engineered strain expressing human Cu / Zn superoxide dismutase, its construction method and application, which relate to the field of biotechnology. The construction method of the engineered strain comprises the following steps: cloning the optimized coding gene of the human Cu / Zn superoxide dismutase gene into an expression vector to construct a recombinant plasmid; transforming the recombinant plasmid into Pichia pastoris competent cells to construct the engineered strain; the nucleotide sequence of the optimized coding gene of the gene is shown as SEQ ID NO.2. The engineered strain can highly express human Cu / Zn superoxide dismutase, and its expression level at the shake flask level can reach more than 3 g / L. The present invention provides strong technical support for developing an economically feasible, environmentally friendly and high-quality human Cu / Zn superoxide dismutase production process, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to an engineered strain expressing human Cu / Zn superoxide dismutase, a construction method thereof, and an application thereof. Background Art

[0002] Superoxide Dismutase (SOD) is an important class of antioxidant enzymes that can catalyze the dismutation of superoxide anion radicals (O 2- ), into hydrogen peroxide (H2O2) and oxygen (O2), thereby protecting cells from damage by Reactive Oxygen Species (ROS). SOD is widely distributed in living organisms and is divided into Cu / Zn superoxide dismutase, manganese superoxide dismutase, and iron superoxide dismutase according to different metal cofactors. Among them, human Cu / Zn superoxide dismutase has broad application prospects in the fields of medicine, cosmetics, etc. due to its high efficiency, stability, and good compatibility with the human body.

[0003] Currently, the methods for industrial production of human Cu / Zn superoxide dismutase mainly include extraction from animal tissues, expression by genetically engineered bacteria, etc. However, these methods have the following problems:

[0004] Extraction method: Since human Cu / Zn superoxide dismutase mainly exists in red blood cells and has a very low content, the extraction cost is high, the yield is limited, and it is difficult to meet the market demand.

[0005] Escherichia coli expression system: Although high-level expression can be achieved, Escherichia coli lacks the post-translational modification mechanism unique to eukaryotes, which affects the spatial structure and biological function of proteins, making the quality and activity of the products unstable.

[0006] Mammalian cell expression system: Although it can perform correct post-translational modification, the culture conditions are harsh, the cycle is long, and the cost is high, which is not suitable for large-scale industrial production.

[0007] The present invention intends to develop a new method for highly expressing human Cu / Zn superoxide dismutase - using Pichia pastoris as a host to construct an engineered strain to achieve the high-level expression and industrial production of human Cu / Zn superoxide dismutase. Summary of the Invention

[0008] The object of the present invention is to provide an engineered strain expressing human Cu / Zn superoxide dismutase, a construction method thereof, and an application thereof to solve the problems existing in the above-mentioned prior art. This engineered strain can highly express human Cu / Zn superoxide dismutase, and its expression level can reach more than 3 g / L.

[0009] As a methylotrophic yeast, Pichia pastoris has the following advantages: it has a strong protein secretion ability, can efficiently secrete recombinant proteins into the fermentation broth, which is convenient for subsequent purification operations; it has a perfect post-translational modification system, can ensure that human Cu / Zn superoxide dismutase obtains the same glycosylation modification as in the natural state, and guarantee its structural integrity and biological activity; it is easy to scale up production and reduce costs. Compared with the mammalian cell expression system, Pichia pastoris has a fast growth rate and a simple and inexpensive culture medium, which is suitable for large-scale industrial production. Therefore, the present invention constructs an engineered strain capable of highly expressing human Cu / Zn superoxide dismutase using Pichia pastoris as a host.

[0010] Based on this, the present invention provides the following solutions:

[0011] The present invention provides a method for constructing an engineered strain expressing human Cu / Zn superoxide dismutase, comprising the following steps:

[0012] Clone the coding gene of human Cu / Zn superoxide dismutase into an expression vector to construct a recombinant plasmid;

[0013] Transform the recombinant plasmid into Pichia pastoris competent cells to construct the engineered strain;

[0014] The nucleotide sequence of the coding gene is shown as SEQ ID NO.2.

[0015] Further, the expression vector is pPICZαA vector.

[0016] Further, clone the coding gene between the EcoR I and Not I restriction enzyme cleavage sites of the expression vector.

[0017] Further, the Pichia pastoris competent cells are Pichia pastoris GS115 competent cells.

[0018] Further, the recombinant plasmid is transformed into the Pichia pastoris competent cells by electroporation.

[0019] The present invention also provides an engineered strain expressing human Cu / Zn superoxide dismutase constructed according to the above construction method.

[0020] The present invention also provides the application of the above-mentioned engineered strain expressing human Cu / Zn superoxide dismutase in the fermentative production of human Cu / Zn superoxide dismutase.

[0021] The present invention also provides a method for fermentatively producing human Cu / Zn superoxide dismutase, which includes the steps of fermenting and culturing the above-mentioned engineered bacteria to prepare the human Cu / Zn superoxide dismutase.

[0022] Further, by adding methanol to the fermentation medium, the induced expression of human Cu / Zn superoxide dismutase is achieved.

[0023] Further, in the fermentation medium, the volume fraction of methanol is 1%.

[0024] The present invention discloses the following technical effects:

[0025] The present invention uses Pichia pastoris as a host to construct an engineered bacterium capable of highly expressing human Cu / Zn superoxide dismutase, and its expression level can reach more than 3 g / L, which is much higher than the yield of traditional methods.

[0026] The present invention uses the Pichia pastoris expression system to replace the traditional methods of extracting from animal tissues or expressing in mammalian cells, greatly reducing the cost expenditures in aspects such as raw material procurement and process flow control, and at the same time improving the market competitiveness of the product.

[0027] The present invention provides strong technical support for developing an economically feasible, environmentally friendly and high-quality human Cu / Zn superoxide dismutase production process, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0029] Figure 1 It is the plasmid map of the recombinant plasmid pPICZαA-rhSOD1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0031] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0033] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are merely exemplary.

[0034] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0035] The pPICZαA vector used in the following examples was purchased from BioShang Technology (Shanghai) Co., Ltd., the Escherichia coli TOP10 strain was purchased from Beyotime Biotechnology Co., Ltd., and the Pichia pastoris GS115 was purchased from Beyotime Biotechnology Co., Ltd.

[0036] Example 1

[0037] 1. Nucleic acid sequence optimization

[0038] The cDNA sequence of human Cu / Zn superoxide dismutase (rhSOD1) is shown as SEQ ID NO.1. There is a hairpin structure at its translation start site and there are many rare codons in Pichia pastoris, which may affect its expression level in Pichia pastoris. Through the replacement of degenerate codons in the present invention, a gene sequence SEQ ID NO.2 without a hairpin structure at the translation start site and without rare codons in Pichia pastoris was obtained. The homology of the sequences before and after optimization is 92.9%.

[0039] SEQ ID NO.1:

[0040] ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAATTTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA。

[0041] SEQ ID NO.2:

[0042] ATGGCTACAAAGGCTGTATGTGTACTGAAGGGTGACGGACCAGTACAGGGCATCATCAATTTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGATCAATTAAAGGATTAACTGAAGGTCTGCATGGATTCCATGTCCATGAGTTCGGAGATAATACAGCAGGCTGTACCAGTGCTGGCCCTCACTTTAATCCTCTTTCCCGTAAACACGGTGGGCCAAAGGATGAGGAACGTCATGTAGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCAGATGTGTCTATTGAAGATTCTGTGATCTCATTATCAGGGGACCATTGCATCATTGGCAGAACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA。

[0043] 2. Construction of expression vector

[0044] Entrusted with Bio-Pharm Biotechnology (Shanghai) Co., Ltd., after adding restriction enzyme sites, a nucleotide sequence as shown in SEQ ID NO.3 was synthesized and cloned between the EcoR I / Not I restriction enzyme sites of the pPICZαA vector to construct the recombinant plasmid pPICZαA-rhSOD1. The plasmid map is as Figure 1 shown

[0045] SEQ ID NO.3:

[0046] GAATTC ATGGCTACAAAGGCTGTATGTGTACTGAAGGGTGACGGACCAGTACAGGGCATCATCAATTTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGATCAATTAAAGGATTAACTGAAGGTCTGCATGGATTCCATGTCCATGAGTTCGGAGATAATACAGCAGGCTGTACCAGTGCTGGCCCTCACTTTAATCCTCTTTCCCGTAAACACGGTGGGCCAAAGGATGAGGAACGTCATGTAGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCAGATGTGTCTATTGAAGATTCTGTGATCTCATTATCAGGGGACCATTGCATCATTGGCAGAACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA GCGGCCGC , where the underlined part is the restriction enzyme site

[0047] 3. Amplification of recombinant plasmid pPICZαA-rhSOD1

[0048] The recombinant plasmid pPICZαA-rhSOD1 was transformed into the competent cells of Escherichia coli TOP10. After identifying positive transformants, more than 20 μg of the recombinant plasmid pPICZαA-rhSOD1 was extracted using a plasmid extraction kit

[0049] 4. Linearization and purification of recombinant plasmid pPICZαA-rhSOD1

[0050] According to the instruction manual of restriction endonuclease Sac I, the recombinant plasmid pPICZαA-rhSOD1 was linearized. A 100 μL reaction system was used to digest 20 μg of the plasmid for 3 hours. After electrophoretic detection showed complete digestion, 100 μL of 5 M NaCl was added and mixed evenly. Then, 400 μL of 75% ethanol was added and mixed evenly. After freezing at -20 °C for 1 hour, centrifugation was carried out at 12000 rpm for 5 min to collect the precipitate. The precipitate was washed twice with 75% ethanol and then dried at 50 °C under sterile conditions. Subsequently, it was resuspended with 40 μL of sterile water to obtain the plasmid solution.

[0051] 5. Electroporation transformation of Pichia pastoris GS115

[0052] Take 5 μL, 10 μL, and 20 μL of the prepared plasmid solution and place them in the electroporation cuvette respectively. Then, add 100 μL of Pichia pastoris GS115 competent cells to each and mix evenly. Incubate in an ice-water bath for 5 min, perform electroporation at 1800 V for 5 ms, and immediately add 900 μL of ice-water bath-precooled 1 M sorbitol. Take 200 μL from each and spread them on YPD plates containing 100 μg / mL bleomycin, and culture at 30 °C for 3 days to screen for positive recombinants.

[0053] 6. Screening of positive recombinants

[0054] Pick 20 positive recombinants with an inoculation loop and inoculate them into 50 mL centrifuge tubes with breathing caps containing 5 mL of BMGY medium. Culture them on a shaker at 220 rpm and 30 °C for 24 hours. After taking them out, let them stand for 30 min. After the yeast cells completely sink to the bottom of the tube, discard all the supernatant; then add 5 mL of BMMY medium (containing 1% methanol by volume fraction), and culture on a shaker at 220 rpm and 28 °C for 96 hours for induced expression. During the culture period, methanol was supplemented to maintain the methanol volume concentration at 1%.

[0055] 7. Electrophoresis analysis of induced expression

[0056] After 96 hours of methanol-induced expression, take 500 μL of the fermentation broth respectively, centrifuge at 4500 rpm for 5 min, take 40 μL of the supernatant, add 10 μL of 5× loading buffer, and perform protein electrophoresis after boiling in a water bath. By comparing the protein electrophoresis results, the strain with the highest expression level of recombinant human Cu / Zn superoxide dismutase was screened and named GS115-pPICZαA-rhSOD1-3. After comparison with the standard quality BSA, the expression level of recombinant human Cu / Zn superoxide dismutase in the GS115-pPICZαA-rhSOD1-3 strain reached 3.5 g / L after 96 hours of induction culture with 1% methanol.

[0057] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an engineered strain expressing human Cu / Zn superoxide dismutase, characterized in that, It includes the following steps: Clone the coding gene of human Cu / Zn superoxide dismutase into an expression vector to construct a recombinant plasmid; Transform the recombinant plasmid into Pichia pastoris competent cells to construct the engineering strain; The nucleotide sequence of the coding gene is as shown in SEQ ID NO.2; The expression vector is pPICZαA vector; Clone the coding gene between the EcoR I and Not I restriction enzyme sites of the expression vector; The Pichia pastoris competent cells are Pichia pastoris GS115 competent cells.

2. The construction method according to claim 1, wherein Use the electrotransformation method to transform the recombinant plasmid into the Pichia pastoris competent cells.

3. An engineering strain expressing human Cu / Zn superoxide dismutase constructed by the construction method according to any one of claims 1-2.

4. Use of an engineering strain expressing human Cu / Zn superoxide dismutase as claimed in claim 3 in the fermentative production of human Cu / Zn superoxide dismutase.

5. A method for fermentatively producing human Cu / Zn superoxide dismutase, characterized in that, It includes the step of fermentatively culturing the engineering bacteria as claimed in claim 3 to prepare the human Cu / Zn superoxide dismutase.

6. The method according to claim 5, characterized in that Induced expression of human Cu / Zn superoxide dismutase is achieved by adding methanol to the fermentation medium.

7. The method according to claim 6, characterized in that, In the fermentation medium, the volume fraction of the methanol is 1%.

Images