Application of calcium sensor protein shcbl1 gene
By overexpressing the ShCBL1 gene in sugarcane and rice to enhance their cold tolerance, the problem of insufficient cold tolerance in plants in existing technologies has been solved, and the low-temperature adaptability of plants has been significantly improved.
Patent Information
- Application Number
- CN202610019925.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-08
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2046-01-08
AI Technical Summary
In the current technology, the function of the ShCBL1 gene in regulating plant cold tolerance has not been fully studied and applied, resulting in crops such as sugarcane and rice exhibiting weak cold tolerance under low temperature stress.
By overexpressing or overexpressing the ShCBL1 gene in sugarcane and rice, the content and activity of ShCBL1 protein in plants are enhanced, the content of proline and superoxide dismutase is increased, and the content of malondialdehyde is reduced, thereby improving the cold tolerance of plants.
It significantly improved the cold tolerance of sugarcane and rice seedlings, altered key physiological indicators, participated in the regulation of low-temperature signaling pathways, enhanced the plants' low-temperature adaptability, and provided a new method for molecular breeding.
Smart Images

Figure CN121472315B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically plant stress biology and molecular breeding, and particularly relates to the application of a calcium-sensing protein gene, ShCBL1. Background Technology
[0002] Low temperature stress is a significant environmental factor limiting the growth of many crops. Low temperatures lead to cell membrane damage, increased accumulation of reactive oxygen species, and inhibition of photosynthetic efficiency, ultimately affecting crop yield. Existing research shows that calcium... 2+ It plays a central role in plant stress signal transduction, among which CBL (Calcineurin B-like) protein is a key Ca 2+ Sensing factors can synergistically regulate stress response networks with CIPKs.
[0003] Calcineurin B-like proteins (CBLs), as plant-specific calcium ion sensors, play a central role in stress signal transduction pathways. Through specific interactions with downstream target proteins, they precisely decode calcium signals and initiate corresponding stress response mechanisms. Under drought stress, Arabidopsis thaliana AtCBL1 / 9 binds to CIPK, regulating potassium ion channels to maintain cell homeostasis, while simultaneously activating the ABA signaling pathway to promote stomatal closure, thereby regulating drought tolerance. Wheat TaCBL7 enhances osmotic regulation by increasing proline content. Under saline-alkali stress, AtCBL4 (SOS3) forms the SOS complex with CIPK24, driving sodium ion transporters to expel Na⁺ or compartmentalize it into vacuoles. Rice OsCBL10 and soybean GmCBL1 also enhance salt tolerance through this mechanism.
[0004] The ShCBL1 gene is a member of the CBL family identified in sugarcane material XTT22. Similar to its homolog in rice, it has the potential to participate in the regulation of salt and osmotic stress. However, the function of the ShCBL1 gene in regulating plant cold tolerance has not been previously reported. Summary of the Invention
[0005] To address the above problems, this invention provides an application of the calcium-sensing protein ShCBL1 gene.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] An application of the ShCBL1 gene in improving plant cold tolerance, characterized in that the application involves overexpressing or overexpressing the ShCBL1 gene in sugarcane or rice to increase the content of proline and superoxide dismutase and decrease the content of malondialdehyde in sugarcane or rice, thereby improving cold tolerance.
[0008] The sequence of the ShCBL1 gene is as shown in SEQ ID NO: 1;
[0009] The contents of proline, superoxide dismutase and malondialdehyde, and other stress resistance physiological indicators in sugarcane ShCBL1 overexpressing plants (ShCBL1-OE) and negative control plants (WT-XTT22) were detected to confirm the cold resistance of sugarcane ShCBL1-OE.
[0010] The expression of cold response marker genes in rice ShCBL1 overexpressing plants (ShCBL1-OE) and negative control plants (WT-ZH11) was detected to confirm the cold tolerance of rice ShCBL1-OE.
[0011] Furthermore, the application involves transforming sugarcane or rice with a recombinant vector containing the ShCBL1 gene or a strain containing the ShCBL1 gene, thereby overexpressing or over-expressing the ShCBL1 gene in sugarcane or rice.
[0012] Specifically, the application involves using sugarcane leaf cDNA as a template for PCR amplification, cloning the full-length sequence of the ShCBL1 gene, and then using Agrobacterium-mediated transformation to overexpress or overexpress the ShCBL1 gene in rice or sugarcane materials to obtain overexpressing plants.
[0013] Rice plants overexpressing ShCBL1 (ShCBL1-OE) and negative control plants (WT-ZH11) were subjected to 4℃ cold treatment, while sugarcane plants overexpressing ShCBL1 (ShCBL1-OE) and negative control plants (WT-XTT22) were subjected to -5℃ cold treatment. By comparing the phenotypic differences in cold tolerance between the overexpressing plants (ShCBL1-OE) and negative control plants before and after cold treatment, it was determined that ShCBL1 can positively regulate the cold tolerance of rice and sugarcane seedlings. At the same time, total RNA was extracted from leaves, cDNA was obtained by reverse transcription, and the expression level of ShCBL1 gene in ShCBL1-OE and negative control plants was analyzed by real-time fluorescence quantitative analysis to confirm the reliability of the phenotypic data.
[0014] Furthermore, the recombinant vector containing the ShCBL1 gene is obtained by ligating the ShCBL1 gene into an overexpression vector;
[0015] The recombinant vector containing the ShCBL1 gene is a ShCBL1 gene overexpression vector.
[0016] Furthermore, the strain containing the ShCBL1 gene is either Agrobacterium containing the ShCBL1 gene or Escherichia coli containing the ShCBL1 gene;
[0017] Strains containing the ShCBL1 gene are ShCBL1 gene overexpressing strains.
[0018] A method for improving the cold tolerance of plants, wherein the method involves overexpressing or overexpressing the ShCBL1 gene in sugarcane or rice, thereby increasing the content and / or activity of the ShCBL1 protein in the plant, increasing the content of proline and superoxide dismutase, and decreasing the content of malondialdehyde, to improve the cold tolerance of the plant.
[0019] The sequence of the ShCBL1 gene is shown in SEQ ID NO: 1.
[0020] Furthermore, the method involves transforming sugarcane or rice with a recombinant vector containing the ShCBL1 gene or a strain containing the ShCBL1 gene, thereby overexpressing or over-expressing the ShCBL1 gene in sugarcane or rice.
[0021] Furthermore, the recombinant vector containing the ShCBL1 gene is obtained by ligating the ShCBL1 gene into an overexpression vector.
[0022] Furthermore, the strain containing the ShCBL1 gene is either Agrobacterium containing the ShCBL1 gene or Escherichia coli containing the ShCBL1 gene.
[0023] A plant breeding method, wherein the breeding method involves overexpressing or overexpressing the ShCBL1 gene in sugarcane or rice to increase the content of proline and superoxide dismutase and decrease the content of malondialdehyde in sugarcane or rice, thereby obtaining sugarcane or rice with enhanced cold resistance.
[0024] The sequence of the ShCBL1 gene is shown in SEQ ID NO: 1.
[0025] Furthermore, the breeding method involves transforming sugarcane or rice with a recombinant vector containing the ShCBL1 gene or a strain containing the ShCBL1 gene, thereby overexpressing or over-expressing the ShCBL1 gene in sugarcane or rice.
[0026] Sugarcane or rice are the parent plants and offspring plants, as well as different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs. Target genes or nucleic acids are present in all these different parts.
[0027] This invention includes any plant cell, or any plant obtained or available by the methods described herein, as well as all plant parts and their propagules; this invention also includes transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods; the only requirement is that the offspring exhibit the same genotype or phenotypic characteristics, and that the offspring obtained using the methods of this invention have the same characteristics.
[0028] The beneficial effects of applying the ShCBL1 gene, a calcium-sensing protein, according to the present invention are as follows:
[0029] The research of this invention shows that overexpression of ShCBL1 in rice and sugarcane can significantly improve the cold tolerance of seedlings and alter key indicators such as proline, superoxide dismutase, and malondialdehyde. In addition, ShCBL1 also affects the expression of cold response marker genes in rice, suggesting that it is involved in the regulation of low temperature signaling pathways. Therefore, ShCBL1 is a cold tolerance functional gene with important application prospects.
[0030] This invention clones the sugarcane ShCBL1 gene, constructs an overexpression vector, and improves the cold tolerance of plants by overexpressing this single gene (sugarcane ShCBL1 gene). This demonstrates that the ShCBL1 gene can positively regulate the cold tolerance of sugarcane and rice seedlings, and is an important candidate gene in molecular breeding of plant cold tolerance, with potential application value for the genetic improvement of plant cold tolerance.
[0031] In practical applications, the ShCBL1 gene can be introduced into target plants to obtain cold-resistant sugarcane and rice plants, providing a new method for molecular breeding of sugarcane and rice. Attached Figure Description
[0032] Figure 1 This is a structural diagram of the recombinant vector pCAMBIA3300:ShCBL1 in Embodiment 1 of the present invention;
[0033] Figure 2 This invention describes the phenotypes of sugarcane and rice overexpression plants and negative control plants before and after cold treatment; wherein, Figure 2 The left figure in Example 2 shows the phenotypes of sugarcane overexpression plants and negative control plants before and after cold treatment, while the right figure shows the phenotypes of rice overexpression plants and negative control plants before and after cold treatment in Example 3.
[0034] Figure 3 This refers to the proline content of sugarcane overexpression plants (ShCBL1-OE) and negative control plants (WT-XTT22) before and after cold treatment in Example 4 of this invention;
[0035] Figure 4 The superoxide dismutase content of sugarcane overexpression plants (ShCBL1-OE) and negative control plants (WT-XTT22) before and after cold treatment in Example 4 of this invention;
[0036] Figure 5 This refers to the malondialdehyde (MDA) content of sugarcane overexpression plants (ShCBL1-OE) and negative control plants (WT-XTT22) before and after cold treatment in Example 4 of this invention.
[0037] Figure 6This refers to the expression levels of the sugarcane overexpression plant (ShCBL1-OE) and the negative control plant (WT-XTT22) before cold treatment in Example 5 of this invention;
[0038] Figure 7 These are semi-quantitative gel images of rice overexpression plants (ShCBL1-OE) and negative control plants (WT-ZH11) before and after cold treatment in Example 5 of this invention; wherein, ShCBL1 represents the target band corresponding to the ShCBL1 gene, and OsACTIN represents the target band corresponding to the OsACTIN gene.
[0039] Figure 8 This refers to the expression levels of cold response marker genes in rice overexpression plants (ShCBL1-OE) and negative control plants (WT-ZH11) in Example 6 of this invention; wherein, OsCold1 represents the cold response marker gene of the upstream regulatory pathway of ShCBL1, and OsICE1 represents the cold response marker gene of the downstream regulatory pathway of ShCBL1. Detailed Implementation
[0040] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it.
[0041] Furthermore, in the specific embodiments disclosed below, where specific techniques or conditions are not specified, the techniques or conditions described in the literature in this field (e.g., refer to *Molecular Cloning: A Laboratory Manual*, 3rd edition, translated by Huang Peitang et al., Science Press) or the product instructions should be followed. Reagents whose manufacturers are not specified are all conventionally available products. Unless otherwise specified, the experimental methods used in the embodiments disclosed below are conventional methods. Unless otherwise specified, the materials and reagents used in the embodiments disclosed below are all commercially available.
[0042] The XTT22 sugarcane and ZH11 rice used in this invention are both derived from and preserved at the Institute of Tropical Biotechnology, Chinese Academy of Tropical Agricultural Sciences.
[0043] Example 1: Obtaining ShCBL1 overexpressing plants
[0044] The full-length sequence of the ShCBL1 gene was obtained from the sugarcane XTT22 genome database. Primers for amplifying the full-length ShCBL1 gene (ShCBL1 gene sequence as shown in SEQ ID NO: 1, ShCBL1 protein sequence as shown in SEQ ID NO: 2) were designed using Primer 5 software: ShCBL1-F: 5'-ATGGGGTGCTTCCATTCCAC-3' / ShCBL1-R: 5'-TGTGACGAGATCATCGACTT-3'.
[0045] Total RNA was extracted from young leaves of sugarcane varieties LA, SP80, Badila, Co285, Kassoer, Cheribon, POJ2878, EK28, ROC22, 1202, 1301, 1305, YN82-114, and FN094095 using an RNA extraction kit and reverse transcribed into cDNA. The full-length ShCBL1 sequence was then amplified using the cDNA from these sugarcane varieties as templates. The PCR amplification system and procedure are as follows:
[0046] Table 1 PCR amplification system
[0047]
[0048] PCR amplification program: 95℃, 3 min; 95℃, 30 sec, 58℃, 30 sec, 72℃, 1 min, 35 cycles; 72℃, 5 min, 4℃, 10 min.
[0049] The empty plasmid of the pCAMBIA3300 overexpression vector was double-digested with BamHI and SacI restriction endonucleases, and the product was purified after digestion at 37℃ for 4 h. Homologous recombination was used to homologously recombine a 639 bp target fragment of the ShCBL1 gene (with the stop codon removed, the sequence of the ShCBL1 gene without the stop codon is shown in SEQ ID NO: 3) with the linearized pCAMBIA3300 vector fragment, resulting in the recombinant vector pCAMBIA3300:ShCBL1 (the structure of the recombinant vector pCAMBIA3300:ShCBL1 is shown in the figure below). Figure 1(As shown) The cells were transformed into competent E. coli DH5α cells by heat shock. After growing on LB plates containing 100 mg / mL kanamycin for 12 h, several single clones were picked for propagation. Positive detection was performed using universal primers for the pCAMBIA3300 vector: pCAMBIA3300-F:5'-CCCTGCCTTCATACGCTATT-3' and pCAMBIA3300-R:5'-CGTATGTTGCATCACCTTCAC-3'. The positive plasmid pCAMBIA3300:ShCBL1 was isolated.
[0050] The positive plasmid pCAMBIA3300:ShCBL1 was transformed into Agrobacterium tumefaciens EHA105. Then, the positive plasmid pCAMBIA3300:ShCBL1 was transformed into Zhonghua 11 (rice) and XTT22 (sugarcane) respectively using the Agrobacterium infection method, with wild-type Zhonghua 11 and XTT22 as controls. The specific operation is as follows:
[0051] High-growth embryogenic callus tissues from sugarcane were selected and transferred to sterilized filter paper for air drying. The sugarcane callus was then transferred to EHA105 Agrobacterium infection solution (obtained by resuspending activated EHA105 Agrobacterium containing the positive plasmid pCAMBIA3300:ShCBL1 in MR liquid medium containing 100 µmol / L acetylsyleugenol) and incubated for 30 min. The EHA105 Agrobacterium infection solution was filtered off, and the callus tissue containing Agrobacterium was placed on sterile filter paper for air drying. The dried infected callus tissue was placed on MS solid medium and incubated in the dark at 22°C for 5 days. After dark incubation, the tissue was washed once with sterile water containing 200 mg / L carbenicillin (Car), then washed 2-4 times with Car-free sterile water, and washed once with liquid MS. The tissue was then placed on sterile filter paper and air dried using a sterile strainer. After drying, the tissue was placed on M2 solid medium containing 200 mg / L Carb and cultured in a constant temperature incubator at 28°C for about three weeks until the embryogenic callus tissue slowly differentiated into green seedlings. The seedlings differentiated from the callus were screened on MS medium containing 2.0 mg / L glyphosate. The selected resistant plants were transferred to M3 medium for rooting culture. After the root system of the seedlings was fully developed, they were removed from the medium, cleaned, old leaves removed, disinfected, and transplanted into crystal soil. They were marked and hardened off for one week. After robust growth, they were planted in flowerpots. The obtained transgenic plants were subjected to DNA detection using the herbicide resistance bar gene primers Bar409-F: CGAGACAAGCACGGTCAACT; Bar409-R: CTGCCAGAAACCCACGTCAT. Homozygous positive plants with herbicide resistance were obtained, namely sugarcane ShCBL1 overexpression plants.
[0052] Mature seeds of Zhonghua 11 were used to induce embryogenic callus on N6D medium (containing 2.5 mg / L 2,4-dichlorophenoxyacetic acid) for 3-4 weeks. Active callus, pale yellowish-white in color and 1-3 mm in diameter, was selected for transformation. Pre-culture: Callus tissue was pre-cultured on fresh N6D medium for 3 days; Infection: Agrobacterium tumefaciens EHA105 containing the positive plasmid pCAMBIA3300:ShCBL1 was resuspended in AAM infection medium (OD200). 600 =0.05~0.1, containing 100µmol / L acetosyringone), soak the callus tissue for 30min; co-culture: transfer the callus tissue to 2N6-AS medium containing 100µmol / L acetosyringone, and co-culture in the dark for 2~3 days; washing and selection: after co-culture, thoroughly wash the callus to remove excess Agrobacterium, and transfer it to N6D-S selection medium containing carbenicillin (inhibits Agrobacterium 400mg / L), culture for 3~4 weeks, and then transfer it to a new N6D-S selection medium containing carbenicillin (400mg / L) and hygromycin (50mg / L) for three more weeks; regeneration: transfer the resistant callus to MS-NK regeneration medium to induce shoots, and then transfer the green shoots to MS-HF medium to promote rooting, to obtain transgenic plants. The obtained transgenic plants were subjected to DNA testing using the herbicide-resistant bar gene primers Bar409-F: 5'-CGAGACAAGCACGGTCAACT-3'; Bar409-R: 5'-CTGCCAGAAACCCACGTCAT-3', resulting in homozygous positive plants with herbicide resistance, namely rice ShCBL1 overexpression plants.
[0053] Example 2: Identification of the function of the ShCBL1 gene by cold treatment of sugarcane
[0054] Sugarcane ShCBL1 overexpressing plants (ShCBL1-OE) and negative control plants (WT-XTT22) were cryogenically treated in a climate incubator at -5℃ and 22000 Lux light intensity. The results are as follows: Figure 2 As shown in the middle left figure, it can be seen that there was no significant difference in phenotype between ShCBL1-OE and WT-XTT22 plants before cold treatment. However, after 7 hours of cold treatment at -5℃, the two cotyledons of WT-XTT22 drooped significantly, physiological lesions appeared at the veins, and the leaf color changed from light green to dark green. On the other hand, the two cotyledons of ShCBL1-OE did not change much from before cold treatment, indicating that the cold tolerance of sugarcane ShCBL1-OE plants was significantly enhanced.
[0055] Example 3: Identification of the function of the ShCBL1 gene in rice by cold treatment
[0056] Cold treatment was performed on rice ShCBL1 overexpressing plants (ShCBL1-OE) and negative control plants (WT-ZH11) in a climate incubator at 4℃ and 22000 Lux light intensity. The results are as follows: Figure 2 As shown in the middle right figure, it can be seen that there was no significant difference in the phenotype of ShCBL1-OE and WT-ZH11 plants before cold treatment. However, after 5 hours of cold treatment at 4℃, the leaves of WT-ZH11 plants curled significantly, while the two cotyledons of ShCBL1-OE plants did not change much from those before cold treatment. This indicates that the cold tolerance of rice ShCBL1-OE plants was significantly enhanced.
[0057] Example 4: Detection of physiological indicators of sugarcane after cold treatment
[0058] In the physiological assessment under cold stress (-5°C, 7 hours in darkness), upper leaf tissues (n=3 biological replicates) at the same developmental stage were collected from negative control plants (WT-XTT22) and sugarcane ShCBL1 overexpressing plants (ShCBL1-OE). Sampling was performed from the same leaf position to reduce individual variability. The tissues were immediately rapidly frozen in liquid nitrogen and stored at -80°C until analysis. Stress-related biomarkers were quantified using a standardized commercial kit (Solaborac Beijing), with three replicates for each biomarker. Proline (Pro) content was determined by the acidic ninhydrin method. The absorbance was measured at 520 nm using a UV-Vis spectrophotometer, and the concentration was extrapolated from the L-proline standard curve (y=-0.3865x+2.8042). The results are as follows: Figure 3 As shown, the proline content of sugarcane ShCBL1 overexpressing plants (ShCBL1-OE) was significantly higher than that of the negative control plants (WT-ZH11). Superoxide dismutase (SOD) activity was assessed by monitoring the inhibition of nitroblue tetrazolium (NBT) photoreduction at 560 nm. One unit was defined as the amount of enzyme causing 50% inhibition of NBT reduction. The results are as follows: Figure 4 The results showed that the superoxide dismutase activity of sugarcane ShCBL1 overexpressing plants (ShCBL1-OE) was significantly higher than that of the negative control plants (WT-ZH11); malondialdehyde (MDA) content was determined by the thiobarbituric acid (TBA) reaction, with absorbance measured at 532 nm and 600 nm using a UV-Vis spectrophotometer (Lambda 35, PerkinElmer), and based on an extinction coefficient of 155 mM. -1 cm -1 The MDA concentration was calculated, and the results are as follows: Figure 5 As shown, the malondialdehyde (MDA) content in sugarcane plants overexpressing ShCBL1 (ShCBL1-OE) was significantly lower than that in the negative control plant (WT-ZH11). These changes in the content of the three cold resistance physiological indicators suggest that ShCBL1 overexpression can increase the cold resistance of sugarcane.
[0059] Example 5: ShCBL1 gene expression analysis
[0060] Sugarcane stem segments from the ShCBL1 overexpressing plant (ShCBL1-OE), sugarcane stem segments from the negative control plant (WT-XTT22), rice seeds from the ShCBL1 overexpressing plant, and rice seeds from the negative control plant (WT-ZH11) were soaked at room temperature, germinated, and then hydroponically cultured in black culture pots. These were then grown in an artificial climate incubator with 16 hours of light / 8 hours of darkness and day / night temperatures of 28 / 22°C. When the sugarcane reached the three-leaf stage, all leaves were harvested at -5°C at 0h and 7h. Similarly, all leaves were harvested from the rice at 4°C at 0h and 5h. The samples were then thoroughly ground using a low-temperature grinder and stored in an ultra-low temperature freezer at -80°C.
[0061] Primers for quantitative real-time analysis of the ShCBL1 gene were designed using Primer 5 software: RT-ShCBL1-F: 5'-CGATATGGATGGCACAGGGT-3'; RT-ShCBL1-R: 5'-CTGATTTGCATCAGCGTCCG-3'. The designed primers were then BLASTed using the sugarcane genome database. The primers showed specificity and could be used for subsequent experiments. Total RNA was extracted from the samples using a GeneStar RNA extraction kit, and cDNA was obtained by reverse transcription using a reverse transcription kit.
[0062] A quantitative PCR experiment was performed on sugarcane using RT-ShCBL1-F and RT-ShCBL1-R primers. The results are as follows: Figure 6 As shown, the expression level of sugarcane ShCBL1 overexpressing plants (ShCBL1-OE) was significantly higher than that of the negative control plants (WT-XTT22).
[0063] Total RNA was extracted from rice samples using a GeneStar RNA extraction kit, and rice cDNA was obtained by reverse transcription using a reverse transcription kit. PCR experiments were performed using RT-ShCBL1-F and RT-ShCBL1-R primers. The PCR products were then subjected to agarose gel electrophoresis on a 1% agarose gel, yielding a semi-quantitative rice gel image. The semi-quantitative rice gel image results are shown below. Figure 7 As shown, the ShCBL1 gene in rice was significantly upregulated under cold stress, indicating that the ShCBL1 gene responds rapidly to cold stress and upregulated its expression to enhance the cold resistance of rice seedlings.
[0064] Example 6: The effect of ShCBL1 gene expression on the expression of cold response marker genes in rice
[0065] RT-qPCR experiments were conducted to detect the expression levels of previously reported rice cold response marker genes (based on the literature: Ma Y, Dai X, Xu Y, et al. COLD1 confers chilling tolerance in rice. Cell. 2015;160 (6):1209-1221; Junya N, Takashi Y, Tran T, et al. Rice homologs of inducer of CBF expression (OsICE) are involved in cold acclimation. PlantBiotechnology. 2011;28 (3):303-309.). The detection results of ShCBL1 overexpressing plants and negative control plants (WT-ZH11) are as follows: Figure 8 As shown, the results indicate that overexpression of ShCBL1 does not affect the expression of the upstream rice cold response marker gene OsCold1; however, it significantly upregulates the expression of the downstream rice cold response marker gene OsICE1, suggesting that under cold stress, the ShCBL1 gene may regulate the upregulation of the cold response marker gene OsICE1 to enhance the cold tolerance of rice seedlings.
[0066] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. Those skilled in the art can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. An application of the ShCBL1 gene in improving cold tolerance in rice, characterized in that, The application improves cold tolerance by overexpressing the ShCBL1 gene in rice. The sequence of the ShCBL1 gene is shown in SEQ ID NO:
1.
2. The application of the ShCBL1 gene in improving cold tolerance in rice according to claim 1, characterized in that, The application involves transforming rice with a recombinant vector containing the ShCBL1 gene or a strain containing the ShCBL1 gene to overexpress the ShCBL1 gene in rice.
3. The application of the ShCBL1 gene in improving cold tolerance in rice according to claim 2, characterized in that, The recombinant vector containing the ShCBL1 gene is obtained by ligating the ShCBL1 gene into an overexpression vector.
4. The application of the ShCBL1 gene in improving cold tolerance in rice according to claim 2, characterized in that, The strain containing the ShCBL1 gene is either Agrobacterium or Escherichia coli containing the ShCBL1 gene.
5. A method for improving the cold resistance of rice, characterized in that, The method involves overexpressing the ShCBL1 gene in rice to enhance the cold tolerance of the plant by increasing the content and / or activity of the ShCBL1 protein in the plant. The sequence of the ShCBL1 gene is shown in SEQ ID NO:
1.
6. The method for improving the cold resistance of rice according to claim 5, characterized in that, The method involves transforming rice with a recombinant vector containing the ShCBL1 gene or a strain containing the ShCBL1 gene to overexpress the ShCBL1 gene in rice.
7. The method for improving the cold resistance of rice according to claim 6, characterized in that, The recombinant vector containing the ShCBL1 gene was obtained by ligating the ShCBL1 gene into an overexpression vector.
8. The method for improving the cold resistance of rice according to claim 6, characterized in that, The strain containing the ShCBL1 gene is either Agrobacterium or Escherichia coli containing the ShCBL1 gene.
9. A method for rice breeding, characterized in that, The breeding method involves overexpressing the ShCBL1 gene in rice to obtain rice with enhanced cold resistance. The sequence of the ShCBL1 gene is shown in SEQ ID NO:
1.
10. The rice breeding method according to claim 9, characterized in that, The breeding method involves transforming rice with a recombinant vector containing the ShCBL1 gene or a strain containing the ShCBL1 gene to overexpress the ShCBL1 gene in rice.