Application of rice gene OsTCP2 or mutant thereof in regulation and control of heading period of rice

Abstract

The invention belongs to the technical field of plant biology, and provides a method for regulating and controlling the heading stage of rice by using an OsTCP2 gene, and the OsTCP2 is used as a TCP family transcription factor and plays an important role in regulating and controlling the heading stage of the rice. Experimental results show that the heading period of the OsTCP2 function deletion mutant strain is obviously advanced. The nucleotide sequence of the OsTCP2 gene is defined, the mutant of the OsTCP2 gene is constructed, and an OsTCP2 mutant plant is successfully obtained through a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) technology. The mutants show an obvious early blossoming phenomenon under a long-day condition, and the heading period is about 8 days earlier than that of a wild type on average. A new gene resource is provided for regulation and control of the heading period of the rice, rice varieties can be improved through a molecular breeding means, the adaptive capacity and yield of the rice varieties in different regions are improved, and the gene has important significance on agricultural production.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and specifically discloses the application of rice gene OsTCP2 or its mutant in regulating the heading date of rice. Background Art

[0002] Rice (Oryza sativa L.) is a facultative short-day (SD) plant. In addition to being a model plant for molecular genetic research of monocotyledons, rice is also the main nutritional source for nearly half of the world's population (D. Tilman et al., 2011), playing a crucial role in global food security. The heading date generally refers to the number of growing days required for rice from sowing to the emergence of the panicle from the flag leaf. The heading date of rice determines the adaptability and yield of rice varieties in different regions, and its regulation is an extremely complex life process, jointly determined by internal genetic factors such as genes and external environmental factors such as light and temperature. In the past two decades, many genes controlling the flowering period have been cloned, and extensive research has been conducted on the mechanism of rice from leaf recognition of day length to the activation of flowering in the shoot apical meristem. First, the leaves measure the photoperiod and produce a mobile flowering signal called florigen under inductive day lengths. Then, florigen is transported from the leaves to the shoot apex, where the shoot apical meristem (SAM) perceives the florigen signal and activates downstream floral identity genes, thus triggering the transition to flowering. For the genetic pathway of photoperiod-controlled flowering, in-depth research has been carried out in the model plant Arabidopsis thaliana. In addition, there are multiple layers of transcriptional and post-transcriptional modifications that regulate the photoperiod flowering pathway, thus affecting the flowering time (Blumel et a1., 2015).

[0003] Through forward and reverse genetics as well as population genetics studies, many genes involved in photoperiodic flowering have been cloned in rice. The evolutionarily conserved OsGI-Hd1-Hd3a pathway and the Ehd1-centered specific pathway in monocotyledons. Both of these pathways ultimately integrate into florigen. Rice has two florigen genes, namely Hd3a and the rice florigen gene RFT1. Both of these genes encode a phosphatidylethanolamine-binding protein, which is an approximate homolog of Arabidopsis FT. As an inbred plant, rice is induced to flower when the day length is less than a specific threshold (called the critical day length). When the day length is shorter than 13 hours, even in rice seedlings, the florigen gene Hd3a is expressed in the morning; when the day length exceeds 13.5 hours, the expression level of Hd3a is reduced to less than one-tenth of the 13-hour day length level (Itoh et al., 2010). CRISPR-Cas genome editing has enabled targeted modification of specific heading date genes (Shirong Zhou et al., 2020), making the breeding of new varieties with pre-determined combinations of heading date genes more efficient, and it is a rapid, feasible, and reliable technology for regulating the heading date of rice. Studying the heading date of rice can provide a scientific basis for improving rice production efficiency, coping with climate change, optimizing agricultural management, promoting breeding innovation, etc., and ensuring sustainable agricultural development. Therefore, the study of the molecular regulation mechanism of the rice heading date still has important theoretical guiding significance for agricultural production.

[0004] The TCP family is a group of plant-specific genes encoding transcription factors. Many members of this family have a great impact on the growth patterns of tissues and organs during plant development and are thus key factors determining plant morphology. TCP genes are divided into class I and class II, distinguished by specific amino acids in the TCP domain. In the second class of genes, two strains were found in angiosperms, namely the CIN and CYC / TB1 genes (M. Martín-Trillo et al., 2010). TCPs control the flowering time of shoot apices and axillary meristems. The timing of the flowering transition is determined by the activity of the floral stimulus, a systemic signal that moves from leaves to shoot apices. In Arabidopsis, this function is achieved by the floral stimuli FT and TSF. In the YTH assay, the BRC1 protein can interact with FT and TSF, and brc1 mutants show early floral transition in lateral buds. Therefore, it is thought that BRC1 can prevent premature flowering of axillary buds by interfering with FT and TSF (Niwa et al., 2013), however, another study showed that brc1 mutants flower later in the main bud. In addition, combinations of Arabidopsis cin loss-of-function mutants flower later (Ho and Weigel, 2014). Since CIN genes are expressed in leaves, their positive effect on flowering may be produced by interacting with FT / TSF in leaves, even before FT is transported to the shoot apex. Finally, several class I TCP proteins (TCP7, TCP8, TCP9, TCP14, TCP15, TCP21, TCP22, and TCP23) were also found to interact with FT in the bimolecular fluorescence complementation (BiFC) assay; however, their effects on flowering have not been analyzed except that mutants of TCP11 show late flowering. In recent years, more and more TCP genes have been associated with central biological processes such as hormone synthesis and signal transduction, flowering time, and circadian rhythm regulation. It also has important theoretical and practical significance for regulating the heading date of rice in different regions and molecular design breeding. Summary of the Invention

[0005] To solve the above problems, we disclose the application of the rice gene OsTCP2 or its mutants in regulating the heading date of rice.

[0006] The present invention includes the following specific technical solutions:

[0007] The application of the rice gene OsTCP2 or its mutants in regulating the heading date of rice, characterized in that the application includes overexpressing the gene OsTCP2 in rice or knocking out the rice gene OsTCP2, thereby correspondingly delaying or advancing the heading date of rice.

[0008] Further, in the above application, the OsTCP2 or its mutants have a nucleotide sequence shown in any one of (a) to (c):

[0009] (a) The nucleotide sequence shown in SEQ ID No.1;

[0010] (b) Mutants of the nucleotide sequence shown in SEQ ID No.1 with one or several base substitutions and / or deletions and / or additions and having the same function;

[0011] (c) Mutants having a similarity of more than 88% with the nucleotide sequence shown in SEQ ID No.1 and having the same function.

[0012] Furthermore, in the above application, the nucleotide sequence of the OsTCP2 mutant is the nucleotide sequence shown in SEQ ID No.2 or SEQ ID No.3.

[0013] The present invention also discloses a biological material comprising an sgRNA sequence capable of directionally knocking out the OsTCP2 gene, and the biological material includes any one of (a) to (c):

[0014] (a) An expression cassette;

[0015] (b) A recombinant vector;

[0016] (c) A recombinant prokaryotic cell;

[0017] The sgRNA sequence is as shown in SEQ ID No.10.

[0018] Furthermore, in the above biological material, the recombinant vector selects plasmid pCAMBIA1300 as the vector.

[0019] Furthermore, in the above biological material, the recombinant prokaryotic cell selects Agrobacterium as the host cell.

[0020] Furthermore, in the above biological material, the Agrobacterium is EHA105.

[0021] The present invention discloses a method for regulating the heading date of rice, which uses the above biological material to transfect plant tissues, and plants with the OsTCP2 mutant gene are obtained through screening.

[0022] The present invention discloses a protein edited by OsTCP2 or its mutant, which has the amino acid sequence shown in SEQ ID No.5 or SEQ ID No.6.

[0023] Compared with the prior art, the present invention has the following outstanding beneficial effects:

[0024] The present invention provides the application of OsTCP2 or its mutant in regulating the heading date of rice, and provides the specific nucleotide sequence contained in OsTCP2 or its mutant, as well as the biological material containing the OsTCP2 mutant, and also provides a clear method for regulating the heading date of rice by using the OsTCP2 or its mutant and the biological material, which provides a clear, simple and highly popularizable technical solution for improving the adaptability of rice varieties in different regions and increasing crop yields, and has potential economic value. Brief Description of the Drawings

[0025] Figure 1 It is a schematic diagram of the mutation sites of two mutants of the OsTCP2 gene;

[0026] Figure 2 It is the phenotype diagram of the early heading of the ostcp2 mutant and the statistical results of the heading date. Detailed Embodiments

[0027] The technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0028] The sequences of the present invention are shown in Table 1.

[0029] Table 1 Sequence Listing

[0030]

[0031]

[0032]

[0033]

[0035] Example 1

[0036] Clone the nucleotide sequence of the OsTCP2 gene

[0037] Total RNA of rice was extracted from rice using the plant RNA extraction kit of Easy Do Company. Then, using 1 μg of total RNA as a template, the RNA was reverse transcribed into cDNA according to the operation instructions of the cDNA synthesis kit (Yeasen). The complete ORF of OsTCP2 was obtained from the website (http: / / rice.plantbiology.msu.edu / expression.shtml), and specific primers were designed: the 5'-end primer was ATGATACTAGGAAGCAACC (SEQ ID No. 7); the 3'-end primer was TTAGCTTCCTGTCTGATCAT (SEQ ID No. 8). The PCR reaction system was 2×Mix 10 μL, forward / reverse primers 10 μM each 0.5 μL, template (cDNA) 1 μL, and sterilized water was added to make up to 20 μL. The reaction procedure was as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C at 2 kb / min, 35 - 40 cycles, and extension at 72 °C for 5 min. Finally, a 924 bp (including the stop codon) full-length cDNA sequence of OsTCP2 (as shown in SEQ ID No. 1) was amplified, encoding 307 amino acids (as shown in SEQ ID No. 4).

[0038] Example 2

[0039] Construction of OsTCP2 gene mutants

[0040] Based on the CRISPR-Cas9 technology, vectors pCAMBIA1300-CAS9-Os-OsTCP2 for two OsTCP2 gene mutants were constructed:

[0041] 2.1 Select the 566 - 588 positions of the CDS sequence of the OsTCP2 gene

[0042] (GCGGAGCGGCGCACATAGTG GGG, as shown in SEQ ID No.9, where the underlined part is the PAM sequence conforming to NGG) sequence is used as the target site, and sgRNA is synthesized. The nucleotide sequence is GCGGAGCGGCGCACATAGTG (as shown in SEQ ID No.10). The gene editing vector psgR-CAS9-Os is digested with BbsI. First, the primers are annealed. The annealing reaction system includes 10 μL of forward primer F: TGTGTGGCGGAGCGGCGCACATAGTGGGG (as shown in SEQ ID No.11), 10 μL of reverse primer R: AAACCCCCACTATGTGCGCCGCTCCGCCA (as shown in SEQ ID No.12), and 80 μL of 10×T4 buffer. After mixing the reaction system, it is incubated at 95 °C for 10 min and then cooled on ice. Then it is ligated with the digested vector psgR-CAS9-Os. The ligation system includes 2 μL of the annealed product, 2 μL of the recovered digested vector, 0.5 μL of 10×T4 buffer, and 0.5 μL of T4 ligase, and ligated at room temperature for 30 min. The ligation product is transformed into Escherichia coli competent cell DH5α. The transformation procedure is as follows: Add the ligation product to the competent Escherichia coli, flick it gently to mix, let it stand on ice for 30 min, heat shock it in a 42 °C water bath for 1 min, then let it stand on ice for 2 min, add 400 μL of LB, resuscitate and shake the bacteria at 37 °C for 1 h, centrifuge at 8000 rpm for 1 min, suck off most of the supernatant, leave 100 μL of the liquid, pipette it evenly, spread it on an LB plate (containing 50 μg / mL Kan) for culture, and select monoclonal colonies for sequencing identification the next day to analyze whether the vector is successfully constructed.

[0043] Example 3

[0044] Obtaining and Identification of OsTCP2 Gene Mutants

[0045] Using rice (Nipponbare) callus as the experimental material. The mutant vector of OsTCP2 obtained in Example 2 was transformed into Agrobacterium tumefaciens EHA105 by the freeze-thaw method. Single colonies of Agrobacterium containing the OsTCP2 mutant vector were picked and cultured overnight at 28 °C and 200 rpm in 2 mL of LB liquid medium containing rifampicin and spectinomycin. Then, 1 mL of the bacterial solution was transferred to 10 mL of LB containing rifampicin and spectinomycin and cultured for 5 h. The cells were centrifuged at 4000 rpm for 10 min at room temperature, the supernatant was discarded, and the cells were resuspended in 50 mL of AAM-As resuspension solution. Well-grown rice callus was selected and immersed in the Agrobacterium suspension for 30 min, and then cultured in the dark at 28 °C for 2 days. After 2 days, the callus was rinsed with sterile water until the washing solution was clear, and then the callus was transferred to a selection medium containing 50 mg / L hygromycin for screening for about two weeks. The selected resistant callus was transferred to a differentiation medium containing 50 mg / L hygromycin for culture. After 2-3 weeks, the green rice shoots were transferred to a rooting medium to induce root formation. For mutant positive plants, the gDNA of T0 generation plants needs to be extracted, identified by PCR and sequenced.

[0046] Identification of OsTCP2 mutants: Using the leaves of T0 generation transgenic plants as templates, specific forward primer F (CCACGCCGACGACGATAA, as shown in SEQ ID No. 13) and reverse primer R (CCAAGGAAAGCAGTGAAGGGA, as shown in SEQ ID No. 14) were designed for PCR amplification. Cas9 T0 generation positive transgenic plants were screened (the size of the PCR amplification product of positive plants is 356 bp), sequenced, and the mutated lines were screened. The T0 generation was self-pollinated to obtain the T1 generation, and the T1 generation was self-pollinated to obtain the T2 generation. The T2 generation plants were screened again to screen out independent lines without the vector and homozygous mutants, as Figure 1 shown. Finally, two mutants were obtained, named OsTCP2-1 and OsTCP2-2 respectively. Two types of mutations occurred at the target site. OsTCP2-1 had a 19-base deletion (-CGGAGCGGCGCACATAGTG, as shown in SEQ ID No. 15) at this position, and the nucleotide sequence after mutation was as shown in SEQ ID No. 2. OsTCP2-2 also had a 1-base deletion (--A) at the same position, and the nucleotide sequence after mutation was as shown in SEQ ID No. 3.

[0047] Test Example

[0048] Analysis of the heading date of mutants and wild-type plants

[0049] After germinating wild-type (Nipponbare) and ostcp2 mutant seeds, they were sown in the field (Fuyang, Hangzhou) during the regular growing season with normal fertilizer and water management. When ostcp2-1 and ostcp2-2 headed, the heading dates of each wild-type and ostcp2 mutant were counted. The results showed that under long-day conditions, compared with the wild-type, all ostcp2 mutants showed an obvious early heading phenomenon, and the heading date of the ostcp2 mutants was about 8 days earlier than that of the wild-type on average (as Figure 2 shown).

[0050] As can be seen from the above examples and test examples, the implementation of the present invention provides the OsTCP2 gene and its mutants as new gene resources for regulating the heading date of rice. By knocking out the OsTCP2 gene, the heading date of rice was significantly advanced, providing a powerful tool for molecular breeding, helping to rapidly improve rice varieties, enhance their adaptability and yield in different regions, and further optimize agricultural management and improve rice production efficiency, which is of great significance for ensuring sustainable agricultural development and promoting related scientific research.

[0051] The above are only a limited number of preferred embodiments of the present invention, and the description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. Application of rice gene OsTCP2 or its mutant in regulating rice heading period, characterized in that: The application includes overexpressing the rice gene OsTCP2 or knocking out the rice gene OsTCP2, thereby correspondingly delaying or advancing the heading period of rice.

2. The use according to claim 1, characterized in that: The OsTCP2 or its mutant has a nucleotide sequence shown in any one of (a) to (c): (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a mutant having the same function as the nucleotide sequence shown in SEQ ID No. 1 after one or more bases are substituted and / or deleted and / or added; (c) A mutant having a similarity of more than 88% to the nucleotide sequence shown in SEQ ID No. 1 and having the same function.

3. The use according to claim 1, characterized in that: The nucleotide sequence of the OsTCP2 mutant is the nucleotide sequence shown in SEQ ID No.2 or SEQ ID No.

3.

4. A biological material comprising an sgRNA sequence capable of targeted knockout of the OsTCP2 gene, characterized in that: The biological material includes any one of (a) to (c): (a) expression cassette; (b) a recombinant vector; (c) recombinant prokaryotic cells; The sgRNA sequence is shown as SEQ ID No.

10.

5. The biomaterial according to claim 4, characterized in that The recombinant vector uses plasmid pCAMBIA1300 as the vector.

6. The biomaterial according to claim 4, characterized in that The recombinant prokaryotic cell uses Agrobacterium as a host cell.

7. The biomaterial according to claim 4, characterized in that The Agrobacterium is EHA105.

8. A method for regulating the heading period of rice, characterized in that: Plant tissues are transfected with the biological material as claimed in claim 4, and plants having the OsTCP2 mutant gene are obtained through screening.

9. The method according to claim 8, characterized in that The variety of rice is Nipponbare.

10. A protein edited by OsTCP2 or a mutant thereof, characterized in that It has an amino acid sequence as shown in SEQ ID No.5 or SEQ ID No.6.

Images