Application of Wheat Receptor-like Kinase TaSRK1 in Improving Wheat Disease Resistance
By silencing or knocking out the wheat receptor kinase gene TaSRK1, the resistance of wheat to stripe rust bacteria is enhanced, and the problem of easy loss of resistance in wheat varieties is solved, and rapid and efficient improvement of disease-resistant varieties is achieved.
Patent Information
- Application Number
- CN202510533765.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-27
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-04-27
AI Technical Summary
When existing wheat varieties face the infection of striped rust bacteria, their resistance is easily affected by new variant species, making it difficult to continuously and effectively prevent and control.
By silencing, reducing or knocking out the wheat receptor kinase gene TaSRK1 in wheat, the resistance of wheat to strip rust is enhanced and the pathogenicity or growth and development ability of strip rust bacteria is reduced.
Significantly improve the resistance of wheat to stripe rust bacteria, inhibit the mycelial length and infection area of stripe rust bacteria, provide excellent materials for disease-resistant varieties, break through interspecies reproductive isolation, and achieve rapid directional improvement.
Smart Images

Figure CN120060353B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering and relates to the application of wheat receptor-like kinase TaSRK1 in improving wheat disease resistance. Background Art
[0002] During the planting process of wheat, various pathogens can infect wheat and cause diseases. Wheat stripe rust fungus ( Puccinia striiformis. f. sp. tritici , Pst ) is one of the most threatening pathogenic fungi. Research and production practices have shown that in addition to reasonable control measures and the rational use of pesticides, cultivating and promoting disease-resistant wheat varieties is the most economical, effective, green and environmentally friendly prevention and control measure; however, disease-resistant varieties are easily affected by newly mutated races and lose their resistance to stripe rust. Therefore, the excavation of genes related to wheat stripe rust resistance, the research on the disease resistance mechanism, and the breeding of disease-resistant varieties are crucial for the prevention and control of wheat stripe rust. Summary of the Invention
[0003] During the process of pathogen infection, a large number of signaling molecules such as pathogen- or microbe-associated molecular patterns (P / MAMPs) and damage-associated molecular patterns (DAMPs) are released. Pattern recognition receptors (PRRs) located on the plasma membrane of plants often perceive these signaling molecules, activate immunity, and confer resistance of the host to pathogens. PRRs are plasma membrane-localized receptor kinases (RKs) or receptor-like proteins (RLPs). PRRs usually perceive pathogen- or microbe-associated molecular patterns and damage-associated molecular patterns, which are host-derived molecules released during pathogen attack or cell damage. However, specific patterns / epitopes recognized as PAMPs among other conserved molecules are under selective pressure and are more polymorphic than previously thought. The perception of DAMPs, in addition to non-self surveillance achieved by PAMP recognition, also allows plant cells to indirectly monitor a more diverse range of pathogens and expand the responses triggered only by PAMP perception. The purpose of the present invention is to provide the application of wheat receptor-like kinase TaSRK1 in improving wheat disease resistance, aiming to enrich the understanding of those skilled in the art about the role played by wheat receptor-like kinases during the process of stripe rust fungus infecting wheat plants, and to provide a theoretical basis and gene selection for breeding and creating excellent disease-resistant germplasm materials.
[0004] To understand the technical solution of the present invention completely and without objection, it should be supplemented that the wheat receptor-like kinase protein of the present invention is represented by the non-italic font "TaSRK1", and the wheat receptor-like kinase gene is represented by the italic font " TaSRK1 ". Of course, those of ordinary skill in the art can clearly and completely understand the meanings and expressions of the relevant genes and their encoded proteins according to the description of the present invention.
[0005] On the one hand, the present invention relates to the application of the wheat receptor-like kinase gene TaSRK1 in improving the disease resistance of wheat. The wheat receptor-like kinase gene TaSRK1 encodes the wheat receptor-like kinase protein TaSRK1, and the amino acid sequence of the wheat receptor-like kinase protein TaSRK1 is shown in SEQ ID NO: 1;
[0006] Silencing, reducing or knocking out the wheat receptor-like kinase gene TaSRK1 enhances the resistance of wheat to stripe rust.
[0007] SEQ ID NO: 1 is specifically shown as follows,
[0008] MMTRVVTLLALLPLISLDLLPLRCCAGAASVAHTLRAGSSLSVEDHGLPFLVSPDATFSCGFLPAGDNAFYFSVWFTAAKNRTAVWTANPGAPVNGRISRISFGAEGKLALVDADGTSVWDSKTGGNKQLTISLLDTGNLLVADPSTGRAPVWQSFDWPTDTLLPSQTLSKNKKLVAGYYALYYDSDNVLRLLYDGPEIASTYWPDRDIGVFGSGRTNYNTSRIGVLDDTGVFLSSDKLRVEASDLGAAGVKRRLTIEQDGNVRMYSLDAAGGWTVTWAAMKQPCSVHGLCGKNGVCEYQPSLRCSCAPGHEMVDRHDWRKGCQPMFSTATNCSASEQQRFAFVEVASTEFYGYDLGYNSSVTLEDCKSICLSMCSCVAFSYKMNGLGQCLPKGVLFNGYTSPTSPESIYLKVPGELNASAPPPPPEGLVCNHNGSAGGATIVPPPQYWSYFFAIAAVLGFLELLFIATAWWFLSRQNSAIPSSMEAGYRLGMGTHFKRFTYRELKNATGNFNEELGHGGSGVVYRGVLDKTTVVAVKKLTNVVQADEEFWAEMAVFGRINHINLVRIWGFCLEGKHRLLVYEYVENESLDRHLFGQDDIDKALAWSERFKIALGAARGLAYLHHECLEWVIHCDVKPENILLTRDLDPKISDFGLAKLSGRNDVSNGVQLSHMRGTAGYMAPEWALGLPVDAKVDVYSYGIVLLEMVIGSRISDQTTADGGERLEMRQITQALKQVVASGSIVSLVDRRLNGQFNPRQAMEMVKISLSCMEERTNRPTMNDICKALTACDYEDEHPAYLA。
[0009] Furthermore, in the application provided by the present invention, the wheat receptor-like kinase gene TaSRK1 has a nucleotide sequence as shown in SEQ ID NO: 2.
[0010] SEQ ID NO: 2 is specifically as follows,
[0011]
[0012] Further, in the application provided by the present invention, silencing, reducing or knocking out the wheat receptor-like kinase gene TaSRK1 , enhances the resistance of wheat to stripe rust.
[0013] Further, in the application provided by the present invention, silencing, reducing or knocking out the wheat receptor-like kinase gene TaSRK1 , reduces the pathogenicity or growth and development ability of stripe rust.
[0014] Further, in the application provided by the present invention, the reduction of the pathogenicity or growth and development ability of stripe rust is the reduction of the hyphal length of stripe rust and / or the infection area of stripe rust on wheat.
[0015] On the other hand, the present invention relates to a method for cultivating wheat varieties resistant to rust, which silences, reduces or knocks out the wheat receptor-like kinase gene in wheat TaSRK1 , and the wheat receptor-like kinase gene TaSRK1 encodes a wheat receptor-like kinase protein TaSRK1, and the amino acid sequence of the wheat receptor-like kinase protein TaSRK1 is shown in SEQ ID NO: 1.
[0016] Further, in the method for cultivating wheat varieties resistant to rust provided by the present invention, the nucleotide sequence of the wheat receptor-like kinase gene TaSRK1 is shown in SEQ ID NO: 2.
[0017] Those of ordinary skill in the art can easily use known methods, such as directed evolution and point mutation methods, to mutate the nucleotide sequence of the wheat receptor-like kinase protein TaSRK1 encoded by the present invention. Those artificially modified nucleotide sequences having 75% or higher identity with the nucleotide sequence of the wheat receptor-like kinase gene isolated from the present invention TaSRK1 , as long as they encode the wheat receptor-like kinase protein TaSRK1 and have the same function, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.
[0018] The term "identity" used herein refers to the sequence similarity with the natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 of the present invention. Identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0019] The above identity of 75% or more can be an identity of 80%, 85%, 90% or more than 95%.
[0020] The present invention silences, reduces or knocks out the wheat receptor-like kinase gene TaSRK1 for the purpose of reducing the activity and / or expression level of the wheat receptor-like kinase protein TaSRK1 in wheat. Those skilled in the art can achieve the purpose of reducing the activity and / or expression level of the wheat receptor-like kinase protein TaSRK1 in wheat by methods well known in the art such as VIGS, RNA interference, homologous recombination, gene site-directed editing, etc.
[0021] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:
[0022] The present invention verifies the expression profile of the wheat receptor-like kinase gene TaSRK1 under the infection of stripe rust pathogen, and obtains that the TaSRK1 is induced to express by the infection of wheat stripe rust pathogen. TaSRK1 has a negative regulatory role in the immune response of wheat against stripe rust. Overexpression of the wheat receptor-like kinase gene TaSRK1 reduces the resistance of wheat to stripe rust pathogen.
[0023] The present invention analyzes the area and burst situation of reactive oxygen species around the infection point after the knockout wheat plants are infected by stripe rust fungus, and finds that the area of reactive oxygen species accumulation in the knockout wheat receptor-like kinase gene TaSRK1 plants is significantly higher than that of the wild type, indicating that the knockout TaSRK1 enhances the disease resistance of wheat. TaSRK1 The hyphal length and infection area of stripe rust fungus in the knockout plants are significantly lower than those of the control Fielder, indicating that the growth and development of stripe rust fungus in the transgenic wheat with the wheat receptor-like kinase gene TaSRK1 knocked out are inhibited and the pathogenicity is significantly weakened; in addition, the present invention analyzes the area and burst situation of reactive oxygen species around the infection point after the overexpressed wheat plants are infected by stripe rust fungus, and finds that the area of reactive oxygen species accumulation in the overexpressed wheat receptor-like kinase gene TaSRK1 plants is significantly lower than that of the wild type, indicating that overexpression of the wheat receptor-like kinase gene TaSRK1 reduces the disease resistance of wheat. The hyphal length and infection area of stripe rust fungus in the overexpressed wheat receptor-like kinase gene TaSRK1 plants are significantly higher than those of the control Fielder, indicating that the growth and development of stripe rust fungus in the transgenic wheat with the wheat receptor-like kinase gene TaSRK1 overexpressed are promoted and the pathogenicity is significantly enhanced.
[0024] The present invention silences, reduces or knocks out the wheat receptor-like kinase gene in wheat TaSRK1Transgenic wheat resistant to stripe rust shows obvious resistance to stripe rust. Therefore, this wheat receptor-like kinase gene can be used to create rust-resistant lines, providing excellent wheat materials for the cultivation of stripe rust-resistant varieties. Compared with traditional disease-resistant breeding techniques, plant disease-resistant genetic engineering techniques can break through the reproductive isolation between species and the incompatibility of distant hybridization, and achieve the directional improvement of target traits in a relatively short time, providing more comprehensive, continuous and broad-spectrum protection for crops. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings. Among them, TaSRK1-KO represents the knockout plants of TaSRK1, and TaSRK1-OE represents the overexpression plants of TaSRK1.
[0026] Figure 1 It is a schematic diagram of the expression profile analysis of the wheat receptor-like kinase gene TaSRK1 . Among them, compared with the infection time of 0 h, * indicates P <0.05, ** indicates P <0.01.
[0027] Figure 2 It is a knockout wheat plant TaSRK1 with stable inheritance of the wheat receptor-like kinase gene tasrk1 -ko#L11, L38, L55 and the phenotype identification results of Fielder inoculated with the physiological race CYR32 of stripe rust after 14 days.
[0028] Figure 3 It is a diagram of the burst situation and area statistics of reactive oxygen species around the infection site of the wheat receptor-like kinase gene TaSRK1 knockout plants after being infected with stripe rust. Among them, SV represents the substomatal cavity; H2O2 represents reactive oxygen species.
[0029] Figure 4 It is a statistical chart of the infection area of stripe rust hyphae in the wheat receptor-like kinase gene TaSRK1 knockout plants after being infected with stripe rust.
[0030] Figure 5 It is a diagram of the phenotype identification results of the overexpression wheat plants L2, L5, L36 and Fielder inoculated with the rust physiological race CYR23 after 14 days of the wheat receptor-like kinase gene TaSRK1 . DETAILED DESCRIPTION OF THE INVENTION
[0031] Next, the technical solutions of the present invention will be described in conjunction with the embodiments. However, the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified. The percentages in the following embodiments are mass percentages unless otherwise specified.
[0032] Example 1
[0033] This example provides the acquisition of a wheat receptor-like kinase gene TaSRK1 .
[0034] Full-length primers for the wheat receptor-like kinase gene TaSRK1 were designed. The primers included a forward primer ( TaSRK1 -FATGATGACTAGAGTCGTTACTCTT) and a reverse primer ( TaSRK1 -R TGCCAAGTAGGCAGGGT). Using the cDNA of wheat Fielder (provided by Northwest A&F University) plants as a template, the wheat receptor-like kinase gene TaSRK1 was amplified and sequenced, and the nucleotide sequence of wheat TaSRK1 was shown as SEQ ID NO: 2.
[0035] Example 2
[0036] This example describes the expression profile analysis of the wheat receptor-like kinase gene TaSRK1 .
[0037] Based on Example 1, real-time fluorescence quantitative PCR technology was used to analyze the expression profile of the wheat receptor-like kinase gene TaSRK1 under the infection of stripe rust.
[0038] Using the cDNA of the interaction between wheat and stripe rust at different time points (0, 6, 12, 24, 48, and 72 h) as a template, and the wheat elongation factor gene as an internal reference gene ( TaEF1 -F: 5’-TGGTGTCATCAAGCCTGGTATGGT-3’ and TaEF1 -R: 5'-ACTCATGGTGCATCTCAACGGACT-3'), specific fragment quantitative primers for the wheat receptor-like kinase gene TaSRK1 ( TaSRK1 -qRT-F: 5'-GATGCCAACCGATGTTCAGC-3' and TaSRK1 -qRT-R: 5'-GGTCGTAGCCGTAGAACTCAGTG-3') were used for real-time fluorescence quantitative PCR. Among them Figure 1CYR23 is an avirulent race of stripe rust, and CYR32 is a virulent race of stripe rust.
[0039] Wheat receptor-like kinase gene TaSRK1 The expression levels at different infection times of wheat by stripe rust are as Figure 1 shown. The reaction conditions are as follows: pre-denaturation at 95°C for 1 min; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; and finally full extension at 72°C for 10 min.
[0040] Example 3
[0041] This example provides the cultivation and disease resistance identification of wheat receptor-like kinase gene TaSRK1 overexpressing plants.
[0042] The wheat receptor-like kinase gene TaSRK1 was constructed into the plant transgenic expression vector PANIC6E, and the TaSRK1 -OE transgenic overexpressing plants were obtained through genetic transformation mediated by Agrobacterium infection. Then, the DNA of the transgenic overexpressing plants was extracted, and PCR transgenic positive detection was performed using the universal detection primers of PANIC6E. Three lines, L2, L5, and L36 of the T1 generation, were selected and inoculated with the main prevalent race CYR23 of stripe rust. TaSRK1 The transgenic overexpressing plants showed weakened resistance to stripe rust, increased spore numbers, and reduced reactive oxygen species area.
[0043] Example 4
[0044] This example provides the cultivation and disease resistance identification of wheat receptor-like kinase gene TaSRK1 knockout plants. The cultivation steps of the wheat receptor-like kinase gene TaSRK1 knockout plants are as follows:
[0045] First step, gene editing target design: According to the genomic sequence of the wheat TaSRK1 gene and the target design requirements of the CRISPR-Cas9 technology, 2 specific gRNAs targeting the wheat TaSRK1 gene were designed.
[0046] Second step, the gRNAs were tandemly constructed onto the gene editing vector VK005 through an in vitro taco bridge method and transformed into the Agrobacterium strain EHA105.
[0047] Third step, Agrobacterium-mediated genetic transformation of wheat callus: The CRSPR-Cas9-gRNAs Agrobacterium transformant constructed in the second step was used to infect and transform the immature embryos of the receptor variety Fielder, and the transgenic targeted edited wheat TaSRK1plants with the gene, and identified positive plants through resistance screening and PCR detection;
[0048] In the fourth step, the offspring of transgenic positive plants were detected and sequenced, and TaSRK1- mutant plants successfully edited on the B copy were obtained.
[0049] Collect wheat leaves at different time points (24, 48 h) after inoculating with the physiological race CYR32 of stripe rust. Cut the leaves into small segments, place the upper morphological ends upward into centrifuge tubes containing DAB staining solution, place them under strong light for 4 h, then take out the leaves and soak them in the decolorizing solution. Replace the decolorizing solution every 24 h until the leaves are transparent. Soak the decolorized and transparent wheat leaves in chloral hydrate solution, fix them for 24 h, and then store them with 30% glycerol. Observe and count the area of reactive oxygen species near the infection sites in the leaf tissue under bright field using an Olympus fluorescence microscope ( Figure 3 ), and use the presence of substomatal vesicles as the basis for determining infection sites.
[0050] Stain the decolorized and transparent wheat leaves with wheat germ agglutinin WGA (Wheat germ agglutin, which can specifically bind to the small molecule glycoprotein on the chitin of the fungal cell wall. Stain the infected leaves with WGA conjugated with fluorescein, and clear hyphal structures can be observed under fluorescence), and then observe the hyphal structures of stripe rust and count the hyphal length and infection area under the GFP fluorescence channel of an Olympus fluorescence microscope ( Figure 4 ). The hyphal length is counted as the distance from the tip of the longest hypha to the tip of the substomatal vesicle. For each tissue sample, 30 - 50 infection sites are counted, repeated three times, and a significant difference analysis is performed on the statistical data.
[0051] As can be seen from Figure 3 , the area of reactive oxygen species accumulation in the knockout plants of the wheat receptor-like kinase gene TaSRK1 is significantly higher than that of the wild type, indicating that silencing the wheat receptor-like kinase gene TaSRK1 enhances the disease resistance of wheat. As can be seen from Figure 4 , the hyphal length and infection area of stripe rust in the knockout plants of the wheat receptor-like kinase gene TaSRK1 are both significantly lower than those of the control Fielder, indicating that the growth and development of stripe rust in the transgenic wheat with the knockout of the wheat receptor-like kinase gene TaSRK1 are inhibited, and the disease resistance is significantly weakened.
[0052] Example 5
[0053] This example provides the identification of the disease resistance of overexpression plants of the wheat receptor-like kinase gene TaSRK1 .
[0054] Selected the wheat receptor-like kinase geneTaSRK1 For three lines, namely L2, L5 and L36, of the T1 generation of the overexpression material, inoculate with the main prevalent race CYR23 of stripe rust fungus, keep it moisturized in the dark for 24 h and then place it under light, and observe the phenotype after 14 days. From Figure 5 It can be seen that compared with the wild type Fielder, the wheat receptor-like kinase gene TaSRK1 Overexpressing plants produce more spores. Extract the DNA from the inoculated part of the leaves of the overexpression material with stripe rust fungus, dilute it to 400 ng / μL, and use it as a template, with the internal reference gene of stripe rust fungus (PstEF-F: 5'-TTCGCCGTCCGTGATATGAGACAA-3'; PstEF-R: 5'-ATGCGTATCATGGTGGTGGAGTGA-3), and the internal reference gene of wheat (TaEF-F: 5'-TGGTGTCATCAAGCCTGGTATGGT-3'; PstEF-R: 5'-ACTCATGGTGCATCTCAACGGACT-3) quantitative primers, and detect the relative biomass of stripe rust fungus in wheat leaves by qRT-PCR. This is used to prove that the wheat receptor-like kinase gene TaSRK1 Transgenic overexpressing plants show weakened resistance to stripe rust fungus.
[0055] As described above, the basic principle, main features and advantages of the present invention are preferably described. The above embodiments and the description are only descriptions of the preferred embodiments of the present invention. The present invention is not limited by the above embodiments. Without departing from the spirit and scope of the present invention, various changes and improvements made by those of ordinary skill in the art to the technical solution of the present invention shall fall within the protection scope determined by the present invention.
Claims
1. Application of wheat receptor kinase gene TaSRK1 in improving wheat disease resistance, characterized in that The said TaSRK1 encodes an S-locus class wheat receptor-like kinase protein, the amino acid sequence of which is shown in SEQ ID NO: 1; Knock out the wheat receptor-like kinase gene TaSRK1 to enhance the resistance of wheat to stripe rust.
2. The application according to claim 1, characterized in that, The wheat receptor-like kinase gene TaSRK1 has a nucleotide sequence as shown in SEQ ID NO:
2.
3. The application according to claim 1, characterized in that, Knock out the wheat receptor-like kinase gene TaSRK1 , enhancing the resistance of wheat to stripe rust 4. The application according to claim 1, characterized in that Knock out the wheat receptor-like kinase gene TaSRK1 , reducing the pathogenicity or the ability of growth and development of stripe rust 5. The application according to claim 4, wherein The ability to reduce the pathogenicity or growth and development of stripe rust fungi is to reduce the hyphal length of stripe rust fungi and / or the infection area of stripe rust fungi on wheat.
6. A method for cultivating a wheat variety resistant to rust, characterized in that, Knockout of the wheat receptor-like kinase gene in wheat TaSRK1 , the wheat receptor-like kinase gene TaSRK1 encodes the wheat receptor-like kinase protein TaSRK1, and the amino acid sequence of the wheat receptor-like kinase protein TaSRK1 is shown in SEQ ID NO:
1.
7. The cultivation method of the wheat variety resistant to rust according to claim 6, characterized in that, The wheat receptor-like kinase gene TaSRK1 has a nucleotide sequence as shown in SEQ ID NO: 2.
Citation Information
Patent Citations
Wheat receptor-like protein kinase gene TaLEMK1.1 and application thereof
CN114621967A
Use of YR4DS gene of aegilops tauschii in stripe rust resistance breeding of triticeae plants
US20210403936A1