Application of cassava mosaic virus AC2 in inhibiting degradation of mRNA decay substrate

The interaction between AC2 and DCP1 and DCP2 downregulates DCP1 expression and inhibits the degradation of mRNA decay substrates, solving the problem of difficult inhibition of the degradation of mRNA decay substrates in the prior art, and achieving the effect of improving the pathogenicity of the virus.

CN120060355AActive Publication Date: 2025-05-30SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1

Patent Information

Application Number
CN202510556967.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-05-30
Estimated Expiration
2045-04-29

AI Technical Summary

Technical Problem

The prior art is difficult to effectively inhibit the degradation of mRNA decay substrate by cassava mosaic virus AC2, affecting the pathogenicity of the virus and host defense mechanism.

Method used

Through research, AC2 interacts with DCP1 and DCP2 in Arabidopsis and downregulates DCP1 expression, inhibits the degradation of unsense-mediated mRNA decay substrates, and achieves protection of mRNA.

Benefits of technology

AC2 can effectively inhibit the degradation of mRNA decay substrates, increase the expression of specific mRNAs, enhance the pathogenicity of the virus, and not affect the phenotype of transgenic plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060355A_ABST
    Figure CN120060355A_ABST
Patent Text Reader

Abstract

The invention provides an application of an AC2 gene and the like in improving the expression quantity of GFP (Green Fluorescent Protein) and / or inhibiting degradation of an mRNA (Messenger Ribonucleic Acid) attenuated substrate taking the GFP as a reporter gene. Researches find that AC2 has an mRNA decay inhibition function, can inhibit degradation of a nonsense-mediated mRNA decay substrate taking GFP as a reporter gene and degradation of an endogenous nonsense-mediated mRNA decay substrate of arabidopsis thaliana, can improve the expression quantity of mRNA of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730 and the like, can reduce the expression quantity of AT1G72450 and AT2G400, has interaction with Dcp1 and Dcp2, and can be used for inhibiting the expression quantity of mRNA of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G6430, AT1G36730 and the like. The growth ability of the yeast in an auxotroph culture medium can be improved, the expression level of Dcp1 can be reduced, and a research result lays a foundation for clarification of AC2 functions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of cassava mosaic virus AC2 in inhibiting the degradation of mRNA decay substrates. Background Art

[0002] mRNA decay plays an important role in resisting virus invasion as a highly conserved self-protection mechanism (Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023, 16(3):632-642.; Wu J, Zhang Y, Li F, Zhang X, Ye J, Wei T, Li Z, Tao X, Cui F, Wang X, Zhang L, Yan F, Li S, Liu Y, Li D, Zhou X, Li Y. Plant virology in the 21st century in China: Recent advances and future directions. J Integr Plant Biol. 2023a, doi: 10.1111 / jipb.13580.). mRNA decay includes pathways such as nonsense-mediated mRNA decay (NMD), Staufen1-mediated mRNA decay (SMD), and structure-mediated RNA decay (SRD). Upstream frameshift 1 (UPF1) is a key component of the three mRNA decay pathways (Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023, 16(3):632-642.).Research has found that NMD, SMD, and SRD are all involved in antiviral defense (May JP, Simon AE. Targeting of viral RNAs by Upf1-mediated RNA decay pathways. Curr Opin Virol. 2021, 47:1-8.; Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023, 16(3):632-642.). Among them, NMD plays an important regulatory role in gene expression, growth and development, and stress defense responses in organisms by rapidly degrading unstable and defective mRNAs to achieve the regulation of mRNA quantity and quality control. Viruses are obligate parasites that have evolved to evade or tolerate various host immune defense mechanisms during the interaction with hosts to achieve infection. Exploring the various immune defense mechanisms by which different viruses evade or tolerate hosts has become the research forefront and hotspot in this field (Sun H, Jing X, Wang C, Wang P, Huang Z, Sun B, Li P, Li H, Zhang C. The Great Game between Plants and Viruses: A Focus on Protein Homeostasis. Int J Mol Sci. 2023, 24(16):12582.). The research results not only have important theoretical value but also provide new technologies for the green prevention and control of viral diseases.

[0003] Cassava mosaic disease (CMD) caused by cassava mosaic geminivirus (CMVs) poses a serious threat to the development of the cassava industry and food security in China. CMD was first reported in Hainan and Fujian in China in 2018, and subsequent reports have been found in other planting areas (Wang et al., 2018). Therefore, it is urgent to carry out basic research on antiviral breeding. Sri Lankan cassava mosaic virus ( Sri Lankan cassava mosaic virus, SLCMV) is a strain of cassava mosaic virus and belongs to the genus Begomovirus in the family Geminiviridae. It is a typical bipartite single-stranded DNA virus, and its genome consists of two circular components, DNA-A and DNA-B. The DNA-A component encodes two proteins, AV1 and AV2, on the sense strand, and four proteins, AC1, AC2, AC3, and AC4, on the antisense strand; the DNA-B component encodes BV1 and BC1 (Patil et al., 2009; Chen et al., 2019).

[0004] Viruses have extremely small genomes, so most of the encoded proteins are multifunctional proteins. AC2 is not only a transcriptional activator of SLCMV but also a viral silencing suppressor, which can inhibit host PTGS and enhance viral pathogenicity (Vanitharaniet al., 2004; Chen et al., 2019). Whether AC2 has other functions has not been reported and remains to be studied. Summary of the Invention

[0005] The object of the present invention is to overcome the deficiencies in the prior art and provide the application of cassava mosaic virus AC2 in inhibiting the degradation of mRNA decay substrates. The present invention finds that AC2 interacts with DCP1 and DCP2 that form Processing-bodies in Arabidopsis thaliana, down-regulates the expression of DCP1, and inhibits the degradation of GFP reporter gene-mediated nonsense-mediated mRNA decay substrates and Arabidopsis thaliana endogenous nonsense-mediated mRNA decay (NMD) substrates, indicating that AC2 has the function of inhibiting mRNA decay.

[0006] The first aspect of the present invention is to provide the application of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacterium containing the coding region of the AC2 gene in increasing the GFP expression level and / or inhibiting the degradation of mRNA decay substrates using GFP as a reporter gene; wherein, the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO:1.

[0007] The second aspect of the present invention is to provide the application of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacterium containing the coding region of the AC2 gene in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana; wherein, the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO:1; or the application of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacterium containing the coding region of the AC2 gene in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana without affecting the phenotype of transgenic Arabidopsis thaliana; wherein, the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO:1.

[0008] Wherein, the target transcripts of endogenous nonsense-mediated mRNA decay in Arabidopsis thaliana are the mRNAs of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570.

[0009] The third aspect of the present invention is to provide the application of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacterium containing the coding region of the AC2 gene in regulating the mRNA expression levels of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein, the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO:1; or the application of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacterium containing the coding region of the AC2 gene in regulating the mRNA expression levels of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400 without affecting the phenotype of transgenic Arabidopsis thaliana; wherein, the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO:1.

[0010] Wherein, the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacterium containing the coding region of the AC2 gene increases the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, AT5G22570.

[0011] Among them, the AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacterium containing the coding region of the AC2 gene reduces the expression levels of AT1G72450 and AT2G400.

[0012] The fourth aspect of the present invention is to provide the use of the AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacterium containing the coding region of the AC2 gene in reducing the expression level of DCP1; wherein, the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO:1, and the nucleotide sequence of the gene corresponding to DCP1 is as shown in SEQ ID NO:2.

[0013] The fifth aspect of the present invention is to provide the use of the AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacterium containing the coding region of the AC2 gene in the interaction with DCP1 and / or DCP2; wherein, the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO:1, the nucleotide sequence of the gene corresponding to DCP1 is as shown in SEQ ID NO:2; the nucleotide sequence of the gene corresponding to DCP2 is as shown in SEQ ID NO:3.

[0014] Among them, the interaction between AC2 and DCP1 or DCP2 improves the growth ability of yeast in the SD / -Ade / -His / -Leu / -Trp auxotrophic medium containing the self-activation inhibitor 3-AT.

[0015] Among them, the interaction between AC2 and DCP1 reduces the expression level of DCP1.

[0016] The research of the present invention finds that AC2 has the function of inhibiting mRNA decay, can inhibit the degradation of the nonsense-mediated mRNA decay substrate with GFP as the reporter gene and the degradation of the endogenous nonsense-mediated mRNA decay (NMD) substrate in Arabidopsis thaliana, can increase the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, AT5G22570, reduce the expression levels of AT1G72450 and AT2G400, has an interaction with DCP1 and DCP2, can improve the growth ability of yeast in the SD / -Ade / -His / -Leu / -Trp auxotrophic medium or the SD / -Ade / -His / -Leu / -Trp auxotrophic medium containing the self-activation inhibitor 3-AT, and can reduce the expression level of DCP1. The research results will lay a foundation for clarifying the function of AC2. Description of the Drawings

[0017] Figure 1AC2 interacts with host UPF1, DCP1, and DCP2 intracellularly. Results of yeast two-hybrid assays of AC2 with Arabidopsis PARN, UPF1, DCP1, and DCP2.

[0018] Figure 2 Confocal microscopy observations of GFP fluorescence results after co-infiltration of Nicotiana benthamiana leaves at 5 dpa with the vector DCP1-GFP and the empty vector pF1300 (EV) or p1300-AC2-Flag (AC2).

[0019] Figure 3 Western Blot detection of the accumulation level of GFP protein after co-infiltration of Nicotiana benthamiana leaves at 5 dpa with the vector DCP1-GFP and the empty vector Vec or p1300-AC2-Flag (AC2). DCP1-GFP: Plant expression vector expressing the DCP1-GFP fusion protein; Vec: Empty vector; AC2: Plant expression vector p1300-AC2-Flag expressing AC2-Flag; GFP: GFP antibody; Rubisco: Rubisco stained with Coomassie Brilliant Blue.

[0020] Figure 4 Schematic diagram of injection of Nicotiana benthamiana leaves. Reporter is the expression vector pG1300abc or pG1300; Vec is the empty vector pF1300; AC2 is p1300-AC2-Flag; P19 is the expression vector pZP-p19.

[0021] Figure 5 Effect of AC2 on GFP expression at the transcriptional level. GFP expression in Nicotiana benthamiana leaves after injection with equal volumes of different GFP reporter vectors, the expression vectors pG1300abc or pG1300, respectively, mixed with the empty vector pF1300 or p1300-AC2-Flag and pZP-p19. Vec is the empty vector pF1300; AC2 is p1300-AC2-Flag; P19 is the expression vector pZP-p19.

[0022] Figure 6 Quantitative fluorescence PCR analysis of known NMD target transcripts (a) premature termination codon genes (PTC: AT1G01060, RPS6, and SMG7) (b) upstream open reading frame genes (uORFs: AT5G35490, AT5G64430, and ATG36730) (c) unknown NMD target genes (AT4G13900, AT5G22570) (d) ARE target genes rich in AU-unstable elements (AT1G72450, AT2G4000). Detailed implementation

[0023] The present invention will be further described below with reference to the accompanying drawings and in conjunction with specific embodiments to better understand the present invention. For those technologies or conditions not specified in the embodiments, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For the reagents or instruments whose manufacturers are not indicated, they are all conventional products that can be obtained through commercial purchase.

[0024] 1 Plant materials Wild-type Nicotiana benthamiana N. benthamiana and Arabidopsis thaliana A. thaliana .

[0025] 2 Experimental methods and results

[0026] 2.1 Construction of plant expression vectors (1) pG1300abc vector The target fragment abc-SacI & SacI (the specific sequence is shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd. After the target fragment was digested with SacI alone, it was ligated to pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) digested with the same single enzyme. The ligation product was transformed into Escherichia coli, and the positive clones identified by sequencing as being inserted in the forward direction were named pG1300abc.

[0027] (2) AD-DCP1, AD-DCP2 and AD-UPF1 vectors Using primers DCP1-1F SfiI and DCP1-1104R BamHI, DCP2-1F SfiI and DCP2-1161R BamH, and Upf1-1F SfiI and Upf1-3765R BamHI (the specific sequences are shown in Table 1) respectively, DCP1 (SEQ ID NO:2), DCP2 (SEQ ID NO:3) and UPF1 were amplified using Arabidopsis cDNA as a template. The PCR amplification system was 1 μL of each primer (10 μmol / L), 10 μL of 2*Magic Green Taq SuperMix, and ddH 2O was supplemented to 20 μL. The amplification program was pre-denaturation at 94°C for 5 min, then denaturation at 94°C for 60 s, annealing at 56°C for 30 s, extension at 72°C for 90 s, with 35 cycles, and finally thorough extension at 72°C for 10 min. The amplified product was double-digested with SfiI and BamHI and then ligated to the large fragment of the yeast expression vector pGADT7 recovered by the same double digestion. The ligation product was transformed into Escherichia coli. After the positive clones were identified as correct by PCR and sequencing, they were named AD-DCP1, AD-DCP2, and AD-UPF1.

[0028] (3)DCP1-GFP vector Using AD-DCP1 as a template, DCP1 was amplified with DCP1-1F MluI and DCP1-1104R KpnI (the specific sequences are shown in Table 1). The PCR amplification system was 1 μL of each primer (10 μmol / L), 10 μL of 2*Magic Green Taq SuperMix, and ddH 2 O was supplemented to 20 μL. The amplification program was pre-denaturation at 94°C for 5 min, then denaturation at 94°C for 60 s, annealing at 56°C for 30 s, extension at 72°C for 90 s, with 35 cycles, and finally thorough extension at 72°C for 10 min. The amplified product was double-digested with MluI and KpnI and then ligated to the large fragment of the plant expression vector pG1300 recovered by the same double digestion. The ligation product was transformed into Escherichia coli. After the positive clones were identified as correct by PCR and sequencing, they were named DCP1-GFP.

[0029] (4)p1300-AC2-Flag Referring to the reported SLCMV sequence (GenBank: KT861468.1), the synthetic biology company Shanghai Sangon Biotech Co., Ltd. was commissioned to artificially synthesize the target fragment AC2-SpeI & KpnI (the specific sequences are shown in Table 2). The synthetic fragment and the pF1300 vector (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology , 116 (3),744–755.) were both double-digested with SpeI and KpnI and then ligated. The ligation product was transformed into Escherichia coli. After the positive clones were identified as correct by PCR and sequencing, they were named p1300-AC2-Flag.

[0030] Table 1 Primers Used Primer name Sequence AtUpf1-1F SfiI ATGGATTCTCAACAGAGCGATCT AtUpf1-3765R BamHI TCAGCCATTGTAAGGATGTTTTG DCP1-1F SfiI CATATGGGCCATGGAGGCCATGTCTCAAAACGGGAAGATAAT DCP1-1104R BamHI GGCCTGCCAGGTCGACGGATCCTCATTGTTGAAGTGCATTTTGTA DCP2-1F SfiI CATATGGGCCATGGAGGCCATGTCGGGCCTCCATCGAT DCP2-1161R BamHI GGCCTGCCAGGTCGACGGATCCTCAAGCTGAATTACCAGATTCCAAC DCP1-1F MluI TATGTCTCAAAACGGGAAGATAAT DCP1-1104R KpnI GGTACCTTGTTGAAGTGCATTTTGTA DCP2-1F MluI ATGTCGGGCCTCCATCGAT DCP2-1161R KpnI AGCTGAATTACCAGATTCCAAC qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT Table 2 Target Fragment Sequences Fragment name Sequence (5′–3′) abc-SacI & SacI GAGCTCGCCAGCTTCGCCACCTCCTTCACATTCAATATCGACGTTCCCAACAATTCAGGACCCGCCGATGGCCTTGCCTTTGTTCTCCTCCCCGTGGGCTCTCAGCCCAAAGACAAAGGCGGTCTTCTAGGTCTGTTCAACAACTACAAATACGACAGCAATGCCCATACTGTGGCTGTGGAGTTCGACACCCTCTACAACGTTCACTGGGACCCCAAACCGCGTCATATTGGCATCGACGTGAACTCCATCAAGTCTATCAAAACGACGACGTGGGATTTTGTCAAAGGAGAAAACGCGGAGGTTCTGATCACCTATGACTCCTCCACGAAGCTCTTGGTGGCTTCTCTGGTTTACCCTTCTCTGAAAACAAGCTTCATCGTCTCTGACACAGTGGACCTGAAGAGCGTTCTTCCCGAGTGGGTGATCGTTGGGTTCACTGCCACCACTGGGATTACTAAAGGGAACGTTGAAACGAACGACATCCTCTCTTGGTCTTTTGCTTCCAAGCTCTCCGATGGCACCACATCTGAAGCTTTGAATCTTGGCAACTTCGCCCTCAACCAAATCCTCTAGGAGCTC AC2 - SpeI & KpnI ATGCGACCTTCATCTCCCTCAGCGAGCCGCTCTACTCAGGTTCCAATCAAGGTCCAACACAGGGCAGCTAAGCGTAAGGCCATTCGGCGACGGAGAGTAGACCTCAATTGCGGCTGCTCATACTACGTGCACATCAACTGCCACAACCATGGATTCACGCACAGGGGAACTCATCACTGCAGCTCAGGCGATGAATGGCGTATATATCTGGGAGGTTCCAAATCCCCTCTATTTCAGGATCATCCAGCACGACAGCCGGCCGTTCAACAGGCCGTGGGACATAATAACCATCCAGATACGCTTCAACCACAACCTGAGGAAAGCGTTGGGACTACATCAATGCTGGATGGATTTCAAGGTCTGGACGACCTTACAGCCTCAGACCTGGCGTTTCTTGAGGGTATT

[0031] 2.2 Yeast Two-Hybrid Identification of the Interaction between AC2 and DCP1 / DCP2 / / UPF1 For ease of description, during the co-transformation process, the "pGADT7" vector was abbreviated as "AD", and the "pGBKT7" vector was abbreviated as "BD". Yeast expression vectors pGADT7, pGBKT7, AD-T (pGADT7-T), BD-53 (pGBKT7-53), BD-lam (pGBKT7-lam), BD-AC2 (pGBKT7-AC2), AD-UPF1, and AD-PARN (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the Interaction between AC2 Protein of Cassava Mosaic Virus and AtPARN[J]. Chinese Journal of Tropical Crops, 2024, 45(01): 197-204.) were all stored in this laboratory.

[0032] After co-transforming different yeast expression vectors into yeast competent cells according to Table 3, single colonies identified as positive by PCR were picked and resuspended in 25 μL of sterile water to prepare a suspension. The suspension was serially diluted 10-fold, 100-fold, and 1000-fold with sterile water. Then, 2 μL of each dilution was inoculated into SD / -Leu / -Trp (SD-LW) minimal medium, SD / -Leu / -Trp / -His / -Ade (SD-LWHA), and SD-LWHA medium supplemented with 5 mM of the self-activation inhibitor 3-AT. Yeast co-transformed with AD-T and BD-Lam and yeast co-transformed with AD-T and BD-53 were used as negative and positive controls, respectively. The yeast cell suspensions transformed with the target plasmids were also inoculated onto solid media and incubated in an inverted position in a constant temperature incubator at 28°C for 3 days to observe and record the growth status, and to determine the interaction between proteins.

[0033] Table 3 Pairing Combinations of Yeast Bait Plasmids and Prey Plasmids Combination Bait vector Prey vector 1 (positive control) AD-T BD-53 2 (negative control) AD-T BD-lam 3 BD-AC2 AD 4 BD-AC2 AD-PARN 5 BD-AC2 AD-UPF1 6 BD-AC2 AD-DCP1 7 BD-AC2 AD-DCP2 The results are as Figure 1 shown (in the figure, 1, 10 -1 、10 -2 、10 -3They respectively represent the bacterial liquid diluted 1-fold, 10-fold, 100-fold, and 1000-fold). The transformants co-transformed with BD-AC2 and AD-UPF1, AD-DCP1, or AD-DCP2 could grow on both SD / -Trp / -Leu (SD-LW) and SD-LWHA defective medium supplemented with 3-AT, while the transformants co-transformed with BD-AC2 and the AD empty vector, or BD-AC2 and AD-PARN could not grow, indicating that there is an interaction between AC2 and UPF1, DCP1, and DCP2 in yeast cells. The results show that there are interactions between AC2 and UPF1, between AC2 and DCP1, and between AC2 and DCP2.

[0034] 2.3 AC2 downregulates DCP1 expression

[0035] 2.3.1 Confocal microscopy observation The empty vector pF1300 (EV) and the expression vector pZP-p19 containing the silencing suppressor p19 that does not interfere with mRNA decay (Qu, F., Ren, T., & Morris, T. J. (2003). The coat protein of turnip crinklevirus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.) are all stored in our laboratory.

[0036] According to the product manual of GV3101 Chemically Competent Cell, the plant expression vectors containing the single-chain green fluorescent protein expression vector DCP1-GFP, p1300-AC2-Flag, EV, and pZP-p19 were respectively transformed into the competent cells of Agrobacterium tumefaciens GV3101. After transformation, the resuspended bacterial pellets were evenly spread on LB plates containing the corresponding antibiotics. DCP1-GFP, p1300-AC2-Flag, and EV were spread on LB plates containing Kan and Rif resistances, while pZP-p19 was spread on LB plates containing Spec and Rif resistances, and then placed upside down in an incubator at 28 °C for 72 - 90 h. After 2 - 3 days when 2 - 3 mm Agrobacterium colonies grew out, single colonies were selected for PCR identification.

[0037] The resuspended bacterial liquid of the recombinant vector Agrobacterium was mixed and injected into the leaves of transgenic wild-type Nicotiana benthamiana. The operation steps are as follows: (a)Use a pipette tip to pick a single colony that has been identified as positive by colony PCR into 5 ml of LB liquid medium containing the corresponding antibiotic, and place it in a constant temperature shaker at 28°C and 200 r / min for overnight shaking culture.

[0038] (b)After centrifuging the bacterial solution at 7000 rmp / min for 15 min, discard the supernatant.

[0039] (c)Prepare injection buffer: Take 2 mL of 1 mol / L MgCl 2 , 2 mL of 1 mol / L MES and 200 μL of 100 mg / mL AS, and finally make up the volume to 200 mL with ultrapure water.

[0040] (d)Resuspend the bacterial solution precipitate with 5 mL of injection buffer, vortex thoroughly to mix evenly, then measure the OD600 value of the bacterial solution, and dilute and adjust the bacterial solution concentration to an OD600 of 0.5.

[0041] (e)After the diluted bacterial solution has been placed at room temperature for 2 - 3 h.

[0042] (f)Select wild-type Nicotiana benthamiana at the 5 - 7 leaf stage with good growth, and use a 1 mL syringe to inject about 2 cm 2 range. Inject the vector DCP1-GFP and EV or p1300-AC2-Flag on the same leaf, inject 10 leaves, cover the injected Nicotiana benthamiana with light-proof material overnight, and then culture it under normal conditions.

[0043] On the 5th day after injection, perform confocal microscopy observation, and the results are as Figure 2 shown. The fluorescent particles of DCP1-GFP co-injected with p1300-AC2-Flag are significantly fewer than those co-injected with EV, indicating that AC2 downregulates DCP1 expression.

[0044] 2.3.2 Detection of the effect of AC2 on DCP1 protein expression by Western blot Extract total proteins from the tobacco leaves of the above different injection combinations on the 5th day, and perform Western Blot to detect the expression of GFP protein to verify the fluorescence observation results. The extraction of plant total proteins and Western Blot refer to the literature (Master's thesis of Liu Linyu, "Cassava mosaic virus silencing suppressor AC4 hijacks UPF1 to promote virus infection"). The results are as Figure 3 shown in the above figure. The expression level of DCP1-GFP in the sample co-injected with AC2 is significantly lower than that co-injected with the empty vector. Coomassie brilliant blue staining of Rubiso shows that the loading amounts are basically the same ( Figure 3 lower figure). The WB detection results confirm the fluorescence observation results, and AC2 downregulates DCP1 expression.

[0045] 2.4 Detection of the function of AC2 in inhibiting mRNA degradation

[0046] 2.4.1 AC2 inhibits the degradation of the mRNA decay substrate with GFP as the reporter gene The empty vector pF1300 (EV) and the expression vector pZP-p19 containing the silencing suppressor p19 that does not interfere with mRNA decay (Qu, F., Ren, T., & Morris, T. J. (2003). The coat protein of turnip crinklevirus suppresses posttranscriptional gene silencing at an early initiationstep. Journal of virology , 77 (1), 511–522.) are all stored in our laboratory.

[0047] According to the product manual of GV3101 Chemically Competent Cell, pG1300abc, pG1300, p1300-AC2-Flag, EV and pZP-p19 were respectively transformed into the competent cells of Agrobacterium tumefaciens GV3101. After transformation, the resuspended bacterial pellets were evenly spread on LB plates containing the corresponding antibiotics. pG1300abc, pG1300, p1300-AC2-Flag, and EV were spread on LB plates containing Kan and Rif resistances, while pZP-p19 was spread on LB plates containing Spec and Rif resistances. They were inverted and cultured in an incubator at 28 °C for 72 - 90 h. After 2 - 3 days when 2 - 3 mm Agrobacterium colonies grew out, single colonies were selected for PCR identification.

[0048] The resuspended bacterial solutions of the recombinant vectors of Agrobacterium were mixed and injected into the leaves of transgenic wild-type Nicotiana benthamiana. The operation steps are as follows: (a)Use a pipette tip to pick a single colony identified as positive by colony PCR into 5 ml of LB liquid medium containing the corresponding antibiotics, and place it in a constant temperature shaker at 28 °C and 200 r / min for overnight shaking culture.

[0049] (b)After centrifuging the bacterial solution at 7000 rmp / min for 15 min, discard the supernatant.

[0050] (c)Prepare the injection buffer: Take 2 mL of 1 mol / L MgCl 2 , 2 mL of 1 mol / L MES and 200 μL of 100 mg / mL AS, and finally make up the volume to 200 mL with ultrapure water.

[0051] (d)Resuspend the bacterial cell pellet with 5 mL of injection buffer. After thoroughly vortexing to mix evenly, measure the OD600 value of the bacterial suspension and dilute and adjust the bacterial concentration to an OD600 of 0.5.

[0052] (e)After the diluted bacterial suspension is placed at room temperature for 2 - 3 h, mix equal volumes according to the required mixing systems respectively (the specific combinations are shown in Table 4).

[0053] Table 4 Combinations of Agrobacterium tumefaciens with different plasmids injected into wild - type Nicotiana benthamiana Group Recombinant plasmid Combination 1 pG1300abc + pF1300 + pZP-p19 Combination 2 pG1300abc + p1300-AC2-Flag + pZP-p19 Combination 3 pG1300 + pF1300 + pZP-p19 Combination 4 pG1300 + p1300-AC2-Flag + pZP-p19 (f)Inject the 4 combinations in Table 4 Figure 4 simultaneously onto one leaf of Nicotiana benthamiana. Inject 10 leaves. After injection, the Nicotiana benthamiana is treated in the dark overnight and then cultured under normal conditions.

[0054] (g)On the 5th day after injection, refer to the instruction manual of "TRNzol Universal Total RNA Extraction Reagent" of Tiangen Company to extract the total RNA of tobacco, and then refer to the instruction manual of the reverse transcription kit and use the two - step method to reverse - transcribe the RNA sample; using the obtained cDNA sample as a template, qNbActin - 128F and qNbActin - 256R as internal reference primers (Table 1), and qsGFP - 306F and qsGFP - 519R as GFP detection primers (Table 1) to perform real - time fluorescence quantitative (qRT - PCR) detection.

[0055] The results are as Figure 5 shown. When AC2 is co - expressed with pG1300abc containing a long 3'UTR, the GFP expression level increases, while there is no obvious effect on the GFP expressed by pG1300. This transient expression result indicates that AC2 significantly inhibits the degradation of the mRNA decay substrate with GFP as the reporter gene with a long sequence at the 3' end, suggesting that SLCMV AC2 has the function of inhibiting host mRNA decay.

[0056] 2.4.2 AC2 inhibits the degradation of endogenous nonsense - mediated mRNA decay (NMD) substrates in Arabidopsis thaliana To further determine the inhibition of AC2 on host mRNA decay function, the expression vector p1300 - AC2 - GFP is transformed into wild - type Arabidopsis thaliana by the pollen - tube pathway method to obtain transgenic Arabidopsis thaliana overexpressing AC2 - GFP, named 35S:AC2 - GFP. Take 4 - week - old seedlings, including 35S:AC2 - GFP, Col - 0 and mutants with partial loss - of - function of the key mRNA decay gene UPF1 upf1-5, RNA was extracted and reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed to study the effect of overexpressing AC2 on the expression levels of NMD substrates and mRNA containing AU-rich instability element (ARE) in transgenic plants. RT-qPCR was used to detect and analyze eight known NMD target transcripts in three major categories (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology, 116(3), 744–755.): (A) AT1G0106020 containing a premature termination codon (Gloggnitzer, J., Akimcheva, S., Srinivasan, A., Kusenda, B., Riehs, N., Stampfl, H. et al. (2014) Nonsense-mediated mRNA decay modulates immune receptor levels to regulate plant antibacterial defense. Cell Host & Microbe, 16(3), 376–390.), RPS6 (Garcia, D., Garcia, S. & Voinnet, O. (2014) Nonsense-mediated decay serves as a general viral restriction mechanism in plants. Cell Host & Microbe, 16(3), 391–402.) or SMG7 with a long 3'UTR (Kerényi, Z., Mérai, Z., Hiripi, L., Benkovics, A., Gyula, P., Lacomme, C. et al. (2008) Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay.The EMBO Journal, 27(11), 1585–1595.); (B) AT5G35490, AT5G64430, AT1G36730 with upstream open reading frames (uORFs) (Rayson, S., Arciga-Reyes, L., Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) A role for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.) and (C) mRNAs of AT4G3900, AT5G22570 carrying two unknown NMD cis-elements (Rayson, S., Arciga-Reyes, L., Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) A role for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.).

[0057] Analysis of two target transcripts containing AU instability elements (AT1G72450 and AT2G400) was performed using RT-qPCR (Gutierrez, R.A., Ewing, R.M., Cherry, J.M. & Green, P.J. (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is associated with a group of touch- and specific clock-controlled genes. Proceedings of the National Academy of Sciences of the United States of America, 99(17), 11513–11518.).

[0058] The results are as Figure 6 shown. Compared with Col-0 plants, the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570 were all significantly increased in AC2 overexpressing plants. In contrast, for the other two target transcripts containing AU instability elements (AT1G72450 and AT2G400), the mRNA expression levels of AT1G72450 and AT2G400 decreased sharply in AC2 overexpressing plants. This indicates that AC2 can inhibit the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis and has the function of an mRNA decay inhibitor. There were no obvious changes in the phenotypes of transgenic Arabidopsis plants.

[0059] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this utility are also within the scope of the present invention. Therefore, equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in increasing the expression of GFP and / or inhibiting the degradation of mRNA attenuation substrates using GFP as a reporter gene; wherein: The nucleotide sequence of the AC2 gene is shown in SEQ ID NO:

1.

2. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in inhibiting the degradation of endogenous nonsense-mediated mRNA attenuation NMD substrates in Arabidopsis thaliana; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; or the AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacteria containing the AC2 gene coding region are used to inhibit the degradation of endogenous nonsense-mediated mRNA attenuation NMD substrates in Arabidopsis thaliana without affecting the phenotype of transgenic Arabidopsis thaliana; wherein the nucleotide sequence of the AC2 gene is shown in SEQ ID NO:

1.

3. The use according to claim 2, characterized in that: The target genes of Arabidopsis endogenous nonsense-mediated mRNA attenuation are AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570.

4. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in regulating the mRNA expression of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein: The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; or the AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacteria containing the AC2 gene coding region are used to regulate the mRNA expression of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400 without affecting the phenotype of transgenic Arabidopsis thaliana; wherein the nucleotide sequence of the AC2 gene is shown in SEQ ID NO:

1.

5. The use according to claim 4, characterized in that: The AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacteria containing the AC2 gene coding region increases the mRNA expression level of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570.

6. The use according to claim 4, characterized in that: The AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacteria containing the AC2 gene coding region reduces the expression level of AT1G72450 and AT2G400.

7. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in reducing the expression level of Dcp1; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the corresponding gene of Dcp1 is shown in SEQ ID NO:

2.

8. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in the interaction with Dcp1 and / or Dcp2; wherein, The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1, the nucleotide sequence of the gene corresponding to Dcp1 is shown in SEQ ID NO: 2; and the nucleotide sequence of the gene corresponding to Dcp2 is shown in SEQ ID NO:

3.

9. The use according to claim 8, characterized in that: The interaction between AC2 and Dcp1 or Dcp2 improves the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium containing the autoactivation inhibitor 3-AT; the interaction between AC2 and Dcp1 reduces the expression level of Dcp1.

Citation Information

Patent Citations

  • Application of turnip crinkling virus P8 in inhibiting degradation of mRNA decay substrate

    CN119614626A

  • Application of turnip crinkling virus P8 in inhibiting RNA silencing

    CN119614627A

Cited By

  • Application of Sri Lanka cassava mosaic virus BV1 in inhibiting RNA silencing

    CN122235213A

  • Use of a sri lankan cassava mosaic virus bv1 in inhibiting rna silencing

    CN122235213B