Single-stranded RNA nanopore direct sequencing method
By connecting the template to the 5' end of the RNA, the problem of loss of RNA 5' end base sequence in nanopore sequencing is solved, improving the accuracy and completeness of sequencing.
Patent Information
- Application Number
- CN202411730948.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-11-30
- Filing Date
- 2024-11-29
- Publication Date
- 2025-05-30
AI Technical Summary
The base sequences around 15nt of the 5' end of RNA in nanopore sequencing are easily lost, resulting in a decrease in sequencing accuracy.
By ligating the template-transforming oligonucleotides as extension linkers at the 5' end of the RNA, the reverse transcriptase is able to extend the complementary DNA and repair the deletion between the template-transforming oligonucleotides and the RNA to be tested, thereby connecting the nanopore sequencing linkers.
It effectively solves the problem of undetectable edge points in nanopore sequencing, and improves the accuracy and completeness of sequencing.
Smart Images

Figure CN120060433A_ABST
Abstract
Description
[0001] Cross - Reference to Related Applications
[0002] This application claims the priority of a Chinese patent application with the application number 202311633507.6, filed on November 30, 2023, the entire content of which is incorporated herein by reference. Technical Field
[0003] The present invention relates to sequencing technology, and more particularly to RNA sequencing methods. Background Art
[0004] Oxford Nanopore Technologies provides a technology that can directly sequence RNA. (store.nanoporetech.com / productDetail / ?id=direct-rna-sequencing-kit) This sequencing technology is mainly used to sequence RNA with a 3’ Poly(A) tail, including eukaryotic mRNA, viral RNA with a Poly(A) tail, or any RNA with a Poly(A) tail added. When preparing the sequencing sample (i.e., library construction), first add a reverse transcription adapter to the RNA with a Poly(A) tail, then perform reverse transcription, and finally ligate a sequencing adapter with a motor protein.
[0005] During sequencing, the motor protein pumps the RNA into the nanopore from the 3’ end, and the sensor detects the current change when the RNA passes through the pore. After analysis by the software algorithm of Oxford Nanopore Technologies, the base signal is finally identified. Since the moving speed of the 5’ end of the RNA increases when it leaves the nanopore, this part of the signal cannot be recognized and analyzed by the algorithm, resulting in the loss of approximately 15 nt of bases at the 5’ end during sequencing, which reduces the accuracy of nanopore sequencing. Therefore, there is an urgent need for a method and kit that can solve this problem. Summary of the Invention
[0006] The present invention ingeniously uses template-switching oligonucleotides as extension adapters to solve the problem that the 5'-end edge points cannot be detected during nanopore sequencing. On the one hand, it provides a sample preparation method for direct RNA detection by nanopore, including the following steps: (1) ligating the RNA to be tested with a reverse transcription adapter; (2) in the presence of a template-switching oligonucleotide, using a reverse transcriptase with terminal transferase activity to perform reverse transcription to generate a complementary polynucleotide of the RNA to be tested and add non-template nucleotides to its 3'-end, wherein the 3'-end of the template-switching oligonucleotide can hybridize with the non-template nucleotides, so that the reverse transcriptase uses the template-switching oligonucleotide as a second template for reverse transcription to extend the complementary polynucleotide to include a sequence complementary to the template-switching oligonucleotide; (3) repairing the nick between the template-switching oligonucleotide and the RNA to be tested, and ligating a nanopore sequencing adapter to the other end of the RNA to be tested to produce a sample that can be used for direct RNA sequencing by nanopore.
[0007] In some embodiments, the 3'-end sequence of the template-switching oligonucleotide complementary to the non-template nucleotides is rGrGrG, rUrUrG or rGrUrG.
[0008] In some embodiments, the nanopore sequencing adapter contains a motor protein binding site.
[0009] In some embodiments, a motor protein is bound to the nanopore sequencing adapter.
[0010] In some embodiments, the motor protein is a DNA helicase.
[0011] In some embodiments, the length of the template-switching oligonucleotide is not less than 13 nucleotides.
[0012] In some embodiments, the template-switching oligonucleotide contains a DNA part at the 5'-end and an RNA part at the 3'-end.
[0013] In some embodiments, in step (3), T4 RNA ligase 2, T3 DNA ligase or T4 DNA ligase is used to repair the nick between the template-converted oligonucleotide and the RNA to be tested.
[0014] On the other hand, the present invention provides a nanopore direct RNA detection sample prepared by the sample preparation method of any one of the foregoing.
[0015] On the other hand, the present invention provides a nanopore direct RNA detection sample library prepared by the sample preparation method of any one of the foregoing.
[0016] Another aspect of the present invention provides a method for direct RNA detection using nanopores, comprising: preparing a test sample using the sample preparation method of any one of the foregoing, and performing nanopore sequencing using the sample, wherein a nucleic acid strand containing the RNA to be detected is passed through the nanopore.
[0017] Another aspect of the present invention provides a kit, comprising a template-switching oligonucleotide, a reverse transcriptase, and a ligase, wherein the reverse transcriptase has terminal transferase activity and can reverse transcribe to produce a complementary polynucleotide of the RNA to be detected and add non-template nucleotides to its 3' end, and the 3' end of the template-switching oligonucleotide can hybridize with the non-template nucleotides, so that the reverse transcriptase uses the template-switching oligonucleotide as a second template for reverse transcription, and the ligase can repair the nick between the template-switching oligonucleotide and the RNA to be detected.
[0018] In some embodiments, the 3' end sequence of the template-switching oligonucleotide complementary to the non-template nucleotides is rGrGrG, rUrUrG, or rGrUrG.
[0019] In some embodiments, the length of the template-switching oligonucleotide is not less than 13 nucleotides.
[0020] In some embodiments, the template-switching oligonucleotide comprises a DNA part at the 5' end and an RNA part at the 3' end.
[0021] In some embodiments, the kit further comprises a reverse transcription adapter.
[0022] In some embodiments, the kit further comprises a sequencing adapter comprising a motor protein binding site or bound to a motor protein.
[0023] In some embodiments, the motor protein is a DNA helicase. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 is a schematic diagram of the construction principle of a library with a 5' end adapter.
[0025] Figure 2 is an IGV comparison diagram of RNA with and without a 5' end adapter.
[0026] Figure 3 is a schematic diagram of the library construction process for designing a customized RTA adapter based on a known RNA sequence.
[0027] Figure 4 is an IGV diagram of the library constructed with the customized RTA adapter. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0029] All publications, patent applications, patents, and other references mentioned herein are hereby incorporated by reference in their entirety. In case of conflict, the present specification (including definitions) shall prevail. Additionally, the materials, methods, and examples described herein are illustrative only and not intended to be limiting.
[0030] When used in conjunction with numerical variables, the terms "about" and "approximate" generally mean that the value of the variable and all values of the variable are within the measurement or experimental error (e.g., 95% confidence interval of the mean) or within a wider range of specified values (e.g., ±5% or ±10%).
[0031] The term "comprising" or its variants such as "containing", "having", "including" means including the recited steps or elements, but not excluding any other steps or elements. "Consisting of" means excluding steps or elements not listed. "Consisting essentially of" means excluding those steps or elements that do not materially affect the basic and novel features of the claimed invention. The term "comprising" a particular step or element and its variants also includes the cases of "consisting of" and "consisting essentially of" the particular step or element.
[0032] When referring to a numerical range, the specific values of its upper and lower limits, as well as all intermediate ranges included therein, such as the intermediate range between its upper or lower limit and any intermediate value, or the intermediate range between any two of its intermediate values, shall be considered specifically disclosed. And any intermediate range, sub-range, and all individual numerical values described in the said numerical range may be excluded from the said numerical range.
[0033] The term "and / or" shall be understood to mean any one or any combination of several elements connected by this term.
[0034] The term "nanopore detection" as used herein refers to a method for detecting nucleic acid sequences through a nanopore, wherein the detection of the nucleic acid sequence is achieved by the signal changes induced when the nucleic acid sequence passes through the nanopore. In some embodiments, the nanopore detection may be nanopore sequencing, such as determining the sequence of a nucleic acid (such as DNA, RNA, or a DNA-RNA hybrid). Nanopore detection techniques are well-known in the art. For example, an insulating dielectric membrane is used to isolate an electrolyte solution, which is divided into two electrolyte solution pools. There are nanopore-sized channels on the insulating dielectric membrane, and the nanopore is the only channel for ions or molecules. When an external voltage is applied, the ions in the electrolyte solution are driven by the electric field force to move directionally to generate a current. When there is a substance to be detected (such as a nucleic acid, such as DNA or RNA) in the electrolyte solution, the substance to be detected will be driven by the electric field force to pass through the nanopore, causing a blocking effect on the ionic current in the nanopore. The degree of blocking changes with the change of the substance to be detected (such as different nucleotides in the nucleic acid chain), thereby forming detectable different electrical signals (such as current signals). The change of the current signal can be measured using an amplifier or other known signal detection devices to obtain the pore-blocking current. Different substances to be detected (such as different nucleotides) correspond to different pore-blocking currents, and information about the substance to be detected can be obtained based on the measurement results. Nanopore detection techniques have been widely used in the sequencing of nucleic acid sequences. The nanopores used can be solid-state nanopores or biological nanopores (such as protein nanopores).
[0035] The term "direct RNA nanopore detection" refers to directly performing nanopore detection on an RNA sequence, wherein the RNA sequence is passed through the nanopore, and the detection of the RNA sequence is achieved based on the induced signal changes.
[0036] The term "reverse transcription" is also referred to as "RT" and refers to the process of synthesizing complementary DNA (cDNA) using RNA as a template. The term "reverse transcriptase" may also be referred to as "reverse transcriptase" or "RT enzyme" in the present invention and refers to an enzyme with reverse transcription activity, which is an RNA-directed DNA polymerase.
[0037] The term "template switching" refers to the process of continuously performing template-dependent synthesis of complementary strands using two nucleic acid templates through a reverse transcriptase, wherein the two templates are not covalently linked to each other by any chemical bond (such as a phosphodiester bond). The synthesized complementary strand will be a continuous single strand that is complementary to both templates. The term "continuous" means that any two adjacent nucleotides in the single strand are covalently linked, that is, there are no nicks in the single strand.
[0038] The term "template-switching oligonucleotide" refers to the oligonucleotide template to which the starting template is switched during the synthesis of the complementary strand by reverse transcriptase. In an embodiment of the present invention, the template-switching oligonucleotide is also referred to as a "template-switching adapter primer", and finally realizes connecting the template-switching oligonucleotide as an extension adapter to the 5'-end of the RNA to be tested.
[0039] The term "wild-type" enzyme refers to an enzyme expressed by a naturally occurring organism or cell (such as a bacterium or a fungus). The "naturally occurring" means without artificial mutagenesis or genetic manipulation.
[0040] The term "mutant" refers to a polypeptide having one or more amino acid insertions, deletions, and / or substitutions relative to the parental polypeptide. Substitution means replacing the amino acid occupying a certain position with a different amino acid; deletion means removing the amino acid occupying a certain position; insertion means adding several (such as 1-5) amino acids at the adjacent position after the amino acid occupying a certain position. The mutant retains at least one activity of the parental polypeptide, but may vary in the activity level. For example, the mutant may remain unchanged or be improved relative to the parental polypeptide in at least one activity or property. In the present invention, the mutant of reverse transcriptase retains its reverse transcription activity and terminal transferase activity, but mutations can be introduced in the RNase H domain such that the RNase H activity of the mutant is reduced or even completely eliminated relative to the parental enzyme.
[0041] The term "hybridization" refers to the formation of double-stranded nucleic acids by complementary single-stranded nucleic acids. The single-stranded nucleic acids undergoing hybridization may be completely complementary or have partial mismatches. The degree of complementarity required for hybridization may vary with hybridization conditions, for example, it can be adjusted by temperature.
[0042] In the present invention, "nucleotide" and "base" can be used interchangeably and are usually represented by conventional single letters, where A is deoxyadenosine monophosphate or adenosine monophosphate, C is deoxycytidine monophosphate or adenosine monophosphate, G is deoxyguanosine monophosphate or adenosine monophosphate, T is deoxythymidine monophosphate, and U is uridine monophosphate. When an r is marked before a nucleotide, such as rU or rG, it indicates that the nucleotide is a ribonucleotide, and when a d is marked before a nucleotide, such as dC or dA, it indicates that the nucleotide is a deoxyribonucleotide.
[0043] Unless otherwise specified, in this article, nucleic acids are written from left to right in the 5' to 3' direction, and amino acid sequences are written from left to right in the direction from the amino terminus to the carboxyl terminus.
[0044] To solve the problem of the loss of about 15 nt of the base sequence at the 5' end of RNA in nanopore direct RNA sequencing, the present invention ligates an additional adapter (referred to as an extended adapter) to the 5' end of RNA, enabling the original 5' end to pass through the nanopore normally and be recognized by software (basecalling).
[0045] The present invention uses a reverse transcriptase with terminal transferase activity, a template-switching oligonucleotide, and a ligase to ligate the extended adapter to the 5' end of the RNA to be tested. Terminal deoxynucleotidyl transferase (TdT) is a template-independent DNA polymerase that catalyzes the binding of deoxynucleotides to the 3'-hydroxyl end of a DNA molecule. During reverse transcription, when the reverse transcriptase reaches the 5' end of the RNA template, its terminal transferase activity causes the addition of non-template-specific nucleotides (which can also be referred to as non-template nucleotides in this article) to the 3' end of the complementary DNA (cDNA) of the resulting RNA template. The template-switching oligonucleotide contains a sequence at its 3' end that can hybridize with these non-template nucleotides, thereby mediating template switching and enabling the reverse transcriptase to use the template-switching oligonucleotide as a second template for reverse transcription to extend the resulting complementary DNA. The final single-stranded DNA produced by the entire reverse transcription process contains a sequence complementary to the RNA to be tested and a sequence complementary to the template-switching oligonucleotide from the 5' end to the 3' end. Subsequently, the nick between the template-switching oligonucleotide and the RNA to be tested is repaired, thereby ligating the template-switching oligonucleotide as an extended adapter to the 5' end of the RNA to be tested.
[0046] The term "second template" is used to distinguish it from the RNA template and means that the template-switching oligonucleotide is another template different from the RNA template, that is, the RNA template can be regarded as the first template, and the template-switching oligonucleotide is correspondingly the second template.
[0047] The number of non-template nucleotides added by the reverse transcriptase may be 1 - 5, for example, it may be 1, 2, 3, 4, or 5. The non-template nucleotides added by the reverse transcriptase may have different sequences and may include different combinations of A, T, C, G, such as but not limited to CCC, CAA, CAC, etc.
[0048] In some embodiments, the full length of the template-switching oligonucleotide (i.e., the extension adapter) is not less than 10 nucleotides, such as not less than 11 nucleotides, not less than 12 nucleotides, not less than 13 nucleotides, not less than 14 nucleotides, not less than 15 nucleotides, not less than 16 nucleotides, not less than 17 nucleotides, not less than 18 nucleotides, not less than 19 nucleotides or not less than 20 nucleotides. The full length of the template-switching oligonucleotide (i.e., the extension adapter) is between 10 and 50 nucleotides, such as it can be 10 - 40 nucleotides, 13 - 50 nucleotides, 13 - 40 nucleotides, 20 - 50 nucleotides, 20 - 40 nucleotides. In some embodiments, the template-switching oligonucleotide comprises deoxyribonucleotides and ribonucleotides. In some embodiments, the template-switching oligonucleotide comprises a deoxyribonucleic acid (DNA) portion and a ribonucleic acid (RNA) portion. In some embodiments, the template-switching oligonucleotide comprises a 5' portion and a 3' portion, wherein the 5' portion is a deoxyribonucleic acid (DNA) portion and the 3' portion is a ribonucleic acid (RNA) portion. In some embodiments, the length of the DNA portion of the template-switching oligonucleotide is 5 - 20 nucleotides, such as 5 - 15 nucleotides, 10 - 15 nucleotides or 5 - 10 nucleotides. In some embodiments, the length of the RNA portion of the template-switching oligonucleotide is not less than 3 nucleotides, such as not less than 3 nucleotides, not less than 4 nucleotides, not less than 5 nucleotides, not less than 6 nucleotides, not less than 7 nucleotides, not less than 8 nucleotides, not less than 9 nucleotides, not less than 10 nucleotides, such as not less than 11 nucleotides, not less than 12 nucleotides, not less than 13 nucleotides, not less than 14 nucleotides or not less than 15 nucleotides. In some embodiments, the length of the RNA portion of the template-switching oligonucleotide is 10 - 40 nucleotides, such as 15 - 40 nucleotides, 10 - 30 nucleotides, 15 - 30 nucleotides or 20 - 30 nucleotides. In some embodiments, the template-switching oligonucleotide consists of ribonucleotides. In some embodiments, the ribonucleotides contained in the template-switching oligonucleotide (such as the ribonucleotides contained in its RNA portion, e.g., the ribonucleotide located at its 5' end when the template-switching oligonucleotide consists of ribonucleotides) have modifications to prevent degradation of the template-switching oligonucleotide. The modifications include but are not limited to phosphorothioate, 2'-fluoro, 2'-Ome, 2'-MOE and / or 2'-LNA.
[0049] The template-switching oligonucleotide contains, at the end of its 3' portion, a sequence capable of hybridizing with the non-template nucleotide and mediating template switching. The sequence mediating template switching can hybridize with the non-template nucleotide added by terminal transferase to the 3' end of the complementary DNA of the synthesized RNA template, thereby mediating template switching and enabling the reverse transcriptase to perform reverse transcription using the template-switching oligonucleotide as the second template. In some embodiments, the sequence capable of hybridizing with the non-template nucleotide and mediating template switching is a ribonucleic acid sequence. Sequences capable of hybridizing with the non-template nucleotide and mediating template switching are known to those skilled in the art. For example, see Wulf MG et al., Non-templated addition and template switching by Moloney murine leukemia virus (MMLV)-based reverse transcriptases co-occur and compete with each other. J Biol Chem. 2019 Nov 29;294(48):18220-18231. doi:10.1074 / jbc.RA119.010676. Epub 2019 Oct 22. In some embodiments, the sequence mediating template switching contained at the 3' end of the template-switching oligonucleotide is rGrGrG, rUrUrG, or rGrUrG, which is located immediately adjacent to the 3' end.
[0050] In the present invention, an extension linker is added to the 5' end of the RNA to be tested, with the aim of ensuring that the nucleotides at the 5' end of the RNA to be tested can be detected during nanopore sequencing, and avoiding the loss of all or part of the 15 nt nucleic acid at the 5' end. Therefore, in some embodiments, the extension linker of the present invention or its complementary sequence does not contain the linkers added to both ends of the sequence to be tested in next-generation sequencing (high-throughput sequencing), the linkers added to both ends of the sequence to be tested in third-generation sequencing (such as SMRT sequencing or nanopore single-molecule DNA sequencing), the primers for subsequent PCR amplification, or restriction enzyme sites.
[0051] Reverse transcriptases with terminal transferase activity are known in the art, including but not limited to: MMLV-based reverse transcriptases, such as MMLV RT (e.g., available from NEB), SuperScript II RT or SuperScript III RT (e.g., available from Invitrogen), Multiscribe RT (e.g., available from Applied Biosystems), SMART MMLV RT or SMARTScribe RT (e.g., available from Clontech); or AMV-based reverse transcriptases. The reverse transcriptase used in the present invention can be a wild-type reverse transcriptase or a mutant thereof.
[0052] The DNA generated by reverse transcription forms a double strand with two templates (i.e., the RNA to be tested and the template-switching oligonucleotide), where there is no covalent connection between the template-switching oligonucleotide and the RNA to be tested, but they are spatially close to each other, and there is a nick between the 3' end of the template-switching oligonucleotide and the 5' end of the RNA to be tested. The template-switching oligonucleotide can be ligated to the 5' end of the RNA to be tested by repairing this nick. Any ligase known in the art that can be used to repair this nick can be used for nick repair, such as T4 RNA ligase 2 (dsRNA ligase), T3 DNA ligase or T4 DNA ligase.
[0053] In some embodiments, before reverse transcription, a reverse transcription adapter is ligated to the 3' end of the RNA to be tested. Reverse transcription adapters are well known to those skilled in the art and can be selected and used as needed. For example, for an RNA to be tested with PolyA at the 3' end, a commercially available reverse transcription adapter complementary to PolyA can be ligated. For an RNA to be tested without PolyA at the 3', PolyA can be added to the 3' end of the RNA to be tested, and then a commercially available reverse transcription adapter complementary to PolyA can be ligated, or a custom reverse transcription adapter complementary to the 3' end of the RNA to be tested can be used.
[0054] In some embodiments, the 5' end of the RNA to be tested is phosphorylated for subsequent nick repair reaction. This step can be carried out before or after the step of ligating the reverse transcription adapter.
[0055] In some embodiments, a sequencing adapter with a motor protein can be further ligated to the double strand generated by reverse transcription, and the sequencing adapter can enter and pass through the nanopore under the action of the motor protein. In some embodiments, the sequencing adapter contains a motor protein binding site through which the motor protein binds to the sequencing adapter. In some embodiments, the sequencing adapter contains or consists of a DNA sequence. In some embodiments, the adapter sequence with the motor protein is ligated to the RNA strand to be tested. In some embodiments, the sequencing adapter is ligated to the 3'-end of the RNA to be tested. In some embodiments, the motor protein is a DNA helicase. In some embodiments, the motor protein can be Hel308 helicase, RecD helicase, XPD helicase, Dda helicase or any combination thereof. When nanopore detection is performed using the test sample prepared by the method of the present invention, the nucleic acid sequence enters the nanopore from its 3'-end, and the motor protein is used to control the speed of the sample passing through the nanopore.
[0056] The length of the RNA to be tested can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides, and can even be 1000 or more nucleotides. In some embodiments, the length of the RNA to be tested can be 10 - 500 nucleotides, such as 50 - 400 nucleotides, 100 - 300 nucleotides, 100 - 200 nucleotides or 100 - 150 nucleotides.
[0057] The method of the present invention can also be used to prepare a sample library suitable for direct RNA detection by nanopore. Among them, the sample preparation method of the present invention can be used for multiple RNAs to be tested to obtain a sample library containing multiple RNAs to be tested.
[0058] In some embodiments, the method of the present invention is carried out in vitro or ex vivo. In some embodiments, the method of the present invention is for non-therapeutic purposes and / or non-diagnostic purposes.
[0059] The method of the present invention can be used to detect various types of RNAs, including but not limited to mRNA, tRNA, miRNA, gRNA, etc. The present invention can be used for direct RNA sequencing, detecting modifications or purity on RNA, or performing quality control on it. The present invention can be used to detect the sequence and modification correctness of gRNA and sgRNA used in CRISPR gene editing tools, or to detect the sequence and modification correctness of mRNA.
[0060] The present invention further provides a kit, which comprises the aforementioned template conversion oligonucleotide, reverse transcriptase and ligase. In some embodiments, the kit further comprises a reverse transcription adapter. In some embodiments, the kit further comprises a sequencing adapter with a motor protein.
[0061] The present invention is further described by the following examples, which should not be construed as limiting the present invention.
[0062] Unless otherwise specified, the reagents used in the following examples are all commercially available products. For the molecular biology experimental methods not specifically described in the examples, they are all carried out according to the specific methods listed in J. Sambrook, Molecular Cloning: A Laboratory Manual, Third Edition, or according to the kit and product instructions.
[0063] Example 1
[0064] Refer to Figure 1 , and the principle of library construction is described as follows:
[0065] 1. Phosphorylate the 5' end of RNA for subsequent nick repair reaction;
[0066] 2. Add polyadenylic acid to the 3' end of RNA for matching with the reverse transcription adapter;
[0067] 3. The reverse transcription adapter is complementary paired with the 3' end Poly(A) of RNA through Poly(T), and then a ligation reaction is carried out;
[0068] 4. The reverse transcriptase uses Poly(T) as a primer and RNA as a template to reverse transcribe cDNA. Since the reverse transcriptase has the activity of terminal transferase, CCC is added to the 3' end of the cDNA.
[0069] 5. The 3' end GGG base (rGrGrG) of the TSO2 adapter primer is complementary paired with the CCC base at the end of the cDNA. At this time, the reverse transcriptase continues to reverse transcribe using TSO2 as a template until it extends to the 5' end of the TSO2 adapter primer.
[0070] 6. There is a nick between the 3' end G of the TSO2 adapter primer and the 5' end of RNA. At this time, the ligase is used to repair the nick and connect the TSO2 adapter primer to the 5' end of RNA.
[0071] Related sequences:
[0072] Full-length RNA:
[0073] 5’-GUUCCGGAGUUGCUACCACGAUGGACCAUCUCUUGGUUUUAGAGCUAGAAAUA GCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUUU-3’(SEQ ID NO:1)
[0074] TSO2 (Template Switching Oligo2): 5’-d(AAGCAGTGGT)r(AUCAACGCAGAGUGGCCAUUAUGGCCGGG)-3’(SEQ ID NO:2), where d() represents DNA and r() represents RNA.
[0075] Reagents:
[0076]
[0077] Equipment:
[0078] Device Name / Model Company MinION Mk1C Oxford Nanopore Technologies Veriti 96Well Thermal cycler Thermo Fisher Scientific Qubit 4 fluorometer Thermo Fisher Scientific
[0079] Experimental procedures:
[0080] 1. 5’ phosphorylation of RNA
[0081] Take 500 ng of RNA and prepare the following reaction system:
[0082]
[0083]
[0084] After mixing, run the following program on a PCR instrument:
[0085] Temperature Time Cycle 37℃ 30min 1 65℃ 20min 1 4℃ ∞ 1
[0086] 2. Adding a poly(A) tail
[0087] Add the following components to the 5’ phosphorylation reaction system:
[0088]
[0089] After mixing, run the following program on a PCR instrument:
[0090] Temperature Time Number of Cycles 37℃ 30min 1 4℃ ∞ 1
[0091] After the reaction ends, add 0.6 μL of EDTA with a concentration of 0.5 M, pipette and mix well, and let it stand at room temperature for 2 min.
[0092] 3. Magnetic bead purification
[0093] 3.1. Take out the magnetic beads from the 4°C refrigerator, equilibrate at room temperature for at least 30 min, and then vortex to ensure thorough mixing. Prepare 80% ethanol (freshly prepared for immediate use).
[0094] 3.2. Add magnetic beads with a volume of 2X (60 μL) to the PCR tube from the previous step, vortex to mix evenly or pipette up and down 10 times, and let stand at room temperature for 5 min.
[0095] 3.3. Place the PCR tube in the magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant with a pipette.
[0096] 3.4. Keep the PCR tube in the magnetic stand all the time, slowly and gently add 200 μL of freshly prepared 80% ethanol, incubate at room temperature for 30 s, and carefully remove the supernatant.
[0097] 3.5. Repeat step 3.4.
[0098] 3.6. Keep the PCR tube in the magnetic stand all the time, open the lid and dry at room temperature until the magnetic beads have no obvious luster.
[0099] 3.7. Remove the PCR tube, add 20 μL of DNase / RNase-Free Water, vortex to mix evenly or pipette up and down to mix, and let stand at room temperature for 5 min.
[0100] 3.8. Place the PCR tube in the magnetic stand. After the solution becomes clear (about 5 min), carefully transfer 18 μL of the supernatant to a new tube with a pipette, and the purification is completed.
[0101] 3.9. Detect the concentration of the purified product with Qubit.
[0102] 4. Ligate RTA (RT Adapter, reverse transcription adapter, from the Direct RNA Sequencing Kit SQK-RNA002 of Oxford Nanopore Technologies)
[0103] Take 100 ng of the purified product to prepare the following reaction system:
[0104]
[0105] After mixing, run the following program on the PCR instrument:
[0106] Temperature Time Number of Cycles 20℃ 30min 1 4℃ ∞ 1
[0107] 5. Reverse transcription and template switching
[0108] Add the following components to the ligation product from the previous step:
[0109]
[0110] After mixing, run the following program on a PCR instrument:
[0111] Temperature Time Number of Cycles 50℃ 50min 1 70℃ 10min 1 4℃ ∞ 1
[0112] 6. Nick repair
[0113] Add the following components to the product of the previous reaction:
[0114]
[0115] After mixing, run the following program on a PCR instrument:
[0116] Temperature Time Number of Cycles 25℃ 2h 1 4℃ ∞ 1
[0117] 7. Magnetic bead purification
[0118] 7.1. Take out the magnetic beads from the 4°C refrigerator, equilibrate at room temperature for at least 30 min, and then vortex to ensure mixing. Prepare 80% ethanol (freshly prepared).
[0119] 7.2. Transfer the product in the PCR tube to a 1.5 mL centrifuge tube, add 1.8X (144 μL) volume of magnetic beads, vortex to mix or pipette 10 times, and let stand at room temperature for 5 min.
[0120] 7.3. Place the centrifuge tube in a magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant with a pipette.
[0121] 7.4. Keep the centrifuge tube in the magnetic stand all the time, slowly and gently add 200 μL of freshly prepared 80% ethanol, incubate at room temperature for 30 s, and carefully remove the supernatant.
[0122] 7.5. Repeat step 7.4.
[0123] 7.6. Keep the centrifuge tube in the magnetic stand all the time, open the lid and dry at room temperature until the magnetic beads have no obvious luster.
[0124] 7.7. Remove the centrifuge tube and add 20 μL of DNase / RNase-Free Water, vortex to mix or pipette evenly, and let stand at room temperature for 5 min.
[0125] 7.8. Place the centrifuge tube in a magnetic stand. After the solution becomes clear (about 5 min), carefully transfer 20 μL of the supernatant to a new PCR tube to complete the purification.
[0126] 8. Ligate sequencing adapters
[0127] Add the following components to the PCR tube containing the purified product:
[0128]
[0129] After mixing, run the following program on a PCR instrument:
[0130] Temperature Time Number of Cycles 20℃ 30min 1 4℃ ∞ 1
[0131] 9. Magnetic bead purification
[0132] 9.1. Take out the magnetic beads from the 4°C refrigerator, equilibrate at room temperature for at least 30 min, and then vortex to ensure mixing.
[0133] 9.2. Add 0.5X (20 μL) volume of magnetic beads to the above PCR tube, vortex to mix evenly or pipette 10 times, and let stand at room temperature for 5 min.
[0134] 9.3. Place the PCR tube in a magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant with a pipette.
[0135] 9.4. Slowly add 150 μL of Wash Buffer, flick the centrifuge tube to resuspend the magnetic beads, place it back on the magnetic stand, and carefully remove the supernatant.
[0136] 9.5. Repeat step 9.4.
[0137] 9.6. Remove the PCR tube and add 21 μL of Elution Buffer, vortex to mix evenly or pipette to mix well, and let stand at room temperature for 10 min.
[0138] 9.7. Place the PCR tube in a magnetic stand. After the solution becomes clear (about 5 min), carefully transfer 20 μL of the supernatant to a new tube to complete the purification.
[0139] 9.8. Use Qubit to detect the concentration of the purified product. If the concentration is greater than 1 ng / μL, it can be sequenced on the machine.
[0140] 10. Sequence the constructed library on a MinION Mk1C.
[0141] 11. Analysis of the data after sequencing
[0142] 11.1 Use the cat command to merge all fq data to generate an fq file. Use the awk command to replace all U in the fq file with T.
[0143] 11.2 Use bwa to align the fq file to the ref sequence and use IGV (The Integrative Genomics Viewer) to view the alignment results.
[0144] Results
[0145] The coverage of the 5'-end sequence of the same RNA segment was detected with and without the 5'-end adapter.
[0146] As shown in the figure below, when the 5'-end adapter was not added, the 5'-end coverage of the RNA was very low (coverage = 99); when the 5'-end adapter was added, the 5'-end of the RNA had a very high coverage (coverage = 14719). The experimental results show that adding the 5'-end adapter can better solve the problem of 5'-end loss in Nanopore sequencing and is applicable to single-stranded RNA without a specific structure.
[0147] Example 2 Library construction with customized RTA adapter
[0148] The schematic diagram of the library construction process is as Figure 3 shown.
[0149] Experimental steps:
[0150] The first step (5'-phosphorylation of RNA) is the same as the first step in Example 1, the second step (magnetic bead purification) is the same as the third step in Example 1, the RNA sequence is the same as in Example 1, and the third to ninth steps are as follows.
[0151] 3. Design and ligate a customized RTA (customized RT Adapter, reverse transcription adapter) according to the 3'-end sequence of the RNA to be tested
[0152] Take 100 ng of the purified product and prepare the following reaction system:
[0153]
[0154] After mixing, run the following program on a PCR instrument:
[0155] Temperature Time Number of Cycles 20℃ 30min 1 4℃ ∞ 1
[0156] 4. Reverse transcription and template switching
[0157] Add the following components to the ligation product from the previous step:
[0158]
[0159] After mixing, run the following program on a PCR instrument:
[0160] Temperature Time Number of Cycles 50℃ 50min 1 70℃ 10min 1 4℃ ∞ 1
[0161] 5. Magnetic bead purification
[0162] 5.1. Take out the magnetic beads from the 4°C refrigerator, equilibrate at room temperature for at least 30 min, and then vortex to ensure mixing. Prepare 80% ethanol (freshly prepared).
[0163] 5.2 Transfer the product in the PCR tube to a 1.5 mL centrifuge tube, add magnetic beads with a volume of 1.8X (72 μL), vortex to mix evenly or pipette up and down 10 times, and let it stand at room temperature for 5 min.
[0164] 5.3 Place the centrifuge tube in the magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant with a pipette.
[0165] 5.4 Keep the centrifuge tube in the magnetic stand all the time. Slowly and gently add 200 μL of freshly prepared 80% ethanol, incubate at room temperature for 30 s, and carefully remove the supernatant.
[0166] 5.5 Repeat step 6.4.
[0167] 5.6 Keep the centrifuge tube in the magnetic stand all the time. Open the lid and dry at room temperature until the magnetic beads have no obvious luster.
[0168] 5.7 Remove the centrifuge tube and add 20 μL of DNase / RNase-Free Water, vortex to mix evenly or pipette up and down to mix, and let it stand at room temperature for 5 min.
[0169] 5.8 Place the centrifuge tube in the magnetic stand. After the solution becomes clear (about 5 min), carefully transfer 20 μL of the supernatant to a new PCR tube with a pipette to complete the purification.
[0170] 6. Ligate sequencing adapters
[0171] Add the following components to the PCR tube containing the purified product:
[0172]
[0173]
[0174] After mixing, run the following program on the PCR instrument:
[0175] Temperature Time Number of Cycles 20℃ 30min 1 4℃ ∞ 1
[0176] 7. Magnetic bead purification
[0177] 7.1 Take out the magnetic beads from the 4 °C refrigerator, equilibrate at room temperature for at least 30 min, and then vortex to ensure mixing.
[0178] 7.2 Add magnetic beads with a volume of 0.5X (20 μL) to the PCR tube in the previous step, vortex to mix evenly or pipette up and down 10 times, and let it stand at room temperature for 5 min.
[0179] 7.3 Place the PCR tube in the magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant with a pipette.
[0180] 7.4. Slowly add 150 μL of Wash Buffer, flick the centrifuge tube gently to resuspend the magnetic beads, place it back on the magnetic stand, and carefully remove the supernatant.
[0181] 7.5. Repeat step 8.4.
[0182] 7.6. Remove the PCR tube and add 21 μL of Elution Buffer, vortex thoroughly or pipette up and down to mix evenly, and let it stand at room temperature for 10 min.
[0183] 7.7. Place the PCR tube in the magnetic stand. After the solution becomes clear (about 5 min), carefully transfer 20 μL of the supernatant to a new tube using a pipette, and the purification is completed.
[0184] 7.8. Use Qubit to detect the concentration of the purified product. If the concentration is greater than 1 ng / μL, it can be used for sequencing on the machine.
[0185] 8. Sequence the constructed library on the MinION Mk1C.
[0186] 9. Data analysis after sequencing
[0187] 9.1 Use the cat command to merge all fq data to generate an fq file. Use the awk command to replace all U in the fq file with T.
[0188] 9.2 Use bwa to align the fq file to the ref sequence and use IGV to view the alignment results.
[0189] Results:
[0190] For the library construction method with customized RTA adapters, it can also be recognized for subsequent sequencing.
[0191] The embodiments of the present invention are not limited to those described in the above examples. Without departing from the spirit and scope of the present invention, those of ordinary skill in the art can make various changes and improvements in form and detail, and all of these are considered to fall within the protection scope of the present invention.
Claims
1. A sample preparation method for direct RNA detection by nanopore, comprising the following steps: (1) connecting the RNA to be tested to a reverse transcription adapter; 2) in the presence of a template switching oligonucleotide, using a reverse transcriptase with terminal transferase activity to perform reverse transcription to produce a complementary polynucleotide of the RNA to be tested and adding a non-template nucleotide at its 3' end, wherein the 3' end of the template switching oligonucleotide can hybridize with the non-template nucleotide, so that the reverse transcriptase uses the template switching oligonucleotide as a second template for reverse transcription, and extends the complementary polynucleotide to include a sequence complementary to the template switching oligonucleotide; 3) repairing the nick between the template switching oligonucleotide and the RNA to be tested, and connecting a nanopore sequencing adapter to the other end of the RNA to be tested to produce a sample that can be used for nanopore direct RNA sequencing. 2 . The method of claim 1 , wherein the 3′ terminal sequence complementary to the non-template nucleotide in the template-switching oligonucleotide is rGrGrG, rUrUrG or rGrUrG.
3. The method of claim 1 or 2, wherein the nanopore sequencing adapter comprises a motor protein binding site.
4. The method according to any one of claims 1 to 3, wherein a motor protein is bound to the nanopore sequencing adapter.
5. The method of claim 3 or 4, wherein the motor protein is a DNA helicase.
6. The method of any one of claims 1 to 5, wherein the template switching oligonucleotide is no less than 13 nucleotides in length.
7. The method of any one of claims 1 to 6, wherein the template switching oligonucleotide comprises a DNA portion located at the 5' end and an RNA portion located at the 3' end.
8. The method according to any one of claims 1 to 7, wherein in step 3), T4 RNA ligase 2, T3 DNA ligase or T4 DNA ligase is used to repair the nick between the template conversion oligonucleotide and the RNA to be detected.
9. A nanopore direct RNA detection sample prepared by the method according to any one of claims 1 to 8.
10. A nanopore direct RNA detection sample library prepared by the method according to any one of claims 1 to 8.
11. Nanopore direct RNA detection method, comprising: A test sample is prepared using the method according to any one of claims 1 to 8, and the sample is used for nanopore sequencing, wherein a nucleic acid chain containing the RNA to be tested is passed through the nanopore.
12. A kit comprising a template switching oligonucleotide, a reverse transcriptase and a ligase, wherein the reverse transcriptase has terminal transferase activity and can reverse transcribe to produce a complementary polynucleotide of the RNA to be tested and add a non-template nucleotide at its 3' end, the 3' end of the template switching oligonucleotide can hybridize with the non-template nucleotide so that the reverse transcriptase performs reverse transcription using the template switching oligonucleotide as a second template, and the ligase can repair the nick between the template switching oligonucleotide and the RNA to be tested. 13 . The kit according to claim 12 , wherein the 3′ terminal sequence complementary to the non-template nucleotide in the template switching oligonucleotide is rGrGrG, rUrUrG or rGrUrG.
14. The kit according to claim 12 or 13, wherein the template switching oligonucleotide has a length of not less than 13 nucleotides.
15. The kit according to any one of claims 12 to 14, wherein the template switching oligonucleotide comprises a DNA portion located at the 5' end and an RNA portion located at the 3' end.
16. The kit according to any one of claims 12 to 15, further comprising a reverse transcription adapter.
17. The kit according to any one of claims 12 to 16, further comprising a sequencing adapter comprising a motor protein binding site or binding to a motor protein.
18. The kit of claim 17, wherein the motor protein is a DNA helicase.
Citation Information
Cited By
Method, template adapter and kit for detecting integrity and accuracy of gRNA (guide Ribonucleic Acid) sequence
CN120843661A