Buffalo Y chromosome fluorescent probe as well as preparation method and application thereof

Abstract

The invention discloses a buffalo Y chromosome fluorescent probe as well as a preparation method and application thereof, the buffalo Y chromosome fluorescent probe is formed by PCR (polymerase chain reaction) amplification of a primer pair, the primer pair comprises a forward primer: AAGACTCTTCCTGTGCACA and a reverse primer: ATAGCCCGGGTATTTGTCTC, and the nucleotide sequence of the buffalo Y chromosome fluorescent probe is as shown in SEQ ID NO. 1. Compared with the prior art, the buffalo Y chromosome probe is obtained through two times of PCR amplification, the probe is prepared by using CY3-dUTP with a proper concentration as a fluorescent marker, and the probe has low cytotoxicity, high sensitivity and high specificity and can be applied to detection of buffalo Y sperms and buffalo early embryo sex.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to a buffalo Y chromosome fluorescent probe, a preparation method thereof, and an application thereof. Background Art

[0002] In modern livestock production, the economic benefits of different genders of the same livestock vary in different uses. For example, the lactation performance of female cows restricted by gender has a significant economic impact on dairy enterprises, while the faster growth rate and larger body size of male bulls affected by gender have a significant economic impact on meat enterprises. In buffalo breeding, if this gender difference can be fully utilized and the gender of offspring can be selected according to production needs, it will strongly promote the economic benefits of the corresponding industries and have great development potential.

[0003] Identifying and controlling sex chromosomes and applying them to artificial insemination are the keys to realizing the selection of livestock genders. Therefore, scientific research personnel have conducted a large number of practical studies on mammalian gender identification methods and established many gender identification methods, such as chromosome karyotype analysis, Y-chromosome enzyme activity detection method, and H-Y antigen detection method, etc. However, these methods are restricted by factors such as cost, time, and accuracy in production applications, resulting in their inability to be widely used. In recent years, molecular biology methods such as polymerase chain reaction (PCR) method, fluorescence in situ hybridization (FISH) method, and flow cytometry analysis have been used for gender identification. Among them, flow cytometry analysis separates sperm according to the difference in DNA content, and the accuracy of separating X sperm and Y sperm is relatively high, but its separation efficiency is low, which hinders its wide application. The FISH technology not only has the advantages of safety, rapidity, accuracy, high sensitivity, etc. of the PCR method, but also has the characteristics of intuitiveness and visualization. At the same time, the accuracy of the FISH technology is higher than that of flow cytometry analysis and can be used for precise analysis of a large number of samples.

[0004] From the perspectives of accuracy, sensitivity, and detection efficiency, the FISH technology is currently the best method for gender identification. However, in the field of buffalo gender identification, there is a lack of a Y chromosome fluorescent probe with low toxicity and strong specificity to the buffalo Y chromosome, and the Y chromosome fluorescent probe is the key for the FISH technology to achieve gender identification.

[0005] In this study, a highly sensitive buffalo Y chromosome probe was prepared, and on this basis, a FISH analysis technology for buffalo Y chromosome fluorescent probe was established to evaluate the ratio of separated sperm of buffalo and identify the gender of early embryos, further improving the buffalo gender control technology and providing technical support for the application of buffalo gender control technology.

[0006] The existing method for preparing probes generally only performs one PCR amplification. The defect of this preparation method is that the template amount is small, so it needs to be cycled more times or it is difficult to obtain a specific probe. Summary of the Invention

[0007] The object of the present invention is to provide a buffalo Y chromosome fluorescent probe, aiming to solve the problem that there is no buffalo Y chromosome probe with low toxicity, high sensitivity and good specificity in the current field of buffalo sex detection, resulting in the inability to carry out large-scale buffalo sex control.

[0008] Another object of the present invention is to provide a preparation method of a buffalo Y chromosome fluorescent probe, aiming to obtain a buffalo Y chromosome fluorescent probe with high sensitivity and high specificity.

[0009] Another object of the present invention is to provide an application of a buffalo Y chromosome fluorescent probe.

[0010] To achieve the above object, the present invention provides a buffalo Y chromosome fluorescent probe, and the nucleotide sequence of the buffalo Y chromosome fluorescent probe is shown in SEQ ID NO.1, wherein,

[0011] The specific SEQ ID NO.1 is as follows:

[0012] AAGACTCTTCCTCGTGCACAGACAGTCATAGCGCAAATGATCAATGTGA

[0013] AAGGGGAGAAAATGTTAGGGAGAGCAGCCAGGACCACATCAAGCGACC

[0014] CATGAACGCCTTCATTTTGTGGTCTCGTGAAGGAAGACGAAAGTTGGCT

[0015] CTAGAGAATCCCAAAATGAAAAACTCAGAGATCAGCAAGCAGCTGGGC

[0016] TATGAGTGGAAAAGGCTTACAGATGCTGAAAAGCGCCCATTCTTTGAGGAGGCACAGAGACTACTATCCATACACAGAGACAAATACCCGGGCTAT.

[0017] Preferably, in the above technical solution, the buffalo Y chromosome fluorescent probe is amplified by PCR with a primer pair, and the primer pair includes a forward primer and a reverse primer.

[0018] The forward primer SEQ ID NO.2: AAGACTCTTCCTCGTGCACA;

[0019] The reverse primer SEQ ID NO.3: ATAGCCCGGGTATTTGTCTC.

[0020] The working principle of the buffalo Y-chromosome fluorescent probe of the present invention:

[0021] The buffalo Y-chromosome fluorescent probe carries CY3 fluorescein and specifically hybridizes with the genes of the Y-chromosome or Y-sperm in early buffalo embryos. The Y-chromosome or Y-sperm in early buffalo embryos show a red fluorescence phenomenon under a fluorescence microscope, thereby identifying the sex of the embryos or separating Y-sperm.

[0022] The present invention also provides a method for preparing a buffalo Y-chromosome fluorescent probe. 3. The preparation method includes:

[0023] S1, Obtaining the Y-chromosome genome: Collect buffalo Y-chromosomes, add enzyme agents to release the Y-chromosome genome from the Y-chromosomes, and inactivate the enzymes;

[0024] S2, First-round PCR amplification: Prepare a primary PCR reaction system, and perform PCR amplification on the primary PCR reaction system to obtain a primary PCR product;

[0025] S3, Second-round PCR amplification: Take the primary PCR product to prepare a secondary PCR reaction system, and perform PCR amplification on the secondary PCR reaction system to obtain a Y-chromosome probe;

[0026] S4, Fluorescent labeling of the probe: Take the Y-chromosome probe to prepare a fluorescent labeling reaction system, and perform fluorescent labeling on the fluorescent labeling reaction system to obtain a labeled buffalo Y-chromosome fluorescent probe;

[0027] S5, Enzyme digestion and purification of the probe: Digest the labeled buffalo Y-chromosome fluorescent probe with Dnase I and then purify it to obtain a buffalo Y-chromosome fluorescent probe.

[0028] According to the above technical solution, the present application uses two rounds of PCR amplification to obtain a Y-chromosome probe. The principle is that the Y-chromosome probe belongs to a single-copy gene, and the content of the target sequence in the Y-chromosome genome is small. Degenerate primers are used for DOP-PCR on the Y-chromosome genome to fully amplify the template amount in a small amount of template, and then specific primers are used for the second-round PCR amplification to specifically amplify a target sequence with a length of 290 bp. This method enables the amplification of the target sequence to obtain sufficient target fragments, that is, the Y-chromosome probe, only by amplifying 30 cycles. The Y-chromosome probe is fluorescently labeled, purified, and sequenced to obtain a buffalo Y-chromosome fluorescent probe. This fluorescent probe has low toxicity, high sensitivity, and high specificity for the Y-chromosome and Y-sperm, and can be used for the separation of Y-sperm and X-sperm, as well as the sex identification of early buffalo embryos.

[0029] Preferably, in the above technical solution, the primary PCR reaction system consists of Buffer, degenerate primers, dNTPs, Taq enzyme, the Y chromosome genome, and sterile water. The nucleotide sequence of the degenerate primers is 5'-CCGACTCGGNNNNNNATGTGG-3'.

[0030] Preferably, in the above technical solution, the length of the primary PCR product is 200 - 700 bp.

[0031] Preferably, in the above technical solution, the secondary PCR reaction system includes the primary PCR product, 10×Buffer, primers, dNTPs, Taq enzyme, and sterile water. The primers are the forward primer AAGACTCTTCCTCGTGCACA and the reverse primer ATAGCCCGGGTATTTGTCTC.

[0032] Preferably, in the above technical solution, the reaction program for PCR amplification is pre-denaturation at 94°C for 5 - 7 min; denaturation at 94°C for 1 - 2 min; annealing at 50 - 60°C for 1 - 2 min, extension at 72°C for 2 - 5 min, for 10 - 30 cycles; final extension at 60 - 72°C for 20 min.

[0033] Preferably, in the above technical solution, the fluorescence labeling reaction system is the Y chromosome probe, 10×Buffer, primers, dNTPs, Taq enzyme, CY3-dUTP, and sterile water. The primers include the forward primer AAGACTCTTCCTCGTGCACA and the reverse primer

[0034] ATAGCCCGGGTATTTGTCTC.

[0035] A buffalo Y chromosome fluorescence probe as described above is applied to detect buffalo Y sperm.

[0036] A buffalo Y chromosome fluorescence probe as described above is applied to detect the sex of buffalo early embryos.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0038] (1) The present invention uses the buffalo Y chromosome genome as a template to obtain a buffalo Y chromosome probe through two rounds of PCR amplification, and prepares it using an appropriate concentration of CY3-dUTP as a fluorescent label. This probe has low cytotoxicity, high sensitivity, and high specificity for the buffalo Y chromosome, and can be used to detect both buffalo Y sperm and the sex of buffalo early embryos.

[0039] (2) The buffalo Y chromosome fluorescence probe of the present invention can effectively detect the sperm of Murrah buffalo, Nili buffalo, Mediterranean buffalo and Holstein cattle, and the analysis purity of Y sperm of Murrah buffalo, Nili buffalo and Mediterranean buffalo is higher than 89.1%, which has species universality and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The realization, functional characteristics and advantages of the object of the present invention will be further described with reference to the embodiments and the accompanying drawings.

[0041] Figure 1 is the electrophoresis pattern of the primary PCR product in Example 1 of the present invention;

[0042] Figure 2 is the electrophoresis pattern of the buffalo Y chromosome fluorescence probe of the present invention;

[0043] Figure 3 is the microscopic examination picture of fluorescence in situ hybridization analysis of the buffalo Y chromosome fluorescence probe and buffalo sperm;

[0044] Figure 4 is the microscopic examination picture of fluorescence in situ hybridization analysis of the buffalo Y chromosome fluorescence probe and buffalo early embryo cells. DETAILED DESCRIPTION OF THE INVENTION

[0045] The technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0046] The substances involved in the detailed description and their sources are as follows:

[0047] Blood samples: The buffalo tissues and semen collected in this experiment were provided by the buffalo farm of Guangxi Buffalo Research Institute.

[0048] Reagents: Proteinase K was purchased from MERCK; lymphocyte culture medium was purchased from Guangzhou Bide Biopharmaceutical Co., Ltd.; rTaq enzyme and dNTP (dATP, dTTP, dCTP, dGTP) were purchased from TaKaRa Bio Inc. (Dalian); DNA probe in situ hybridization detection kit was purchased from Beijing Dingguo Biotechnology Co., Ltd.; DNA Marker was purchased from Dongsheng Biotechnology Co., Ltd.; CY3-dUTP was purchased from Sigma, USA, and other reagents were all domestic common analytical pure.

[0049] Degenerate primer: 5'-CCGACTCGGNNNNNNATGTGG-3', synthesized by Shanghai Bioengineering Technology Service Co., Ltd.

[0050] Example 1

[0051] A method for preparing a fluorescence probe for the Y chromosome of a water buffalo, the preparation method is as follows:

[0052] S1. Obtain the Y chromosome genome:

[0053] S11. Collect the Y chromosome: Take the metaphase chromosome specimen prepared from the somatic cells of male water buffalo, in a sterile environment throughout the process; use a micro glass needle to pick out the Y chromosome in the metaphase chromosome specimen with the aid of a micromanipulator, transfer the Y chromosome to a PCR tube, collect 50 Y chromosomes in total, perform instantaneous centrifugation, and store for later use;

[0054] S12. Release the Y chromosome genome: Add 0.5 μL of proteinase K at 50 nm / mL to the PCR tube containing the Y chromosome, incubate at 37 °C for 30 min to depolymerize and disperse the Y chromosome, and degrade the protein on the Y chromosome to release the chromosome genome;

[0055] S13. Enzyme inactivation: Place the incubated PCR at 96 °C for 10 min to inactivate the proteinase K in the PCR tube, and perform the next treatment to obtain the Y chromosome genome.

[0056] S2. First-round PCR amplification:

[0057] S21. Prepare the primary PCR reaction system: Take 2.5 μL of 10× Buffer, 2.5 μL of degenerate primer (25 pmol / μL), 2.0 μL of dNTPs, 0.5 μL of Taq enzyme (5 U / μL), and 5 μL of the Y chromosome genome, add sterile water to a total volume of 25 μL to obtain the primary PCR reaction system;

[0058] S22. Take the primary PCR reaction system for the first-round degenerate oligonucleotide primed PCR (DOP-PCR) amplification to obtain the primary PCR product, where

[0059] The reaction program of the first-round DOP-PCR amplification is set as: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 1 min, annealing at 25 °C for 1.5 min, extension at 60 °C for 2 min, and a total of 10 cycles; final extension at 60 °C for 10 min.

[0060] The primary PCR product is electrophoresed in a 2% agarose gel, and the result is as Figure 1 shown Figure 1 Lane M is the 100 bp ladder marker, lane 1 is the primary PCR product, and lane 2 is the primary PCR product. FromFigure 1 In lanes 1 and 2, it can be observed that the sizes of the primary PCR product fragments mainly concentrate between 200 - 700 bp.

[0061] S3, Second-round PCR amplification:

[0062] S31, Prepare the secondary PCR reaction system: Take 5 μL of the primary PCR product as the template, add 2.5 μL of 10× Buffer, 2.5 μL of primers (25 pmol / μL), 2.0 μL of dNTPs, 0.5 μL of Taq enzyme (5 U / μL), and add water to a total volume of 25 μL to obtain the secondary PCR reaction system. Among them, the nucleotide sequences of the primer pair are specifically as follows:

[0063] Forward primer: AAGACTCTTCCTCGTGCACA,

[0064] Reverse primer: ATAGCCCGGGTATTTGTCTC;

[0065] S32, Take the secondary PCR reaction system for the second-round PCR amplification to obtain the Y chromosome probe. Among them,

[0066] The reaction program of the second-round PCR amplification is set as follows: Pre-denaturation at 94 °C for 5 min; Denaturation at 94 °C for 1 min; Annealing at 50 °C for 2 min, Extension at 72 °C for 5 min, 30 cycles; Final extension at 72 °C for 20 min.

[0067] S4, Fluorescent labeling of the probe:

[0068] S41, Prepare the fluorescent labeling reaction system: Take 20 μL of the Y chromosome probe, add 5 μL of 10× Buffer, 2.5 μL of primers (25 pmol / μL), 5.0 μL of dNTPs (10 pmol / μL), 0.5 μL of Taq enzyme (5 U / μL), 2.5 μL of CY3-dUTP, and add water to a total volume of 100 μL. Among them, the nucleotide sequences of the primer pair are specifically as follows:

[0069] Forward primer: AAGACTCTTCCTCGTGCACA,

[0070] Reverse primer: ATAGCCCGGGTATTTGTCTC;

[0071] S42, Take the fluorescent labeling reaction system for fluorescent labeling to obtain the labeled buffalo Y chromosome fluorescent probe. The fluorescent labeling reaction program is set as follows: Pre-denaturation at 94 °C for 7 min; Denaturation at 94 °C for 2 min; Annealing at 60 °C for 1 min, Extension at 72 °C for 2 min, 30 cycles; Final extension at 72 °C for 5 min.

[0072] S5, Digestion and Purification of the Probe: Incubate the labeled buffalo Y chromosome fluorescent probe with Dnase I at 37 °C for 30 min. Purify the labeled probe from the digestion product by affinity adsorption to obtain the buffalo Y chromosome fluorescent probe. The buffalo Y chromosome fluorescent probe can highly sensitively detect the Y chromosome of buffalo and is used for subsequent detection.

[0073] The electrophoresis results of the buffalo Y chromosome fluorescent probe in 2% agarose gel are as Figure 2 shown in lanes 1 and 2. Lane M is the 100 bp ladder marker. From Figure 2 lanes 1 and 2, it can be observed that the finally obtained buffalo Y chromosome fluorescent probe is mainly concentrated between 200 - 300 bp. The length of the finally obtained buffalo Y chromosome fluorescent probe is 290 bp. The nucleotide sequence of the buffalo Y chromosome fluorescent probe is specifically as follows:

[0074] AAGACTCTTCCTCGTGCACAGACAGTCATAGCGCAAATGATCAATGTGAAAGGGGAGAAAATGTTAGGGAGAGCAGCCAGGACCACATCAAGCGACCCATGAACGCCTTCATTTTGTGGTCTCGTGAAGGAAGACGAAAGTTGGCTCTAGAGAATCCCAAAATGAAAAACTCAGAGATCAGCAAGCAGCTGGGCTATGAGTGGAAAAGGCTTACAGATGCTGAAAAGCGCCCATTCTTTGAGGAGGCACAGAGACTACTATCCATACACAGAGACAAATACCCGGGCTAT.

[0075] Example 2

[0076] Application of a Buffalo Y Chromosome Fluorescent Probe in Fluorescence In Situ Hybridization Analysis of Buffalo Sperm

[0077] Depolymerize the sperm nuclear chromosomes of buffalo. The specific steps are as follows: After washing, centrifuging, DTT depolymerization, and fixation, the sperm are dropped onto a slide to make a sperm specimen slide, and then dehydrated through a series of anhydrous ethanol with concentrations of 70%, 90%, and 100%, followed by fluorescence in situ hybridization detection.

[0078] To detect whether the buffalo Y chromosome probe can be used for sperm chromosome analysis of different cattle breeds, after depolymerizing the sperm nuclear chromosomes of Murrah buffalo, Nili buffalo, Mediterranean buffalo, and Holstein cattle according to the above method, perform fluorescence in situ hybridization detection and analysis with the Y chromosome fluorescent probe respectively. The results are as Figure 3 shown.

[0079] From Figure 3 it can be seen that Figure 3 it includes a, b, c, and d, where Figure 3 a is a graph of the fluorescence reaction of Murrah buffalo sperm, Figure 3 b is a graph of the fluorescence reaction of Nili buffalo sperm, Figure 3 c is a graph of the fluorescence reaction of Mediterranean buffalo sperm, Figure 3 d is a graph of the fluorescence reaction of Holstein cattle sperm. The Y-chromosome fluorescence probe of the present invention can perform fluorescence in situ hybridization with the sperm of four bovine species, namely Murrah buffalo, Nili buffalo, Mediterranean buffalo, and Holstein cattle, and exhibit obvious red fluorescence signals, indicating that this buffalo fluorescence probe can effectively detect the sperm of different breeds of buffalo. Although this probe is developed based on the buffalo species, fluorescence signals can also be found in Holstein cattle sperm, indicating that this fluorescence probe can not only be used for the Y-chromosome analysis of buffalo sperm but also be applicable to the Y-chromosome analysis of Holstein cattle, confirming the species generality of this fluorescence probe in the buffalo species. In addition, 10,614 sperm fluorescence signals were counted, among which X sperm accounted for 47.3% (2,406 / 5,084), and Y sperm accounted for 48.7% (2,694 / 5,530). The ratio of X and Y sperm is close to 1:1, which is close to the theoretical value.

[0080] Buffalo sperm were separated by flow cytometry, and buffalo Y sperm were selected for fluorescence probe hybridization analysis or. The results are shown in Table 1.

[0081] Table 1 Analysis purity of Y sperm of different species of buffalo by fluorescence probe method and flow cytometry analysis

[0082] species fluorescent probe method flow analysis method Murrah buffalo 92.3％ 90.1％ Nili buffalo 89.1％ 87.6％ Mediterranean buffalo 90.4％ 86.7％

[0083] As can be seen from Table 1, a total of 4,950 fluorescence signals were counted for the separated Y sperm of Murrah buffalo. The purity of Y sperm detected by this fluorescence probe was 92.3%, and the analysis purity by flow cytometry was 90.1%. The fluorescence probe method had better results than the flow cytometry analysis method. A total of 5,862 fluorescence signals were counted for the separated Y sperm of Nili buffalo. The purity of Y sperm detected by this fluorescence probe was 89.1%, and the analysis purity by flow cytometry was 87.6%. The fluorescence probe method had better results than the flow cytometry analysis method. The purity of fluorescence in situ hybridization of the separated Y sperm of Mediterranean buffalo was 90.4%, compared with the analysis purity by flow cytometry of 86.7%. The fluorescence probe method had better results than the flow cytometry analysis method. The results confirmed that the prepared buffalo Y-chromosome probe has species specificity, high sensitivity, better analysis purity for Y sperm of different species of buffalo than the flow cytometry analysis method, and higher separation efficiency than the flow cytometry analysis method. Therefore, the buffalo Y-chromosome fluorescence probe of the present invention can be used for the determination and identification of buffalo X and Y sperm types, and has better separation purity and higher separation efficiency.

[0084] Example 3

[0085] An application of a buffalo Y chromosome fluorescent probe in the sex identification of buffalo early embryos, the specific method is as follows:

[0086] Prepare chromosome slide specimens of buffalo early embryo cells and bake the slides in an incubator at 50 °C for 2 - 3 h. Then, after a series of procedures such as hybridization with the probe, washing, signal amplification, counterstaining, and mounting of the specimen slides, observe with a fluorescence microscope. The results are as Figure 4 shown.

[0087] From Figure 4 it can be seen that Figure 4 includes a, b, and c, where Figure 4 a is a picture of the chromosomes of buffalo early embryo cells stained with DAPI, Figure 4 b is a picture after fluorescence in situ hybridization of the Y chromosome fluorescent probe with buffalo early embryo cells, Figure 4 c is Figure 4 a and Figure 4 b composite picture. From Figure 4 it can be seen that the buffalo Y chromosome fluorescent probe of the present invention can specifically bind to the Y chromosome in buffalo early embryos, making the embryonic Y chromosome show a red fluorescence reaction. The principle that this fluorescent probe can be used for the sex identification of buffalo early embryos is that the buffalo Y chromosome fluorescent probe of the present invention has high sensitivity and strong specificity for the Y chromosome of buffalo. If the buffalo early embryo contains a Y chromosome, a fluorescence reaction signal will appear after in situ hybridization with the fluorescent probe of the present invention. From Figure 4 obvious red fluorescence reaction can be seen in b, indicating that the buffalo early embryo cells contain a Y chromosome. The results show that the sex of the embryo is male; after further verification, it is determined that the sex of the buffalo early embryo is indeed male, which is consistent with the results of this experiment. This shows that the buffalo Y chromosome fluorescent probe of the present invention has strong specificity for the buffalo Y chromosome and can be used for the sex identification of buffalo early embryos. At the same time, it does not poison the cells of early embryos, and its direct use for identifying the sex of buffalo embryos has obvious hybridization signals, indicating that the probe has high sensitivity when identifying the sex of buffalo embryos.

[0088] The present invention can be implemented in various different ways and is not limited to the described embodiments. Those of ordinary skill in the art can understand that the present invention can be implemented by other specific methods without changing the technical idea or essential features of the present invention. Therefore, it should be understood that the above-described embodiments are exemplary and not intended to limit the present invention.

Claims

1. A buffalo Y chromosome fluorescent probe, characterized in that: The nucleotide sequence of the buffalo Y chromosome fluorescent probe is shown in SEQ ID NO.

1.

2. The buffalo Y chromosome fluorescent probe according to claim 1, characterized in that The buffalo Y chromosome fluorescent probe is amplified by PCR using a primer pair, wherein the primer pair includes a forward primer and a reverse primer. The forward primer: AAGACTCTTCCTCGTGCACA; The reverse primer: ATAGCCCGGGTATTTGTCTC.

3. A method for preparing a buffalo Y chromosome fluorescent probe as claimed in any one of claims 1 to 2, characterized in that: The preparation method comprises: S1, obtaining the Y chromosome genome: collecting the Y chromosome of buffalo, adding an enzyme to release the Y chromosome genome from the Y chromosome, and inactivating the enzyme; S2, first round of PCR amplification: preparing a primary PCR reaction system, taking the primary PCR reaction system for PCR amplification, and obtaining a primary PCR product; S3, second round of PCR amplification: taking the primary PCR product to prepare a secondary PCR reaction system, and performing PCR amplification on the secondary PCR reaction system to obtain a Y chromosome probe; S4, fluorescent labeling of the probe: preparing a fluorescent labeling reaction system with the Y chromosome probe, and carrying out fluorescent labeling with the fluorescent labeling reaction system to obtain a labeled buffalo Y chromosome fluorescent probe; S5, enzyme digestion and purification of the probe: the labeled buffalo Y chromosome fluorescent probe is digested with DNase I and purified to obtain the buffalo Y chromosome fluorescent probe.

4. The method for preparing the buffalo Y chromosome fluorescent probe according to claim 3, characterized in that: The primary PCR reaction system consists of Buffer, degenerate primers, dNTPs, Taq enzyme, the Y chromosome genome and sterile water, and the nucleotide sequence of the degenerate primer is 5'-CCGACTCGGNNNNNNATGTGG-3'.

5. The method for preparing the buffalo Y chromosome fluorescent probe according to claim 3, characterized in that: The length of the primary PCR product is 200-700 bp.

6. The method for preparing the buffalo Y chromosome fluorescent probe according to claim 3, characterized in that: The secondary PCR reaction system includes primary PCR product, 10×Buffer, primers, dNTPs, Taq enzyme and sterile water, wherein the primers are forward primer AAGACTCTTCCTCGTGCACA and reverse primer ATAGCCCGGGTATTTGTCTC.

7. The method for preparing the buffalo Y chromosome fluorescent probe according to claim 3, characterized in that: The reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 5-7 minutes; denaturation at 94°C for 1-2 minutes; annealing at 50-60°C for 1-2 minutes, extension at 72°C for 2-5 minutes, 10-30 cycles; and final extension at 60-72°C for 20 minutes.

8. The method for preparing the buffalo Y chromosome fluorescent probe according to claim 3, characterized in that: The fluorescent labeling reaction system comprises the Y chromosome probe, 10×Buffer, primers, dNTPs, Taq enzyme, CY3-dUTP and sterile water.

9. A buffalo Y chromosome fluorescent probe as claimed in any one of claims 1 to 2, used for detecting buffalo Y sperm.

10. A buffalo Y chromosome fluorescent probe as claimed in any one of claims 1 to 2, used for detecting the sex of buffalo early embryos.

Images