Method for rapidly and conveniently detecting DNA (deoxyribonucleic acid) at low cost

By treating DNA in alkaline and acidic solutions and performing in vitro transcription reactions, the existing DNA detection methods rely on expensive instruments and high costs are solved, and low-cost, fast and convenient DNA detection is achieved, suitable for agricultural fields and aquaculture and other fields.

CN120060445APending Publication Date: 2025-05-30TIANJIN YUEMINGDA BIOTECHNOLOGY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510344990.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Existing DNA detection methods rely on expensive instruments and are costly, making them unable to achieve fast and convenient on-site inspections, especially in agricultural fields and aquaculture.

Method used

The target DNA is treated by denatured in alkaline solution and a stable ligation with the target DNA in acid solution using a detection probe of a specific structure is then generated in an in vitro transcription reaction to achieve DNA detection.

Benefits of technology

It realizes low-cost, fast and convenient DNA detection, reduces dependence on instruments, simplifies operating steps, and is suitable for on-site micro DNA detection, especially in agricultural fields and aquaculture and other fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060445A_ABST
    Figure CN120060445A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of DNA detection, and particularly relates to a method for rapidly and conveniently detecting DNA at low cost. According to the method for detecting DNA provided by the invention, the DNA chain is subjected to denaturation treatment by adopting the alkaline solution, and then the DNA chain is renatured by adopting the acid solution, so that the detection probe with a specific structure can be well combined to the DNA chain, and in the subsequent in-vitro transcription process, the detection sensitivity is greatly improved. The RNA aptamer obtained by transcription of the detection probe can be specifically combined with malachite green dye in a transcription system to generate a fluorescence signal, so that target DNA detection is realized. The DNA detection method provided by the invention has the advantages of simple operation steps, low detection cost, good stability and the like, and can realize on-site rapid detection of trace DNA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the technical field of DNA detection, and more specifically, relates to a method for low-cost, rapid and convenient detection of DNA. Background Art

[0002] DNA detection is a technology for analyzing the structure, sequence or function of the whole DNA molecule or a specific segment, including detecting the integrity of the double-stranded structure, the status of single-strand break repair or the base arrangement in a specific region, etc. For example, the physical state (such as breakage, folding) or sequence information of the DNA strand is traced through fluorescence probes or electrophoresis technology. DNA detection has a wide range of applications in biomedical research and diagnosis, such as genetic disease diagnosis, early disease diagnosis, biological evolution research, genomics research, criminal investigation, etc.

[0003] Currently, the main methods for detecting DNA include Sanger sequencing, high-throughput sequencing, CRISPR detection, etc. Among them, the detection speed of Sanger sequencing is slow, which is difficult to meet the needs of large-scale DNA strand analysis, and the purchase cost of Sanger sequencers and the costs of instrument maintenance, calibration and upgrade are high. After sequencing, fragments need to be separated by capillary electrophoresis, and the operation steps are complex and the detection cost is high. For high-throughput sequencing methods, such as NGS, expensive sequencing kits are required during DNA detection, and the dependence on instruments is high. In the CRISPR-based detection method, Cas proteins have been widely used to detect DNA and RNA, but the purification process of Cas proteins is complex and the activity needs to be verified, which is time-consuming and consumable, and it is difficult to achieve on-site rapid and convenient detection in fields such as agricultural fields and aquaculture.

[0004] Therefore, there is an urgent need to develop a method that is applicable to fields such as agricultural fields and aquaculture and can detect DNA rapidly and at low cost on-site. Summary of the Invention

[0005] Aiming at the defects of the prior art, the purpose of this application is to provide a method for low-cost, rapid and convenient detection of DNA, aiming to solve the problems of high dependence on instruments, high temperature requirements, high detection cost, and inability to be used for on-site detection in existing DNA detection methods.

[0006] To achieve the above purpose, in the first aspect, this application provides a method for low-cost, rapid and convenient detection of DNA, including the following steps: S1. Mix the target DNA and the detection probe in an alkaline solution, denature the target DNA, and at the same time, through strand displacement reaction, make the detection probe bind to the single strand of the target DNA, and then add an acidic solution to adjust the pH of the system to neutral to form a stable complex of the detection probe and the target DNA; The 5'-to-3' sequence of the above detection probe sequentially includes a sequence for transcribing to generate an RNA aptamer, a complementary sequence that binds to a part of the above target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; S2. Mix the above complex and the transcription system, and perform an in vitro transcription reaction; The above transcription system includes an RNA polymerase and a malachite green dye. The RNA aptamer obtained by transcribing the detection probe on the above complex can specifically bind to the above malachite green dye to generate a fluorescence signal, thereby realizing the detection of the above target DNA.

[0007] Preferably, in step S1, the pH of the above alkaline solution is 11.5 - 13.0.

[0008] Preferably, in step S1, the molar ratio of the above alkaline solution to the above target DNA is (2×10 5 ~1×10 7 ):1.

[0009] More preferably, in step S1, the molar ratio of the above alkaline solution to the above target DNA is (2×10 5 ~7×10 6 ):1.

[0010] Preferably, in step S1, the time of the above denaturation treatment is 3 min - 5 min.

[0011] Preferably, in step S1, the length of the above detection probe is 100 bp - 140 bp.

[0012] Preferably, in step S1, the length of the above complementary sequence is 10 bp - 40 bp.

[0013] Preferably, in step S1, the above detection probe includes a primer probe and a reporter probe; The 5'-to-3' sequence of the above reporter probe sequentially includes a sequence for transcribing to generate an RNA aptamer and a first sequence that binds to a part of the above target DNA; The 5'-to-3' sequence of the above primer probe sequentially includes a phosphate group, a second sequence that binds to a part of the above target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; The above reporter probe and the above primer probe can be ligated by a DNA ligase to form the above detection probe, wherein the first sequence and the second sequence are ligated under the action of the DNA ligase to form the above complementary sequence.

[0014] Preferably, the above promoter sequence is one or more of a T7 promoter sequence, a T3 promoter sequence, and an Sp6 promoter sequence.

[0015] Preferably, in step S1, the sequence for transcribing and generating the RNA aptamer is 5'-GGATC CATTCGTTACCTGGCTCTCGCCAGTCGGGATCC-3'.

[0016] Preferably, in step S1, the above system further includes one or more of a nucleic acid extractant, a nucleic acid releasing agent, and a reverse transcriptase.

[0017] Preferably, in step S2, the above RNA polymerase is one or more of T7 RNA polymerase, T3 RNA polymerase, and Sp6 RNA polymerase.

[0018] Preferably, in step S2, the above transcription system further includes a substrate for in vitro transcription, an RNA inhibitor, and a buffer required for in vitro transcription.

[0019] Generally speaking, compared with the prior art, the above technical solution conceived by this application mainly has the following technical advantages: (1) The method for detecting DNA provided by this application can denature the DNA strand with an alkaline solution and then renature it with an acidic solution, enabling a detection probe with a specific structure to bind well to the DNA strand. In the subsequent in vitro transcription process, the RNA aptamer obtained from the in vitro transcription reaction of the detection probe can specifically bind to the malachite green dye in the transcription system to produce a fluorescence signal, thereby realizing the detection of target DNA. The method for detecting DNA provided by this application has the advantages of simple operation steps, low detection cost, good stability, etc., and can realize the on-site rapid detection of trace DNA.

[0020] (2) The method for detecting DNA provided by this application can denature and unwind and renature the DNA strand by preparing an alkaline solution - acidic solution system. Compared with the prior art, it eliminates the need to repeatedly regulate the temperature multiple times to achieve the denaturation and unwinding and renaturation of the DNA strand in traditional detection methods, has a low dependence on instruments, and greatly shortens the detection time. It can be used for the on-site rapid detection of trace DNA. In addition, the cost of preparing the alkaline solution - acidic solution system is low, the steps are simple, and the reagents can be stored stably for a long time.

[0021] (3) In the preferred embodiment, this application splits the detection probe into a start probe and a reporter probe, enabling the start probe and the reporter probe to bind well to the DNA strand during the denaturation - unwinding and renaturation process, which can improve the specificity of DNA detection, avoid non-specific binding of the detection probe to generate background signals, reduce the non-specificity of the detection result, and is not prone to false positive results. Description of the Drawings

[0022] Figure 1It is a schematic flow chart of a method for low-cost, rapid and convenient detection of DNA provided by this application; Figure 2 It is a schematic diagram of the principle for detecting DNA by the method provided by this application; Figure 3 It is the effect of detecting target DNA in Example 1 of this application; Figure 4 It is the effect of detecting target DNA in Example 2 of this application; Figure 5 It is the effect of detecting target DNA in Example 3 of this application; Figure 6 It is the effect of detecting target DNA in Example 4 of this application; Figure 7 It is the effect of detecting target DNA in Example 5 of this application; Figure 8 It is the effect of detecting target DNA in Comparative Example 1 of this application. Detailed implementation manners

[0023] In order to make the objectives, technical solutions and advantages of this application clearer, the following further details this application in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not used to limit this application.

[0024] In the description of this application, it should be understood that the term "and / or" is an association relationship describing associated objects, indicating that three relationships may exist. For example, A and / or B may represent: A exists alone, A and B exist simultaneously, and B exists alone. The symbol " / " in this article represents an "or" relationship between associated objects. For example, A / B represents A or B.

[0025] In the description of the specification and claims of this application, the terms "first", "second", etc. are used to distinguish different objects, rather than to describe the specific order of objects, and should not be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features.

[0026] In the description of the embodiments of this application, words such as "exemplary" or "for example" are used to represent examples, illustrations or explanations. Any embodiment or design solution described as "exemplary" or "for example" in the embodiments of this application should not be construed as being more preferred or having more advantages than other embodiments or design solutions. Exactly speaking, using words such as "exemplary" or "for example" aims to present relevant concepts in a specific manner.

[0027] In the description of the embodiments of this application, unless otherwise specified, the meaning of "a plurality of" refers to two or more.

[0028] Such as Figure 1As shown, the present application provides a method for detecting DNA with low cost, high speed and convenience, including the following steps: S1. Mix the target DNA and the detection probe in an alkaline solution, denature the above-mentioned target DNA, and at the same time, through strand displacement reaction, make the above-mentioned detection probe bind to the single strand of the above-mentioned target DNA, and then add an acidic solution to adjust the pH of the system to neutral to form a complex in which the above-mentioned detection probe is stably connected to the above-mentioned target DNA; The 5'-to-3' sequence of the above-mentioned detection probe sequentially includes a sequence for transcribing into an RNA aptamer, a complementary sequence that binds to a part of the above-mentioned target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; S2. Mix the above-mentioned complex and the transcription system, and carry out an in vitro transcription reaction; The above-mentioned transcription system includes malachite green dye, and the RNA aptamer obtained by transcribing the detection probe on the above-mentioned complex can specifically bind to the above-mentioned malachite green dye to generate a fluorescence signal, thereby realizing the detection of the above-mentioned target DNA.

[0029] As Figure 2 shown, in the present application, the DNA strand is denatured by using an alkaline solution, and then after renaturation with an acidic solution, a detection probe with a specific structure (including a promoter probe L1 and a reporter probe L2) can be well bound to the DNA strand and connected to form a detection probe. During the in vitro transcription process, the RNA aptamer obtained by transcribing the detection probe can specifically bind to the malachite green dye in the transcription system to generate a fluorescence signal, thereby realizing the detection of the target DNA. The DNA detection method provided by the present application does not require the use of instruments such as PCR, and does not require repeated temperature regulation. The steps of preparing the alkaline denaturing solution-acidic composite solution system are simple, low in cost, and can be stored stably for a long time. It can realize the on-site detection of trace DNA, and has the advantages of low cost, short time consumption and good stability.

[0030] In some embodiments, in step S1, the pH of the above-mentioned alkaline solution is 11.5-13.0, and the molar ratio of the above-mentioned alkaline solution to the above-mentioned target DNA is (2×10 5 ~1×10 7 ):1. When the pH of the alkaline solution is too high or the molar ratio of the alkaline solution to the above-mentioned target DNA is too large, serious fragmentation of the DNA strand will occur; when the pH of the alkaline solution is too low or the molar ratio of the alkaline solution to the above-mentioned target DNA is too small, the DNA double strand cannot be completely opened.

[0031] In a preferred embodiment, the molar ratio of the above-mentioned alkaline solution to the above-mentioned target DNA is (2×10 5 ~7×10 6 ):1. More preferably, the molar ratio of the above-mentioned alkaline solution to the above-mentioned target DNA is (2.11×105 ~6.67×10 6 ):1。

[0032] It can be understood that the present application does not limit the alkaline reagent for preparing the above alkaline solution, which may be but not limited to sodium hydroxide, potassium hydroxide, etc. The present application does not limit the acidic reagent for preparing the above acidic solution, which may be but not limited to hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, etc.

[0033] In some embodiments, in step S1, the time of the above denaturation treatment is 3 min to 5 min, which can cause the target DNA to denature and the double strand to unwind, so that the above detection probe can bind to the target DNA strand, avoiding too long denaturation treatment time, resulting in too serious fragmentation of the DNA strand, thereby reducing the amount of detectable DNA fragments; or too short denaturation treatment time, resulting in incomplete opening of the DNA double strand and unable to effectively bind the above detection probe to the target DNA strand.

[0034] In some embodiments, the molar ratio of the above detection probe to the above target DNA is (10~200):1. When the molar ratio of the detection probe to the target DNA is too high, interference signals may be generated, thereby reducing the specificity of the detection.

[0035] In some embodiments, in step S1, the length of the above target DNA is 50 bp to 600 bp.

[0036] In some embodiments, in step S1, the length of the above detection probe is 100 bp to 140 bp.

[0037] In some embodiments, in step S1, the length of the above complementary sequence is 10 bp to 40 bp. When the length of the complementary sequence is too short, the detection probe cannot effectively bind to the target DNA sequence, resulting in a weak fluorescence detection signal of the target DNA; when the length of the complementary sequence is too long, it may form a complementary sequence by itself, thereby reducing the specificity of the target DNA detection.

[0038] In some embodiments, to improve the specificity of DNA detection and avoid background signals caused by non-specific binding of detection probes, the above detection probes can be split into a primer probe and a reporter probe. The 5'-to-3' sequence of the reporter probe sequentially includes a sequence for transcribing an RNA aptamer and a first sequence that binds to a part of the above target DNA; the 5'-to-3' sequence of the primer probe sequentially includes a phosphate group, a second sequence that binds to a part of the above target DNA, and a sequence containing a promoter sequence and having a stem-loop structure. Under the action of DNA ligase, the 3'-terminal hydroxyl group of the reporter probe and the 5'-terminal phosphate group of the primer probe are connected under the action of DNA ligase to generate the above detection probe, wherein the first sequence and the second sequence are connected to form a complementary sequence in the above detection probe.

[0039] It can be understood that the types of the above DNA ligases are not limited in this application, and DNA ligases reported in the prior art that can be used to ligate DNA sequences are all within the protection scope of this application. In some embodiments, the above DNA ligase can be, but is not limited to, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, etc.

[0040] In some embodiments, the length of the sequence containing a promoter sequence and having a stem-loop structure is 45bp - 75bp, which can enhance the stability of the above primer probe structure and improve the transcription efficiency. In a specific embodiment of this application, the sequence containing a promoter sequence and having a stem-loop structure is 5'-CCCTA TAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGG-3'.

[0041] Without being limited by theory, the promoter sequence used in this application can be any promoter sequence that can be recognized, bound by RNA polymerase in vitro and start transcription to generate RNA. Since the promoter sequence is designed in the detection probe, the promoter sequence should not be too long, and is preferably a T7 promoter sequence, a T3 promoter sequence or an Sp6 promoter sequence. Correspondingly, in step S2, the RNA polymerase in the in vitro transcription system is T7 RNA polymerase, T3 RNA polymerase or Sp6 RNA polymerase.

[0042] In some embodiments, to improve the stability of the detection probe, the initiation probe, and the reporter probe, so that the above-mentioned probes can better bind to the target DNA, a protecting base can be used to connect the sequence for transcribing the RNA aptamer and the first sequence that binds to a part of the above-mentioned target DNA, as well as the second sequence that binds to a part of the above-mentioned target DNA and the sequence containing the promoter sequence and having a stem-loop structure. In some embodiments, the length of the above-mentioned protecting base is 1 bp to 3 bp, and it can be, but is not limited to, A, T, AT, ACG, ACC, etc.

[0043] In some embodiments, the sequence for transcribing the RNA aptamer is 5'-GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCC-3'.

[0044] In some embodiments, in step S1, the above-mentioned system further includes a buffer and other components. Among them, the above-mentioned buffer can be any specific or general buffer known in the art and applicable to the present application, including but not limited to SENSR buffer, Tris-HCl, or phosphate buffer. The above-mentioned other components include but are not limited to nuclease-free water.

[0045] In some embodiments, in step S1, the above-mentioned system further includes one or more of a nucleic acid extractant, a nucleic acid releasing agent, and a reverse transcriptase. Among them, the above-mentioned nucleic acid extractant is used to extract the nucleic acid of the sample to be detected. The above-mentioned nucleic acid releasing agent is used to release the nucleic acid in the sample to be detected. The above-mentioned reverse transcriptase is used to reverse transcribe the target RNA into target DNA.

[0046] In some embodiments, in step S2, the above-mentioned RNA polymerase is one or more of T7 RNA polymerase, T3 RNA polymerase, and Sp6 RNA polymerase.

[0047] In some embodiments, in step S2, the above-mentioned transcription system further includes substrates for in vitro transcription, an RNA inhibitor, a buffer required for in vitro transcription, and other components.

[0048] In some embodiments, the above-mentioned substrates for in vitro transcription are nucleoside triphosphates; the above-mentioned buffer required for in vitro transcription can be any specific or general buffer known in the art and applicable to the present application, including but not limited to SENSR buffer, Tris-HCl, or phosphate buffer. The above-mentioned RNA inhibitor is a ribonuclease inhibitor, which can specifically bind to and inhibit the activity of RNase (ribonuclease), protecting RNA from degradation by RNase. The above-mentioned other components include but are not limited to nuclease-free water.

[0049] It should be understood that materials that are the same as or similar to the types, models, qualities, properties, or functions of the reagents and instruments used in the following embodiments can be used to implement this application. Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0050] The following are examples and comparative examples: Example 1 The low-cost, rapid, and convenient method for detecting DNA provided in this example includes the following steps: 1. Prepare an alkaline stock solution and an acidic stock solution Take 4 g of NaOH and 100 mL of ultrapure water and mix them evenly to prepare an alkaline stock solution, that is, the NaOH stock solution, and store it at 4 °C for later use. Take 10 μL of concentrated hydrochloric acid with a concentration of 12 mol / L and 110 μL of ultrapure water and mix them evenly to prepare an acidic stock solution, that is, the HCl stock solution, and store it at 4 °C for later use.

[0051] 2. Prepare an alkaline denaturing solution and an acidic neutralizing solution Take 20 μL of the NaOH stock solution and 180 μL of nuclease-free water and mix them evenly to prepare an NaOH solution with a pH of 13 and a concentration of 0.1 mol / L as the alkaline denaturing solution of this example. Take 20 μL of the HCl stock solution and 180 μL of nuclease-free water and mix them evenly to prepare an HCl solution with a pH of 1 and a concentration of 0.1 mol / L as the acidic neutralizing solution of this example.

[0052] 3. Target DNA detection 3.1 Target DNA construction and probe design The target DNA (G4915) in this example is extracted from Drosophila, and its sequence is shown in Table 1. And a start probe L1 (G4915E-L1) and a reporter probe L2 (G4915E-L2) are designed for the above target DNA. The 5' to 3' sequence of the start probe L1 successively includes a phosphate group (PO 4 ), a second sequence (the underlined sequence) that binds to part of the above target DNA, a protecting base (the bolded sequence, that is, AT), and a sequence containing a promoter sequence and having a stem-loop structure; the 5' to 3' sequence of the reporter probe L2 successively includes a sequence for transcribing an RNA aptamer, a protecting base (the bolded sequence, that is, ACC), and a first sequence (the underlined sequence) that binds to part of the above target DNA.

[0053] Table 1 Sequence information of target DNA, start probe L1, and reporter probe L2

[0054] 3.2 Target DNA Denaturation and Probe Ligation Perform the denaturation of the target DNA and the ligation of the initiation probe L1 and the reporter probe L2 according to the reaction system shown in Table 2. The specific steps are as follows: Mix 0.75 μL of the target DNA (dsDNA) with a concentration of 100 nM, 0.75 μL of the initiation probe L1 with a concentration of 1 μM, and 0.75 μL of the reporter probe L2 with a concentration of 1 μM. Then add 5 μL of the above alkaline denaturation solution and treat for 4 min to unwind the double-stranded target DNA. Next, add 5 μL of the above acidic neutralization solution and treat for 1 min to enable the initiation probe L1 and the reporter probe L2 to bind well to the DNA strand. Then add 0.75 μL of 10×SENSR Buffer and mix well. Finally, add 1 μL of T4 DNA ligase (concentration: 50 U / μL) and incubate at 25 °C for 3 h to link the 5'-terminal phosphate group of the initiation probe L1 and the 3'-terminal hydroxyl group of the reporter probe L2, forming a phosphodiester bond and generating a long detection probe with a T7 promoter at the 3'-end and a stem-loop structure, and an RNA aptamer sequence at the 5'-end, obtaining a complex with the long detection probe stably bound to the target DNA strand.

[0055] Table 2 Target DNA Denaturation System

[0056] 3.3 In Vitro Transcription Transcription was carried out according to the in vitro transcription system shown in Table 3, which specifically included the following steps: 16 μL of the product from Step 3.2, 1.5 μL of 10×SENSR buffer, 0.15 μL of RNA Inhibitor with a concentration of 40 U / μL, 2 μL of T7 RNA polymerase, 1.5 μL of Malachite Green (MG) dye with a concentration of 320 μM, 7.5 μL of ATP with a concentration of 20 nM, 7.5 μL of UTP with a concentration of 20 nM, 7.5 μL of GTP with a concentration of 20 nM, 7.5 μL of CTP with a concentration of 20 nM, and 0.6 μL of nuclease-free water were added to 30 μL, and the transcription reaction was carried out at 37 °C, denoted as the S treatment group. During the in vitro transcription process, the long detection probe bound to the target DNA strand starts to transcribe a large amount of RNA aptamers under the action of T7 RNA polymerase. This RNA aptamer can specifically bind to the malachite green dye to produce a fluorescence signal, and the amount of the transcription product is determined according to the fluorescence intensity to achieve the detection of the target DNA. To more intuitively observe the situation of in vitro transcription, the fluorescence signal was collected once per minute in this example.

[0057] In the transcription system of the control group, T7 RNA polymerase was not added, and the others were the same as the experimental group, denoted as the D treatment group.

[0058] Table 3 In vitro transcription system

[0059] 4. Experimental results It can be seen that Figure 3 as the transcription time increases, the fluorescence intensity gradually increases, and the fluorescence intensity is significantly higher than that of the control group, indicating that the method provided in this application can produce obvious fluorescence signals under the condition of trace target DNA concentration.

[0060] Example 2 Prepare an alkaline denaturing solution and an acidic neutralizing solution Take 31.6 μL of the NaOH solution (pH 13, concentration 0.1 mol / L) prepared in Step 2 of Example 1 and 68.4 μL of nuclease-free water and mix them evenly to prepare a NaOH solution with a pH of 12.5 and a concentration of 0.0316 mol / L as the alkaline denaturing solution of this example.

[0061] Take 31.6 μL of the HCl solution prepared in Step 2 of Example 1 (pH = 1, concentration = 0.1 mol / L) and mix it with 68.4 μL of nuclease-free water to prepare an HCl solution with a pH of 1.5 and a concentration of 0.0316 mol / L as the acidic neutralization solution for this example.

[0062] 2. Target DNA Detection 2.1 The construction of the target DNA and the design of the probe are the same as in Step 3.1 of Example 1.

[0063] 2.2 The denaturation of the target DNA and the ligation of the probe are the same as in Step 3.2 of Example 1.

[0064] 2.3 In vitro transcription is the same as in Step 3.3 of Example 1.

[0065] 3. Experimental Results As Figure 4 can be seen, compared with the control group, after the target DNA is treated with the system of the alkaline denaturation solution - acidic composite solution provided in this example, significant fluorescence intensity can be generated after transcription, indicating that this example can be used for sensitive, rapid, and on-site detection of trace DNA. In addition, the fluorescence signal of the control group is relatively stable, indicating good stability of the system.

[0066] Example 3 1. Preparation of the Alkaline Denaturation Solution and the Acidic Neutralization Solution Take 10 μL of the NaOH solution prepared in Step 2 of Example 1 (pH = 13, concentration = 0.1 mol / L) and mix it with 90 μL of nuclease-free water to prepare a NaOH solution with a pH of 12 and a concentration of 0.01 mol / L as the alkaline denaturation solution for this example.

[0067] Take 10 μL of the HCl solution prepared in Step 2 of Example 1 (pH = 1, concentration = 0.1 mol / L) and mix it with 90 μL of nuclease-free water to prepare an HCl solution with a pH of 2 and a concentration of 0.01 mol / L as the acidic neutralization solution for this example.

[0068] 2. Target DNA Detection 2.1 The construction of the target DNA and the design of the probe are the same as in Step 3.1 of Example 1.

[0069] 2.2 The denaturation of the target DNA and the ligation of the probe are the same as in Step 3.2 of Example 1.

[0070] 2.3 In vitro transcription is the same as in Step 3.3 of Example 1.

[0071] 3. Experimental Results As Figure 5 shown, when the target DNA is treated with the system of the alkaline denaturing solution - acidic composite solution provided in this embodiment, significant fluorescence intensity can also be generated after transcription, enabling on-site detection of trace DNA.

[0072] Example 4 1. Preparation of Alkaline Denaturing Solution and Acidic Neutralization Solution Take 3.16 μL of the NaOH solution (pH = 13, concentration = 0.1 mol / L) prepared in Step 2 of Example 1 and 96.84 μL of nuclease-free water and mix them evenly to prepare a NaOH solution with a pH of 11.5 and a concentration of 0.00316 mol / L as the alkaline denaturing solution of this embodiment.

[0073] Take 3.16 μL of the HCl solution (pH = 1, concentration = 0.1 mol / L) prepared in Step 2 of Example 1 and 96.84 μL of nuclease-free water and mix them evenly to prepare an HCl solution with a pH of 2.5 and a concentration of 0.00316 mol / L as the acidic neutralization solution of this embodiment.

[0074] 2. Target DNA Detection 2.1 The construction of the target DNA and the design of the probe are the same as in Step 3.1 of Example 1.

[0075] 2.2 The denaturation of the target DNA and the ligation of the probe are the same as in Step 3.2 of Example 1.

[0076] 2.3 In vitro transcription is the same as in Step 3.3 of Example 1.

[0077] 3. Experimental Results It can be seen from Figure 6 that compared with the control group, this embodiment has significant fluorescence intensity, indicating that the system based on the alkaline denaturation - acidic composite provided in this embodiment can be used for the detection of trace DNA.

[0078] Example 5 1. Preparation of the alkaline denaturing solution and the acidic neutralization solution is the same as in Steps 1 and 2 of Example 1.

[0079] 2.2 Target DNA Detection 2.1 The construction of the target DNA and the design of the probe are the same as in Step 3.1 of Example 1.

[0080] 2.2 Denaturation of the target DNA and ligation of the probe Same as step 3.2 of Example 1, where the target DNA denaturation system is shown in Table 4, and the molar ratio of the alkaline denaturation solution to the target DNA is 2.22×10 6 :1.

[0081] Table 4 Target DNA denaturation system

[0082] 2.3 In vitro transcription is the same as step 3.3 of Example 1.

[0083] 3. Experimental results It can be seen from Figure 7 that compared with the control group, the experimental group of this example has significant fluorescence intensity, indicating that the alkaline denaturation-acid composite system provided in this example can be used for the detection of trace DNA.

[0084] Comparative Example 1 1. Prepare the alkaline denaturation solution and the acidic neutralization solution in the same manner as steps 1 and 2 of Example 1.

[0085] 2.2 Target DNA detection 2.1 Construction of the target DNA and probe design are the same as step 3.1 of Example 1.

[0086] 2.2 Target DNA denaturation and probe ligation Same as step 3.2 of Example 1, where the target DNA denaturation system is shown in Table 5, and the molar ratio of the alkaline denaturation solution to the target DNA is 2.22×10 7 :1.

[0087] Table 5 Target DNA denaturation system

[0088] 2.3 In vitro transcription is the same as step 3.3 of Example 1.

[0089] 3. Experimental results It can be seen from Figure 8 that the experimental group and the control group could not produce effective fluorescence intensity. Possibly, the molar ratio of the alkaline solution to the target DNA was too high, the stability of the target DNA in the alkaline denaturation solution-acid composite solution system was poor, and the DNA strand fragmentation was severe, making it impossible to achieve the detection of the target DNA.

[0090] In summary, in the present application, the target DNA strand is denatured by using an alkaline solution with an appropriate pH, and the molar ratio of the alkaline solution to the target DNA is regulated. Then, after renaturation with an acidic solution, the initiation probe L1 and the reporter probe L2 with specific structures can be well bound to the target DNA strand and ligated to form a long detection probe. The RNA aptamer transcribed from the detection probe can specifically bind to malachite green to produce a significant fluorescence intensity, thus enabling on-site detection of the target DNA. The DNA detection method provided by the present application does not require the aid of instruments such as PCR, and does not require repeated regulation of temperature and the like. The steps of preparing the alkaline denaturing solution - acidic renaturing solution system are simple, low in cost, and can be stably stored for a long time. It is suitable for on-site detection of trace DNA in fields such as agricultural fields and aquaculture, and has the advantages of low cost, short time consumption, and good stability, facilitating popularization and application.

[0091] It is easy for those skilled in the art to understand that the above are only preferred embodiments of the present application, and are not intended to limit the present application. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present application shall be included within the protection scope of the present application.

Claims

1. A low-cost, fast and convenient method for detecting DNA, characterized in that: The steps include: S1, mixing the target DNA and the detection probe in an alkaline solution, denaturing the target DNA, and simultaneously allowing the detection probe to bind to the single strand of the target DNA through a strand displacement reaction, and then adding an acidic solution to adjust the pH of the system to neutral, forming a complex in which the detection probe and the target DNA are stably connected; The 5' to 3' sequence of the detection probe includes, in sequence, a sequence for transcription to generate an RNA aptamer, a complementary sequence that binds to a portion of the target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; S2, mixing the complex and the transcription system to perform an in vitro transcription reaction; The transcription system includes RNA polymerase and malachite green dye. The RNA aptamer obtained by transcription of the detection probe on the complex can specifically bind to the malachite green dye to generate a fluorescent signal, thereby realizing the detection of the target DNA.

2. The method according to claim 1, characterized in that: In step S1, the pH of the alkaline solution is 11.5-13.

0.

3. The method according to claim 2, characterized in that In step S1, the molar ratio of the alkaline solution to the target DNA is (2×10 5 ~1×10 7 ):

1.

4. The method according to claim 1, characterized in that In step S1, the denaturation treatment time is 3 min to 5 min.

5. The method according to claim 1, characterized in that: In step S1, the length of the detection probe is 100 bp to 140 bp; Preferably, the length of the complementary sequence is 10 bp to 40 bp.

6. The method according to claim 1 or 5, characterized in that: In step S1, the detection probe includes an activation probe and a reporter probe; The 5' to 3' sequence of the reporter probe includes, in sequence, a sequence for transcription to generate an RNA aptamer and a first sequence that binds to a portion of the target DNA; The 5' to 3' sequence of the activation probe sequentially includes a phosphate group, a second sequence that binds to a portion of the target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; The reporter probe and the start probe can be connected by DNA ligase to form the detection probe, wherein the first sequence and the second sequence are connected under the action of DNA ligase to form the complementary sequence.

7. The method according to claim 1 or 6, characterized in that: The promoter sequence is one or more of a T7 promoter sequence, a T3 promoter sequence and a Sp6 promoter sequence; and / or, The sequence used for transcription to generate RNA aptamers is 5'-GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCC-3'.

8. The method according to claim 1, characterized in that In step S1, the system further comprises one or more of a nucleic acid extracting agent, a nucleic acid releasing agent, and a reverse transcriptase.

9. The method according to claim 1, characterized in that In step S2, the RNA polymerase is one or more of T7 RNA polymerase, T3 RNA polymerase and Sp6 RNA polymerase.

10. The method according to claim 1 or 9, characterized in that: In step S2, the transcription system further includes a substrate for in vitro transcription, an RNA inhibitor and a buffer required for in vitro transcription.