Composition and method for detecting eDNA of dolphin sinensis in seawater sample based on micro-fluidic chip type digital PCR technology

Abstract

The invention discloses a composition and a method for detecting eDNA of dolphin sinensis in a seawater sample based on a micro-fluidic chip type digital PCR technology. The composition comprises an upstream primer F1, a downstream primer R1 and a probe T1, the sequence of the upstream primer F1 is as shown in SEQ ID NO.1, the sequence of the downstream primer R1 is as shown in SEQ ID NO.2, and the sequence of the probe T1 is as shown in SEQ ID NO.3. The invention further discloses a method for detecting eDNA of dolphin sinensis in a seawater sample based on the micro-fluidic chip type digital PCR technology. By establishing the digital PCR detection method for the eDNA of the Chinese dolphin in the seawater sample, absolute quantitative analysis of the eDNA of the Chinese dolphin in the seawater sample can be completed, existence of a target gene as low as 0.0845 copies / [mu] L can be detected, and compared with traditional PCR and qPCR technologies, the method has higher sensitivity, accuracy and stability.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a composition and method for detecting eDNA of Chinese white dolphins in seawater samples based on microfluidic chip-based digital PCR technology. Background Art

[0002] With the increasing demand for biodiversity conservation, environmental DNA (eDNA) technology has become an important tool for monitoring aquatic species. By detecting free DNA in water bodies, eDNA technology can accurately track the presence of species without disturbing the ecosystem, especially in the monitoring of endangered species, such as the Chinese white dolphin (Sousa chinensis).

[0003] Traditional monitoring methods for Chinese white dolphins, such as visual observation and acoustic monitoring, have certain limitations. It is difficult to comprehensively and accurately evaluate the distribution of species, especially in large-scale or complex environments. The eDNA technology can collect DNA in seawater samples, is not restricted by the environment, and can detect the DNA of target species with high sensitivity, which is an effective species monitoring method.

[0004] In gene detection, PCR amplification and qPCR amplification are commonly used technologies, but they also have some limitations. Although the traditional PCR method can perform gene amplification, it cannot perform quantitative analysis and is easily affected by template concentration and background interference. Although qPCR can achieve quantitative detection, it depends on the standard curve, and its sensitivity and accuracy are limited by the reaction efficiency and template concentration. Especially in low-abundance samples, it may lead to errors. In addition, qPCR requires strict control of reaction conditions and is sensitive to non-specific amplification, which affects the accuracy of detection results.

[0005] In contrast, digital PCR (dPCR) technology can achieve absolute quantification of target DNA by dividing the reaction system into multiple independent tiny reaction units without relying on a standard curve. Each reaction unit contains only one or zero target DNA molecules, significantly improving sensitivity and accuracy. Digital PCR has a high anti-interference ability, can effectively reduce background noise and non-specific amplification, and is particularly suitable for the detection of low-copy number samples. Summary of the Invention

[0006] The object of the present invention is to provide a composition for detecting eDNA of Chinese white dolphins in seawater samples based on microfluidic chip-based digital PCR technology.

[0007] The object of the present invention is also to provide a method for detecting eDNA of Chinese white dolphins in seawater samples based on microfluidic chip-based digital PCR technology.

[0008] The above first object of the present invention can be achieved by the following technical solution: A composition for detecting the eDNA of the Chinese white dolphin in a seawater sample based on a microfluidic chip-based digital PCR technology, the composition comprising an upstream primer F1, a downstream primer R1, and a probe T1, the sequence of the upstream primer F1 being as shown in SEQ ID NO.1, the sequence of the downstream primer R1 being as shown in SEQ ID NO.2, and the sequence of the probe T1 being as shown in SEQ ID NO.3.

[0009] Primer and probe combination, the sequences are as follows:

[0010] Upstream primer F1: GCCCATTTTCACTATGTGCTTTC (SEQ ID NO.1);

[0011] Downstream primer R1: GGAAGTGTTGTGGGAAGAATGTC (SEQ ID NO.2);

[0012] Probe T1: TCTTTGCCATCATAGGAGGTTTCGTTCA (SEQ ID NO.3).

[0013] Preferably, the 5' end of the probe T1 is modified with a fluorescent reporter group, and the 3' end of the probe is modified with a quenching group. The fluorescent reporter group is FAM, and the quenching group is BHQ1.

[0014] The present invention also discloses a kit for detecting the eDNA of the Chinese white dolphin in a seawater sample based on a microfluidic chip-based digital PCR technology, the kit containing the above composition.

[0015] The above second object of the present invention can be achieved by the following technical solution: A method for detecting the eDNA of the Chinese white dolphin in a seawater sample based on a microfluidic chip-based digital PCR technology, comprising the following steps:

[0016] (1) Prepare a digital PCR reaction system: The digital PCR reaction system includes the above upstream primer F1, downstream primer R1, probe T1, as well as a digital PCR premix and an eDNA template;

[0017] (2) Droplet formation treatment: Place the oil-phase encapsulating reagent and the digital PCR reaction system in step (1) into the oil holes and sample holes of the chip of the microfluidic chip-based digital PCR device, start the droplet generator to generate droplets;

[0018] (3) PCR amplification: Perform thermal cycling on the microfluidic chip-based digital PCR device;

[0019] (4) Fluorescence signal acquisition: After the PCR amplification is completed, the chip is scanned in a biochip reader to obtain fluorescence signals and related data.

[0020] Preferably, in step (1), the digital PCR reaction system includes 10 μL of digital PCR premix, 1 μL of upstream primer F1, 1 μL of downstream primer R1, 0.5 μL of probe T1, and 7.5 μL of eDNA template.

[0021] Preferably, in step (1), the eDNA template is extracted and recovered using a genomic DNA extraction kit for marine animal tissues.

[0022] Preferably, in step (2), the volume ratio of the oil-phase encapsulating reagent to the digital PCR reaction system is 15:4.

[0023] Preferably, in step (3), the thermal cycling includes: pre-denaturation at 95°C for 10 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, for a total of 40 cycles; then inactivation at 98°C for 10 min, and storage at 20°C.

[0024] Preferably, in step (4), the fluorescence data acquisition results are processed using digital PCR analysis software to calculate the number of reaction units of positive and negative samples, and then to determine the presence or absence of the target gene and the corresponding positive copy number.

[0025] The present invention has the following advantages:

[0026] (1) The present invention provides a method for detecting eDNA of Chinese white dolphins in seawater samples based on microfluidic chip-based digital PCR technology. This method ensures the stability of the reaction system and reduces background interference by distributing the reaction system into multiple micro-reaction units and using an oil-phase encapsulation technology.

[0027] (2) By establishing a digital PCR detection method for eDNA of Chinese white dolphins in seawater samples, the present invention can not only complete the absolute quantitative analysis of eDNA of Chinese white dolphins in seawater samples and detect the presence of the target gene as low as 0.0845 copies / μL, but also has higher sensitivity, accuracy, and stability compared with traditional PCR and qPCR technologies. Description of the Drawings

[0028] Figure 1 is the standard curve of the digital PCR detection positive standard product in Example 1 of the present invention;

[0029] Figure 2 is the example scatter plot of the digital PCR detection in Example 2 of the present invention;

[0030] Figure 3This is an example droplet diagram for digital PCR detection in Example 2 of the present invention. Detailed implementation manners

[0031] The following implementation manners facilitate the understanding of the present invention, but are not limited thereto. Unless otherwise specified, the following implementation manners all adopt conventional experimental methods; if not specifically stated, the reagents used are all conventional reagents that are easy to purchase.

[0032] Among them:

[0033] The digital PCR premix mainly consists of buffer, magnesium chloride, dNTP and Taq DNA polymerase, and is purchased from companies including but not limited to Suzhou Ruixun Biotechnology Co., Ltd.

[0034] The oil phase encapsulation reagent is mainly mineral oil and is purchased from companies including but not limited to Suzhou Ruixun Biotechnology Co., Ltd.

[0035] Example 1

[0036] 1. Experimental method

[0037] 1.1 Screening of specific target genes and primer design

[0038] 1.1.1 Analysis of conserved sequences

[0039] Download the complete mitochondrial gene sequences of Sousa chinensis and multiple related species (Indo-Pacific bottlenose dolphin, bottlenose dolphin, rough-toothed dolphin, Risso's dolphin, Fraser's dolphin, Indo-Pacific finless porpoise, false killer whale, pygmy killer whale, common dolphin, long-beaked common dolphin, pantropical spotted dolphin, spinner dolphin, striped dolphin, Pacific white-sided dolphin) from NCBI (https: / / www.ncbi.nlm.nih.gov / ). After multi-sequence alignment analysis using MEGA12 (https: / / www.megasoftware.net / ) software, a conserved sequence is finally obtained. This sequence belongs to a part of the cytochrome c oxidase subunit I (COI) gene, and the sequence information is shown in SEQ ID NO.4.

[0040] Conserved sequence of Sousa chinensis (5’-3’):

[0041]

[0042] 1.1.2 Specific primer and probe design

[0043] Based on the conserved sequence obtained in 1.1.1, specific primers and probes were designed using Primer Premier 5 software, and indexes such as primer dimers, hairpin structures, and mismatch analysis of the primers and probes were evaluated on Oligo6 software to select the optimal primer and probe combination (Table 1), and the sequences are as follows:

[0044] Forward primer F1: GCCCATTTTCACTATGTGCTTTC (SEQ ID NO.1);

[0045] Reverse primer R1: GGAAGTGTTGTGGGAAGAATGTC (SEQ ID NO.2);

[0046] Probe T1: TCTTTGCCATCATAGGAGGTTTCGTTCA (SEQ ID NO.3).

[0047] Sequence information table of the forward primer, reverse primer and probe described in Table 1

[0048] Sequence number Sequence information 5'-modification 3'-modification 1 GCCCATTTTCACTATGTGCTTTC 2 GGAAGTGTTGTGGGAAGAATGTC 3 TCTTTGCCATCATAGGAGGTTTCGTTCA FAM BHQ1 。

[0049] 1.2 DNA extraction

[0050] Collect 1 L of seawater samples in the distribution area of Chinese white dolphins, concentrate them through a filtration device to obtain seawater filter membranes, and extract and recover them using the Marine Animal Tissue Genomic DNA Extraction Kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. to obtain eDNA samples. Among them, the eDNA samples extracted from the filter membranes obtained by filtering the seawater samples at the locations where Chinese white dolphins were sighted are called positive samples, the eDNA samples extracted from the filter membranes obtained by filtering the seawater samples at the locations where Chinese white dolphins were not found are called negative samples, and the eDNA samples extracted from the filter membranes obtained by filtering pure water are called blank control samples.

[0051] Take about 30 mg of the muscle tissue of the stranded and dead Chinese white dolphins, and extract and recover it using the Marine Animal Tissue Genomic DNA Extraction Kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. to obtain genomic DNA samples. The steps are as follows:

[0052] (1) Place 1 filter membrane or muscle tissue in a 2 mL centrifuge tube and cut it into pieces;

[0053] (2) Add 800 μL of GA buffer and 80 μL of Proteinase K to the filter membrane sample, and add 200 μL of GA buffer and 20 μL of Proteinase K to the muscle tissue. After shaking and mixing evenly, briefly centrifuge to remove the water droplets on the inner wall of the tube cap, and incubate at 56 °C for 2.5 h;

[0054] (3) Add 500 μL of GB buffer, shake and mix evenly, briefly centrifuge to remove the water droplets on the inner wall of the tube cap, and incubate at 70 °C for 10 min;

[0055] (4) Centrifuge at 12,000 rpm for 30 s, and transfer all the supernatant to a new 2 mL centrifuge tube;

[0056] (5) Add 400 μL of absolute ethanol to the supernatant, mix well, and transfer it to the adsorption column CB3 (in the adsorption column collection tube) in two portions. Centrifuge at 12,000 rpm for 30 s, pour out the waste liquid, and place the adsorption column CB3 back into the collection tube;

[0057] (6) Add 500 μL of GD buffer to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, pour out the waste liquid, and place the adsorption column CB3 back into the collection tube;

[0058] (7) Add 600 μL of PW washing solution to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, pour out the waste liquid, and place the adsorption column CB3 back into the collection tube;

[0059] (8) Repeat operation step 7;

[0060] (9) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, pour out the waste liquid, and open the lid of the adsorption column CB3 and place it at room temperature for 5 min to thoroughly dry the residual washing solution in the adsorption material;

[0061] (10) Transfer the adsorption column CB3 into a clean centrifuge tube, suspend and add 100 μL of TE elution buffer to the middle part of the adsorption membrane, place it at room temperature for 10 min, centrifuge at 12,000 rpm for 2 min. After detecting the concentration and purity of the collected DNA sample by Qbit quantification method, store it at -20 °C for standby.

[0062] 1.3. Primer and probe specificity verification

[0063] 1.3.1 Preparation of digital PCR system

[0064] Prepare the positive standard: Take the genomic DNA of the muscle tissue of the stranded and dead Chinese white dolphin, and dilute it to 10 3 、10 4 、10 5 、10 6times as the template for digital PCR reaction. Each 20 μL digital PCR reaction system contains 10 μL of digital PCR premix (probe method), 1 μL of upstream primer, 1 μL of downstream primer, 0.5 μL of probe, 3 μL of DNA template, and ddH 2 O 4.5 μL.

[0065] 1.3.2 Operation of digital PCR program

[0066] In this experiment, a microfluidic chip-based digital PCR system (SG-2000) manufactured by Suzhou Ruixun Company was used as the experimental instrument

[0067] a. Droplet formation: The prepared reaction system was dispensed into at least 2,000 tiny reaction units, and each unit contained one or no template DNA molecule. The specific operations included: placing the oil-phase encapsulating reagent and the digital PCR reaction solution prepared in 3.1 into the oil hole and sample hole of the special chip respectively, starting the droplet generator to generate droplets; the volume ratio of the oil-phase encapsulating reagent to the digital PCR reaction solution was 15:4.

[0068] b. PCR amplification: Thermal cycling was performed on a dedicated digital PCR device, including pre-denaturation at 95 °C for 10 min; denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, for a total of 40 cycles; subsequently, inactivation at 98 °C for 10 min, and storage at 20 °C.

[0069] c. Fluorescence signal collection: After the PCR amplification was completed, the chip was scanned in a biochip reader to obtain fluorescence signals and related data.

[0070] 1.3.3 Data analysis and result interpretation

[0071] The fluorescence data collection results were processed using digital PCR analysis software to calculate the number of positive and negative reaction units, and then to determine the presence or absence of the target gene and the corresponding positive copy number.

[0072] 1.3.4 Specificity results and analysis of primers and probes

[0073] Using the genomic DNA of Chinese white dolphins obtained from "1.2 DNA extraction" as samples, they were diluted to 10 3 、10 4 、10 5 、10 6 times to prepare standard products as templates for digital PCR detection. The reaction system and procedure were as described in "1.3.1 Preparation of digital PCR system" and "1.3.2 Operation of digital PCR program" above.

[0074] The results were as Figure 1As shown, with the copy number of the positive standard product as the abscissa and the copy number of the COI target gene DNA detected as the ordinate, a standard curve was plotted and linearly fitted, and the correlation coefficient R 2 = 0.997, and this linear relationship was very significant (P = 5.21×10 -7 ).

[0075] The above results indicate that the experimental operation error is extremely small, and the dilution and concentration measurement processes are highly reliable. At the same time, this also proves that the system for detecting the copy number of the COI gene in the tissues of Chinese white dolphins based on the digital PCR method of the present invention is very successful, further verifying the effectiveness and high specificity of the primers and probes designed in the experiment, and the digital PCR reaction conditions established by the present invention are suitable for absolute quantitative analysis.

[0076] Example 2

[0077] Quantitative detection of the copy number of eDNA of Chinese white dolphins in seawater samples using digital PCR technology

[0078] (1) Preparation of the digital PCR system

[0079] Take the eDNA sample from seawater obtained by extraction in step "1.2 DNA extraction" of Example 1 as the template for the digital PCR reaction. Each 20 μL digital PCR reaction system contains 10 μL of digital PCR premix (probe method), 1 μL of upstream primer, 1 μL of downstream primer, 0.5 μL of probe, and 7.5 μL of eDNA template.

[0080] (2) Operation of the digital PCR program:

[0081] (a) Droplet generation: The prepared reaction system was dispensed into at least 2,000 tiny reaction units, and each unit contains one or no template DNA molecule. The specific operation includes: placing the oil-phase encapsulating reagent and the digital PCR reaction solution prepared in "(1) Preparation of the digital PCR system" into the oil wells and sample wells of a dedicated chip respectively, starting the droplet generator to generate droplets; the volume ratio of the oil-phase encapsulating reagent to the digital PCR reaction solution is 15:4.

[0082] (b) PCR amplification: Thermal cycling was carried out on a dedicated digital PCR device, including pre-denaturation at 95°C for 10 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, for a total of 40 cycles; then inactivation at 98°C for 10 min, and storage at 20°C.

[0083] (c) Fluorescent signal acquisition: After the PCR amplification was completed, the chip was scanned in a biochip reader to obtain fluorescent signals and related data.

[0084] Data analysis and result interpretation: Use digital PCR analysis software to process the fluorescence data acquisition results, calculate the number of positive and negative reaction units, and then determine the presence or absence of the target gene and the corresponding positive copy number, as Figures 2-3 shown.

[0085] Specifically include:

[0086] Quantitative detection of the copy number of Sousa chinensis eDNA in seawater samples by digital PCR

[0087] Use the eDNA sample from the seawater sample obtained in "1.2 DNA extraction" in Example 1 as a template for digital PCR detection. The reaction system and procedure are in accordance with those described in "(1) Preparation of digital PCR system" and "(2) Operation of digital PCR procedure".

[0088] The results are shown in Table 2. In the 15 positive samples detected, the presence of the COI target gene of Sousa chinensis in the seawater samples could be detected. The lowest quantitative value was 0.0845 copies / μL, corresponding to 23 copies. The target gene was not detected in the negative samples and blank controls.

[0089] Table 2 Quantitative detection of the copy number of Sousa chinensis eDNA in seawater samples by digital PCR

[0090]

[0091]

[0092] The above results indicate that the digital PCR method established in the present invention has high specificity and effectiveness for the detection of the COI target gene of Sousa chinensis in seawater, can accurately identify whether the target gene of Sousa chinensis exists in the sample, and can detect relatively low concentrations of gene copies within the detection range, providing a reliable gene detection basis for further research on the distribution and survival status of Sousa chinensis in this sea area.

[0093] The above specific embodiments are intended to further illustrate the content of the present invention, but should not be regarded as a limitation on the protection scope of the present invention. Any non-substantive modification or adjustment made by anyone on the basis of the present invention according to the provided technical inspiration should be covered within the protection scope of the present invention.

Claims

1. A composition for detecting Chinese white dolphin eDNA in seawater samples based on microfluidic chip digital PCR technology, characterized in that: The composition comprises an upstream primer F1, a downstream primer R1 and a probe T1, the sequence of the upstream primer F1 is shown as SEQ ID NO.1, the sequence of the downstream primer R1 is shown as SEQ ID NO.2, and the sequence of the probe T1 is shown as SEQ ID NO.

3.

2. The composition for detecting Chinese white dolphin eDNA in seawater samples based on microfluidic chip digital PCR technology according to claim 1, characterized in that: The 5' end of the probe T1 is modified with a fluorescent reporter group, and the 3' end of the probe is modified with a quencher group. The fluorescent reporter group is FAM, and the quencher group is BHQ1.

3. A kit for detecting Chinese white dolphin eDNA in seawater samples based on microfluidic chip digital PCR technology, characterized in that: The kit contains the composition according to claim 1 or 2.

4. A method for detecting Chinese white dolphin eDNA in seawater samples based on microfluidic chip digital PCR technology, characterized in that: The following steps are involved: (1) preparing a digital PCR reaction system: the digital PCR reaction system comprises the upstream primer F1, the downstream primer R1, the probe T1, the digital PCR premix and the eDNA template according to claim 1; (2) droplet processing: placing the oil-phase encapsulated reagent and the digital PCR reaction system described in step (1) in the oil well and sample well of a chip of a microfluidic chip-type digital PCR device, and starting a droplet generator to generate droplets; (3) PCR amplification: thermal cycling on a microfluidic chip-based digital PCR device; (4) Fluorescence signal acquisition: After PCR amplification, the chip is scanned in a biochip reader to obtain the fluorescence signal and related data.

5. The method according to claim 4, characterized in that The digital PCR reaction system in step (1) includes 10 μL of digital PCR premix, 1 μL of upstream primer F1, 1 μL of downstream primer R1, 0.5 μL of probe T1 and 7.5 μL of eDNA template.

6. The method according to claim 4, characterized in that The eDNA template described in step (1) is extracted and recovered using a marine animal tissue genomic DNA extraction kit.

7. The method according to claim 4, characterized in that The volume ratio of the oil phase encapsulation reagent and the digital PCR reaction system in step (2) is 15:

4.

8. The method according to claim 4, characterized in that The thermal cycle in step (3) includes: pre-denaturation at 95°C for 10 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, for a total of 40 cycles; followed by inactivation at 98°C for 10 min and storage at 20°C.

9. The method according to claim 4, characterized in that In step (4), digital PCR analysis software is used to process the fluorescence data collection results, calculate the number of reaction units of positive samples and negative samples, and then determine the presence or absence of the target gene and the corresponding positive copy number.

Images