Kit for rapidly detecting nucleotide variation sites on DNA chain at low cost and application

Abstract

The invention belongs to the field of gene variation detection, and particularly relates to a kit for rapidly detecting nucleotide variation sites on a DNA chain at low cost and application. According to the kit, a target (wild type or mutant type) is subjected to denaturation treatment by adopting an alkaline solution, then renaturation is carried out by adopting an acidic solution, and a block probe and a linear probe with specific structures are well combined to a target DNA chain through a strand displacement reaction to form a complex; an RNA aptamer obtained by in-vitro transcription of the complex can be specifically combined with malachite green dye to generate a fluorescence signal, nucleotide variation sites on DNA single chains / double chains can be effectively recognized according to the intensity of the fluorescence signal, a wild type and a mutant type are effectively distinguished, a blank area from single-chain detection to double-chain detection in the nucleic acid detection history is broken through, and the detection accuracy is improved. The method is suitable for on-site rapid mutation screening in the fields of agriculture, aquatic products and the like, and has the advantages of simple detection steps, low cost, high sensitivity, good specificity, short time consumption and the like.

Description

Technical Field

[0001] This application belongs to the field of gene mutation detection, and more specifically, relates to a kit for low-cost and rapid detection of nucleotide mutation sites on a DNA strand and its application. Background Art

[0002] Genotyping is the process of examining an individual's DNA sequence using biological tests to determine differences in the individual's genetic makeup (genotype). Genotyping technology has far-reaching significance in aspects such as individual health, disease prevention, precision medicine, and scientific research. Nucleotide mutation detection is an important method in genotyping detection, which is used to detect mutations at nucleotide positions on the genome.

[0003] Currently, nucleotide mutation detection mainly relies on PCR, DNA sequencing, and nucleic acid hybridization techniques. These two techniques of PCR and DNA sequencing have the disadvantages of complex operation, expensive equipment, high dependence on instruments, and relatively high error rates. Detecting nucleotide mutation sites based on nucleic acid hybridization technology mainly involves designing probes with specific sequences, using the Watson-Crick base complementary pairing principle to hybridize the probes with complementary sequences in the nucleic acid sample to be detected, and based on the intensity of the fluorescence signal generated by the transcription of the hybridization product, thereby realizing the detection of nucleotide mutation sites in specific genes or gene regions, which can improve the accuracy and sensitivity of detection and is widely used in fields such as gene mutation detection, pathogen detection, and drug efficacy evaluation. Further, based on the nucleic acid hybridization technology, researchers provided a toehold-controlled nucleic acid ligation and in vitro transcription detection system (TLT) constructed based on strand displacement reaction, which combines the ligation reaction of linear probes and repressor strands with the target sequence and the reading of the fluorescence amplification signal of the transcription reaction to achieve nucleic acid sequence-specific recognition detection at a constant temperature and can be applied to the identification of single nucleotide mutation sites. However, in this method, the nucleic acid ligation reaction requires first unwinding the target double strand at high temperature, then cooling to allow the linear probe and the repressor strand to bind to the target, and then heating for the ligation reaction, which has a high dependence on temperature control equipment and is not suitable for on-site detection in fields such as agricultural fields and aquaculture, restricting its large-scale popularization and application.

[0004] Therefore, there is an urgent need in the art to develop a kit that is suitable for fields such as agricultural fields and aquaculture and can low-cost and rapidly detect nucleotide mutation sites on a DNA strand. Summary of the Invention

[0005] In view of the deficiencies of the prior art, the purpose of the present application is to provide a kit and application for low-cost and rapid detection of nucleotide mutation sites on a DNA strand, aiming to solve the problems in the prior art that the detection of nucleotide mutation sites has strict temperature requirements, high dependence on temperature control equipment, and is prone to false positive results, etc., and is particularly suitable for the detection of nucleotide mutation sites on double strands.

[0006] To achieve the above purpose, in the first aspect, the present application provides a kit for low-cost and rapid detection of nucleotide mutation sites on a DNA strand, which includes a strand displacement system and an in vitro transcription system; The above strand displacement system includes a target DNA, an alkaline solution, an acidic solution, a blocker probe and a linear probe designed for the above target DNA; The pH of the above alkaline solution is 11.5 - 13.0, and the molar ratio of the above alkaline solution to the above target DNA is (2×10 5 ~1×10 7 ):1, and the above acidic solution is used to adjust the pH of the system to neutral; The 5' to 3' sequence of the above blocker probe includes a first sequence complementary to the first fragment on the above target DNA; The 5' to 3' sequence of the above linear probe sequentially includes a sequence for transcribing an RNA aptamer, a second sequence complementary to the second fragment on the above target DNA, a third sequence complementary to the third fragment on the above target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; The above first sequence is the same as the above third sequence, or a partial fragment of the above first sequence is the same as the above third sequence, and the length of the above partial fragment is 5bp - 10bp; The above in vitro transcription system includes an RNA polymerase and a malachite green dye; the RNA aptamer obtained by transcribing the sequence for transcribing the RNA aptamer can specifically bind to the above malachite green dye to generate a fluorescence signal.

[0007] Preferably, the molar ratio of the above alkaline solution to the above target DNA is (2.11×10 5 ~7×10 6 ):1.

[0008] Preferably, the molar ratio of the above target DNA to the above blocker probe is 1:(5 - 50).

[0009] More preferably, the molar ratio of the above target DNA to the above blocker probe is 1:(5 - 20).

[0010] Preferably, the length of the above blocker probe is 15bp - 25bp.

[0011] Preferably, the length of the above linear probe is 100bp to 140bp.

[0012] Preferably, the total length of the above second sequence and the above third sequence is 10bp to 40bp.

[0013] Preferably, the above blocker probe binds to the single strand of the above target DNA prior to the above linear probe.

[0014] Preferably, the above linear probe includes a reporter probe and a promoter probe; wherein, The 5'-to-3' sequence of the above reporter probe sequentially includes the sequence for transcribing to generate the RNA aptamer and the above second sequence; The 5'-to-3' sequence of the above promoter probe sequentially includes a phosphate group, the above third sequence, and the sequence containing the promoter sequence and having a stem-loop structure; The 3'-terminal hydroxyl group of the above reporter probe and the 5'-terminal phosphate group of the above promoter probe are connected under the action of DNA ligase to form the above linear probe.

[0015] Preferably, the above promoter sequence is one or more of a T7 promoter sequence, a T3 promoter sequence, and an Sp6 promoter sequence.

[0016] Preferably, the sequence for transcribing to generate the RNA aptamer is 5'-GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCC-3'.

[0017] Preferably, the above RNA polymerase is one or more of a T7 RNA polymerase, a T3 RNA polymerase, and an Sp6 RNA polymerase.

[0018] Preferably, the above strand displacement system further includes one or more of a nucleic acid extractant, a nucleic acid releasing agent, and a reverse transcriptase.

[0019] Preferably, the above in vitro transcription system further includes a substrate for in vitro transcription, a buffer required for in vitro transcription, and an RNA inhibitor.

[0020] In a second aspect, the present application provides the use of the above kit in detecting nucleotide variations on a DNA strand.

[0021] In a third aspect, the present application provides a method for detecting or assisting in detecting nucleotide variation sites on a DNA strand of a test sample using the above kit, including the following steps: S1. Design blocker probes and linear probes for wild-type targets, and then use the above alkaline solution to denature the test sample and the wild-type target respectively, so that the above blocker probes and the above linear probes bind to the denatured DNA strands, and use the above acidic solution to adjust the pH of the system to neutral to obtain a test complex in which the above blocker probes and the above linear probes are stably bound to the above test sample, and a wild-type complex in which the above blocker probes and the above linear probes are stably bound to the above wild-type target; S2. Mix the above test complex and the above wild-type complex with the above in vitro transcription system respectively. The RNA aptamer obtained by transcribing the above complex can specifically bind to the malachite green dye to produce a fluorescence signal. If the fluorescence signal generated after transcribing the above test complex is stronger than the fluorescence signal generated after transcribing the above wild-type complex, then a nucleotide site mutation occurs on the DNA strand of the above test sample, that is, the above test sample is a mutant sample; The nucleotide mutation site on the DNA strand of the above test sample is located on the above first fragment.

[0022] Preferably, in step S1, the time of the above denaturation treatment is 3 min to 5 min.

[0023] Generally speaking, compared with the prior art, the above technical solution conceived by this application mainly has the following technical advantages: (1) The kit for low-cost and rapid detection of nucleotide mutation sites on DNA strands provided by this application denatures target DNA (wild-type, mutant) with an alkaline solution, and then after renaturation with an acidic solution, through strand displacement reaction, blocker probes and linear probes with specific structures can bind well to the target DNA strand to form a complex. Then, the RNA aptamer obtained by transcribing this complex can specifically bind to the malachite green dye in the transcription system to produce a fluorescence signal. The nucleotide mutation sites on DNA single strands / double strands can be effectively identified through the strength of the fluorescence signal, and wild-type and mutant types can be effectively distinguished, breaking through the blank area from single-strand detection to double-strand detection in the history of Toehold detection. It is applicable to on-site rapid gene mutation screening in fields such as agriculture and aquaculture, and has the advantages of simple detection steps, low detection cost, high detection sensitivity, good specificity, short time consumption, and good stability.

[0024] (2) The kit provided by the present application for rapidly detecting nucleotide mutation sites on a DNA strand can denature and unwind and renature the DNA strand by preparing an alkaline solution - acidic solution system. Compared with the prior art, it eliminates the need to repeatedly regulate the temperature multiple times to achieve denaturation, unwinding, and renaturation of the DNA strand in traditional detection methods, has a low dependence on temperature control equipment, and significantly shortens the detection time. It can rapidly detect and effectively identify nucleotide mutation sites on trace DNA double strands on-site. In addition, the cost of preparing the alkaline solution - acidic solution system is low, the steps are simple, and the reagents can be stably stored for a long time, making it suitable for on-site detection in fields such as agricultural fields and aquaculture. Brief Description of the Drawings

[0025] Figure 1 is a schematic diagram of the principle of the kit provided by the present application for detecting nucleotide mutation sites on a DNA strand; Figure 2 is the sequence structure of the wild-type blocker probes (G-B1, G-B2) and mutant blocker probes (E-B1, E-B2) designed in Example 1 of the present application, as well as the wild-type target DNA and mutant target DNA; Figure 3 is the effect of the kit provided in Example 1 of the present application for detecting nucleotide mutation sites on wild-type target double-stranded DNA; Figure 4 is the effect of the kit provided in Example 2 of the present application for detecting nucleotide mutation sites on wild-type target single-stranded DNA; Figure 5 is the effect of the kit provided in Comparative Example 1 of the present application for detecting nucleotide mutation sites on wild-type target double-stranded DNA; Figure 6 is the effect of the kit provided in Comparative Example 2 of the present application for detecting nucleotide mutation sites on wild-type target double-stranded DNA. Detailed Description of the Embodiments

[0026] In order to make the objectives, technical solutions, and advantages of the present application clearer, the present application will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0027] In the description of the present application, it should be understood that the term "and / or" is a relationship describing associated objects, indicating that three relationships may exist. For example, A and / or B may represent: A exists alone, A and B exist simultaneously, and B exists alone. In this article, the symbol " / " represents an "or" relationship between associated objects, for example, A / B represents A or B.

[0028] In the description and claims of this application, terms such as "first", "second", and "third" are used to distinguish different objects, rather than to describe a specific order of objects, and should not be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features.

[0029] In the description of the embodiments of this application, words such as "exemplary" or "for example" are used to indicate examples, illustrations, or explanations. Any embodiment or design solution described as "exemplary" or "for example" in the embodiments of this application should not be construed as being more preferred or having more advantages than other embodiments or design solutions. Rather, the use of words such as "exemplary" or "for example" is intended to present relevant concepts in a specific manner.

[0030] In the description of the embodiments of this application, unless otherwise specified, the meaning of "a plurality" refers to two or more.

[0031] This application provides a kit for low-cost and rapid detection of nucleotide mutation sites on a DNA strand, including a strand displacement system and an in vitro transcription system; The above-mentioned strand displacement system includes a target DNA, an alkaline solution, an acidic solution, a blocker probe and a linear probe designed for the above-mentioned target DNA; Among them, the pH of the above-mentioned alkaline solution is 11.5 to 13.0, and the molar ratio of the above-mentioned alkaline solution to the above-mentioned target DNA is (2×10 5 ~1×10 7 ):1, and the above-mentioned acidic solution is used to adjust the pH of the system to neutral; The above-mentioned blocker probe is a single-stranded DNA oligonucleotide, and its 5'-to-3' sequence includes a first sequence complementary to a first fragment on the above-mentioned target DNA; The 5'-to-3' sequence of the above-mentioned linear probe sequentially includes a sequence for transcribing an RNA aptamer, a second sequence complementary to a second fragment on the above-mentioned target DNA, a third sequence complementary to a third fragment on the above-mentioned target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; The above-mentioned first sequence and the above-mentioned third sequence are the same, or a partial fragment of the above-mentioned first sequence and the above-mentioned third sequence are the same, and the length of the above-mentioned partial fragment is 5 bp to 10 bp; The above-mentioned in vitro transcription system includes an RNA polymerase and a malachite green dye; the sequence for transcribing the RNA aptamer can transcribe an RNA aptamer under the action of the RNA polymerase, which can specifically bind to the malachite green dye to generate a fluorescence signal.

[0032] Figure 1The figure shows a schematic diagram of the principle of the kit provided by this application for detecting nucleotide variant sites on a DNA strand. In this application, the target DNA (wild type, mutant type) is denatured by an alkaline solution, and then renatured by an acidic solution. Through a strand displacement reaction, blocker probes and linear probes with specific structures can bind well to the target DNA strand. When the target is a wild-type target, the wild-type blocker probe is completely complementary to the wild-type target. The binding of the wild-type blocker probe to the wild-type target and the binding of the linear probe to the wild-type target are in a dynamic equilibrium state, forming an appropriate amount of complex of the linear probe bound to the wild-type target. Under the action of RNA polymerase, the RNA aptamer transcribed from this complex can specifically bind to the above-mentioned malachite green dye to produce a moderate fluorescence signal. When the target is a mutant target, there is a one-base mismatch between the wild-type blocker probe and the mutant target. The linear probe is more likely to displace the wild-type blocker probe bound to the mutant target, that is, the wild-type blocker probe is more easily migrated by the linear probe, and the reaction tends to bind the linear probe to the mutant target, forming a large amount of complex of the linear probe bound to the mutant target. Under the action of RNA polymerase, a large amount of RNA aptamers are transcribed from this complex and specifically bind to the above-mentioned malachite green dye to produce a strong fluorescence signal. The nucleotide variant sites on the DNA double strand can be effectively identified through the intensity of the fluorescence signal, and the wild type and the mutant type can be effectively distinguished.

[0033] In some embodiments, the molar ratio of the above-mentioned alkaline solution to the above-mentioned target DNA is (2.11×10 5 ~7×10 6 ):1. In a preferred embodiment, the molar ratio of the above-mentioned alkaline solution to the above-mentioned target DNA is (6.67×10 5 ~6.67×10 6 ):1.

[0034] It can be understood that this application does not limit the alkaline reagent for preparing the above-mentioned alkaline solution, which can be, but is not limited to, sodium hydroxide, potassium hydroxide, etc. This application does not limit the acidic reagent for preparing the above-mentioned acidic solution, which can be, but is not limited to, hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, etc.

[0035] In some embodiments, the molar ratio of the above-mentioned target DNA to the above-mentioned blocker probe is 1:(5~50). When the dosage of the blocker probe in the strand displacement system is too much, the detection signal will be unstable.

[0036] In a preferred embodiment, the molar ratio of the above-mentioned target DNA to the above-mentioned blocker probe is 1:(5~20).

[0037] In some embodiments, the length of the above-mentioned target DNA is 50 bp to 600 bp.

[0038] In some embodiments, the length of the above-mentioned blocker probe is 15 bp to 25 bp.

[0039] In some embodiments, the length of the above-mentioned linear probe is 100 bp to 140 bp.

[0040] In some embodiments, the total length of the above-mentioned second sequence and the above-mentioned third sequence is 10 bp to 40 bp.

[0041] In some embodiments, to improve the specificity of DNA detection and avoid background signals caused by non-specific binding of the linear probe, the above-mentioned linear probe can be split and designed into a primer probe and a reporter probe. Among them, the 5'-to-3' sequence of the above-mentioned reporter probe sequentially includes a sequence for transcribing an RNA aptamer and a second sequence complementary to a second fragment on the above-mentioned target DNA; the 5'-to-3' sequence of the above-mentioned primer probe sequentially includes a phosphate group, a third sequence complementary to a third fragment on the above-mentioned target DNA, and a sequence containing a promoter sequence and having a stem-loop structure.

[0042] The 3'-terminal hydroxyl group of the above-mentioned reporter probe and the 5'-terminal phosphate group of the above-mentioned primer probe are connected under the action of DNA ligase to generate the above-mentioned linear probe.

[0043] It can be understood that the present application does not limit the type of the above-mentioned DNA ligase, and DNA ligases reported in the prior art that can be used to ligate DNA sequences are all within the protection scope of the present application. In some embodiments, the above-mentioned DNA ligase can be, but is not limited to, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, etc.

[0044] In some embodiments, the length of the sequence containing a promoter sequence and having a stem-loop structure is 45 bp to 75 bp, which can enhance the stability of the above-mentioned primer probe structure and improve the transcription efficiency. In a specific embodiment of the present application, the sequence containing a promoter sequence and having a stem-loop structure is 5'-CCCTA TAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGG-3'.

[0045] Without being limited by theory, the promoter sequence adopted in the present application can be any promoter sequence that can be recognized, bound by RNA polymerase in vitro and initiate transcription to generate RNA. Since the promoter sequence is designed in the initiation probe, the promoter sequence should not be too long, and preferably is a T7 promoter sequence, a T3 promoter sequence or an Sp6 promoter sequence. Correspondingly, the RNA polymerase in the in vitro transcription system is T7 RNA polymerase, T3 RNA polymerase or Sp6 RNA polymerase.

[0046] In some embodiments, to improve the stability of the linear probe, the initiation probe and the reporter probe, so that the above-mentioned probes can better bind to the target DNA, protective bases can be used to connect the sequence for transcribing to generate the RNA aptamer and the first sequence that binds to a part of the above-mentioned target DNA, and the second sequence that binds to a part of the above-mentioned target DNA and the sequence containing the promoter sequence and having a stem-loop structure. In some embodiments, the length of the above-mentioned protective bases is 1bp - 3bp, and can be but not limited to A, T, AT, ACG, ACC, etc.

[0047] In some embodiments, the sequence for transcribing to generate the RNA aptamer is 5'-GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCC-3'.

[0048] In some embodiments, the above-mentioned strand displacement system further includes a buffer and other components. Among them, the above-mentioned buffer can be any specific or general buffer known in the art and applicable to the present application, including but not limited to SENSRbuffer, Tris-HCl or phosphate buffer. The above-mentioned other components include but not limited to nuclease-free water.

[0049] In some embodiments, the above-mentioned strand displacement system further includes one or more of a nucleic acid extractant, a nucleic acid releasing agent, and a reverse transcriptase. Among them, the above-mentioned nucleic acid extractant is used to extract the nucleic acid of the sample to be detected. The above-mentioned nucleic acid releasing agent is used to release the nucleic acid in the sample to be detected. The above-mentioned reverse transcriptase is used to reverse transcribe the target RNA into target DNA.

[0050] In some embodiments, the RNA polymerase in the above-mentioned in vitro transcription system is one or more of T7 RNA polymerase, T3 RNA polymerase and Sp6 RNA polymerase.

[0051] In some embodiments, the above-mentioned in vitro transcription system further includes substrates for in vitro transcription, buffers required for in vitro transcription, RNA inhibitors and other components.

[0052] In some embodiments, the substrate for in vitro transcription described above is nucleoside triphosphate; the buffer required for the in vitro transcription described above can be any specific or general buffer known in the art and applicable to the present application, including but not limited to SENSR buffer, Tris-HCl, or phosphate buffer. The RNA inhibitor described above is a ribonuclease inhibitor, which can specifically bind to and inhibit the activity of RNase (ribonuclease), protecting RNA from degradation by RNase. The other components described above include but are not limited to nuclease-free water.

[0053] On the other hand, the present application also provides the use of the above-mentioned kit in detecting nucleotide variations on the DNA strand of a sample to be tested, which is applicable to fields such as agriculture and aquaculture.

[0054] The present application also provides a method for detecting or assisting in detecting nucleotide variation sites on the DNA strand of a sample to be tested using the above-mentioned kit for non-diagnostic purposes, including the following steps: S1. Design blocker probes and linear probes for the wild-type target, and then use the above-mentioned alkaline solution to denature the sample to be tested and the wild-type target respectively, so that the above-mentioned blocker probes and the above-mentioned linear probes bind to the denatured DNA strand, and use the above-mentioned acidic solution to adjust the pH of the system to neutral to obtain a test complex in which the above-mentioned blocker probes and the above-mentioned linear probes are stably bound to the sample to be tested, and a wild-type complex in which the above-mentioned blocker probes and the above-mentioned linear probes are stably bound to the above-mentioned wild-type target; S2. Mix the above-mentioned test complex and the above-mentioned wild-type complex with the above-mentioned in vitro transcription system respectively. The RNA aptamer obtained by transcribing the complex can specifically bind to the above-mentioned malachite green dye to produce a fluorescence signal. If the fluorescence signal generated after transcribing the test complex is stronger than the fluorescence signal generated after transcribing the wild-type complex, then a nucleotide site variation occurs on the DNA strand of the sample to be tested, that is, the sample to be tested is a mutant sample; The nucleotide variation site on the DNA strand of the sample to be tested is located on the above-mentioned first fragment.

[0055] In some embodiments, the time for the above-mentioned denaturation treatment is 3 min to 5 min, which can denature the DNA strands of the wild-type target and the sample to be tested, unwind the double strands, so that the above-mentioned blocker probes and linear probes with specific structures can bind to the denatured DNA strand, avoiding too long denaturation treatment time, resulting in too serious fragmentation of the DNA strands of the wild-type target and the sample to be tested, thus reducing the amount of detectable DNA fragments; or too short denaturation treatment time, resulting in incomplete opening of the DNA double strands of the wild-type target and the sample to be tested.

[0056] It should be understood that materials that are the same as or similar to the types, models, qualities, properties, or functions of the reagents and instruments used in the following embodiments can be used to implement this application. Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0057] The following are examples and comparative examples: Example 1 1. Prepare alkaline stock solution and acidic stock solution Take 4 g of NaOH and 100 mL of ultrapure water and mix them evenly to prepare an alkaline stock solution, that is, the NaOH stock solution, and store it at 4 °C for later use. Take 10 μL of concentrated hydrochloric acid with a concentration of 12 mol / L and 110 μL of ultrapure water and mix them evenly to prepare an acidic stock solution, that is, the HCl stock solution, and store it at 4 °C for later use.

[0058] 2. Prepare alkaline denaturing solution and acidic neutralizing solution Take 20 μL of the NaOH stock solution and 180 μL of nuclease-free water and mix them evenly to prepare an NaOH solution with a pH of 13 and a concentration of 0.1 mol / L as the alkaline denaturing solution of this example. Take 20 μL of the HCl stock solution and 180 μL of nuclease-free water and mix them evenly to prepare an HCl solution with a pH of 1 and a concentration of 0.1 mol / L as the acidic neutralizing solution of this example.

[0059] 3. Detection of nucleotide variant sites on the target DNA strand 3.1 Construction of target DNA and probe design The wild-type target DNA sequence (G4915) in this example was extracted from Drosophila melanogaster, and its sequence is shown in Table 1. Linear probes (initiation probe GE-L1, reporter probe GE-L2) and corresponding wild-type blocker probes (G-B1, G-B2) were designed. Among them, the 5'-to-3' sequence of the initiation probe GE-L1 sequentially includes a phosphate group (PO 4 )), a third sequence complementary to the third fragment on the target DNA (the underlined sequence), a protection base (the bolded sequence, that is, AT), and a sequence containing a promoter sequence and having a stem-loop structure; the 5'-to-3' sequence of the reporter probe GE-L2 sequentially includes a sequence for transcribing into an RNA aptamer, a protection base (the bolded sequence, that is, ACC), and a second sequence complementary to the second fragment on the target DNA (the underlined sequence).

[0060] A mutant target DNA sequence (E4915) with nucleotide mutation sites was designed based on the sequence of the wild-type target DNA sequence (G4915), and corresponding mutant blocker probes (E-B1, E-B2) were designed.

[0061] The corresponding relationships between the wild-type target DNA sequence (G4915) and the wild-type blocker probes (G-B1, G-B2), and between the mutant target DNA sequence (E4915) and the mutant blocker probes (E-B1, E-B2) are as Figure 2 shown.

[0062] Table 1 Sequence information of wild-type target DNA, mutant target DNA, linear probes, and blocker probes

[0063] 3.2 Denaturation of target DNA and ligation of linear probes and blocker probes The DNA denaturation of the target and the ligation of linear probes and blocker probes were carried out according to the reaction system shown in Table 2. The specific steps are as follows: The target DNA, the initiation probe GE-L1, the reporter probe GE-L2, and the blocker probe were mixed evenly, and then 5 μL of the above alkaline denaturation solution was added and treated for 4 min to unwind the double-stranded target DNA. Then 5 μL of the above acidic neutralization solution was added and treated for 1 min. The blocker probe first binds to the target DNA strand, and the region not bound to the blocker probe is the toehold region of the target DNA. The linear probe binds to the target DNA through the toehold region. Then 10×SENSR Buffer was added and mixed evenly. Finally, T4 DNA ligase was added and treated at 25 °C for 3 h to connect the 5'-terminal phosphate group of the initiation probe GE-L1 and the 3'-terminal hydroxyl group of the reporter probe GE-L2 to form a phosphodiester bond, generating a sequence with a T7 promoter at the 3'-end and a stem-loop structure, and a long linear probe with an RNA aptamer sequence at the 5'-end, obtaining a complex in which the long linear probe and the blocker probe are stably bound to the target DNA strand.

[0064] When the target is the wild-type target (G4915), the wild-type blocker probe (G-B1 or G-B2) is completely complementary to the wild-type target. The binding of the wild-type blocker probe to the wild-type target and the binding of the linear probe to the wild-type target are in a dynamic equilibrium state. However, the mutant blocker probe (E-B1 or E-B2) has a single-base mismatch with the wild-type target, and the linear probe is more likely to displace the mutant blocker probe bound to the wild-type target, that is, the mutant blocker probe is more easily migrated by the linear probe, and the reaction tends to the binding of the linear probe to the wild-type target, forming a large number of complexes of the linear probe bound to the wild-type target.

[0065] When the target is the mutant target (E4915), the mutant blocker probe (E-B1 or E-B2) is completely complementary to the mutant target. The binding of the mutant blocker probe to the mutant target and the binding of the linear probe to the mutant target are in a dynamic equilibrium state. However, the wild-type blocker probe (G-B1 or G-B2) has a single-base mismatch with the mutant target, and the linear probe is more likely to displace the wild-type blocker probe bound to the mutant target, that is, the wild-type blocker probe is more easily migrated by the linear probe, and the reaction tends to the binding of the linear probe to the mutant target, forming a large number of complexes of the linear probe bound to the mutant target.

[0066] Table 2 Target DNA Denaturation System

[0067] 3.3 In Vitro Transcription Transcription is carried out according to the in vitro transcription system shown in Table 3, which specifically includes the following steps: 16.75 μL of the product of Step 3.2, 1.5 μL of 10×SENSR buffer, 0.15 μL of RNA Inhibitor with a concentration of 40 U / μL, 2 μL of T7 RNA polymerase, 1.5 μL of Malachite Green (MG) with a concentration of 320 μM, 7.5 μL of ATP with a concentration of 20 nM, 7.5 μL of UTP with a concentration of 20 nM, 7.5 μL of GTP with a concentration of 20 nM, 7.5 μL of CTP, and nuclease-free water is added to make the transcription system 30 μL. The transcription reaction is carried out at 37 °C. Each experimental group is named according to the name of the blocker probe used in each experimental group, denoted as the G-B1, G-B2, E-B1, and E-B2 treatment groups. In the transcription system of the control group, T7 RNA polymerase is not added, and the others are the same as the experimental group, denoted as the D treatment group.

[0068] Under the action of T7 RNA polymerase, the above complex transcribes from the first base after the T7 promoter sequence on the linear probe, generating a large amount of RNA aptamers. The RNA aptamers can specifically bind to malachite green dye to produce a fluorescence signal. The amount of transcription products is determined according to the fluorescence intensity, thereby realizing the detection of nucleotide mutation sites.

[0069] Table 3 In vitro transcription system

[0070] 4. Experimental results From Figure 3 It can be seen that for the wild-type target, after adding the non-corresponding blocker (i.e., the mutant blocker probe, such as E-B1 or E-B2), a relatively high fluorescence signal is generated; after adding the corresponding blocker (i.e., the wild-type probe blocker, such as G-B1 or G-B2), the fluorescence signal significantly decreases. This shows that the system for detecting nucleotide mutation sites on the DNA strand provided by this application has obvious discrimination and can effectively identify nucleotide mutation sites on the DNA double strand.

[0071] Example 2 1. Prepare the alkaline denaturing solution and acidic neutralizing solution according to the steps 1 and 2 of Example 1.

[0072] 2. Detection of nucleotide mutation sites on the target DNA strand 2.1 Construction of the target DNA and design of the probe are the same as step 3.1 of Example 1.

[0073] 2.2 Denaturation of the target DNA and ligation of the linear probe and the blocker probe are the same as step 3.2 of Example 1.

[0074] 2.3 In vitro transcription Same as step 3.3 of Example 1, where the target DNA of the experimental group is single-stranded DNA, and the control group is without adding the blocker probe, adding nuclease-free water with the same volume as the blocker probe, denoted as the D-W treatment group.

[0075] 3. Experimental results From Figure 4It can be seen that for the wild-type single-stranded target, after adding a non-corresponding blocker (i.e., a mutant blocker probe, such as E-B1 or E-B2), a relatively high fluorescence signal is generated; after adding the corresponding blocker (i.e., a wild-type probe blocker, such as GE-B1 or G-B2), the fluorescence signal significantly decreases, indicating that the kit provided by the present application can also effectively identify nucleotide variant sites on the DNA single strand, that is, the target single strand has good stability in the alkaline denaturing solution - acidic renaturing solution system provided by the present application.

[0076] Comparative Example 1 1. Prepare the alkaline denaturing solution and acidic neutralizing solution according to the steps 1 and 2 of Example 1.

[0077] 2. Detection of nucleotide variant sites on the target DNA strand 2.1 Construct the target DNA and design the probes according to the steps 3.1 of Example 1.

[0078] 2.2 Denature the target DNA and ligate the linear probe and blocker probe Same as the steps 3.2 of Example 1, where the target DNA denaturing system is shown in Table 4, and the molar ratio of the target DNA to the blocker probe is 1:100.

[0079] Table 4 Target DNA denaturing system

[0080] 2.3 In vitro transcription is the same as the step 3.3 of Example 1.

[0081] 3. Experimental results From Figure 5 It can be seen that for the wild-type double-stranded target, after adding a non-corresponding blocker (i.e., a mutant blocker probe, such as E-B1 or E-B2), a relatively high fluorescence signal is generated; after adding the corresponding blocker (i.e., a wild-type probe blocker, such as G-B1 or G-B2), the fluorescence signal does not decrease significantly. The reason may be that there are too many blocker probes in the strand displacement system, generating interference signals, thereby reducing the detection specificity and being unable to effectively distinguish between wild-type and mutant types.

[0082] Comparative Example 2 1. Prepare the alkaline denaturing solution and acidic neutralizing solution according to the steps 1 and 2 of Example 1.

[0083] 2. Detection of nucleotide variant sites on the target DNA strand 2.1 Construct the target DNA and design the probes according to the steps 3.1 of Example 1.

[0084] 2.2 Denaturation of target DNA and ligation of linear probe and blocker probe Same as step 3.2 of Example 1, wherein the target DNA denaturation system is shown in Table 5, and the molar ratio of the alkaline solution to the target DNA is 2.22×10 7 :1.

[0085] Table 5 Target DNA denaturation system

[0086] 2.3 In vitro transcription is the same as step 3.3 of Example 1.

[0087] 3. Experimental results It can be seen from Figure 6 that the experimental group and the control group could not produce effective fluorescence signals. Probably because the molar ratio of the alkaline solution to the target DNA was too high, the stability of the target DNA in the alkaline denaturation solution - acidic composite solution system was poor, the target DNA strand was severely fragmented, resulting in the blocker probe and the linear probe being unable to effectively bind to the target DNA strand, thus unable to produce effective fluorescence signals.

[0088] It is easy for those skilled in the art to understand that the above are only the preferred embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present application shall be included within the protection scope of the present application.

Claims

1. A low-cost rapid detection kit for nucleotide variation sites on a DNA chain, characterized in that: Including strand displacement system and in vitro transcription system; The strand displacement system includes target DNA, alkaline solution, acidic solution, and blocker probe and linear probe designed for the target DNA; The pH of the alkaline solution is 11.5-13.0, and the molar ratio of the alkaline solution to the target DNA is (2×10 5 ~1×10 7 ):

1. The acidic solution is used to adjust the pH of the system to neutral; The 5' to 3' sequence of the blocker probe includes a first sequence complementary to the first fragment on the target DNA; The 5' to 3' sequence of the linear probe includes, in sequence, a sequence for transcription to generate an RNA aptamer, a second sequence complementary to the second segment on the target DNA, a third sequence complementary to the third segment on the target DNA, and a sequence containing a promoter sequence and having a stem-loop structure; The first sequence is identical to the third sequence, or a partial fragment of the first sequence is identical to the third sequence, and the length of the partial fragment is 5 bp to 10 bp; The in vitro transcription system comprises RNA polymerase and malachite green dye; the RNA aptamer obtained by transcription of the sequence used to generate RNA aptamers can specifically bind to the malachite green dye to generate a fluorescent signal.

2. The kit according to claim 1, characterized in that The molar ratio of the target DNA to the blocker probe is 1:(5-50).

3. The kit according to claim 1, characterized in that The length of the blocker probe is 15 bp to 25 bp; The length of the linear probe is 100 bp to 140 bp; The total length of the second sequence and the third sequence is 10 bp to 40 bp; Preferably, the blocker probe binds to the single strand of the target DNA before the linear probe.

4. The kit according to claim 1 or 3, characterized in that The linear probe includes a reporter probe and an initiator probe; wherein, The 5' to 3' sequence of the reporter probe includes the sequence for transcription to generate the RNA aptamer and the second sequence in sequence; The 5' to 3' sequence of the promoter probe includes a phosphate group, the third sequence and the sequence containing the promoter sequence and having a stem-loop structure in sequence; The 3'-terminal hydroxyl group of the reporter probe and the 5'-terminal phosphate group of the initiator probe are connected under the action of DNA ligase to form the linear probe.

5. The kit according to claim 1 or 4, characterized in that The promoter sequence is one or more of a T7 promoter sequence, a T3 promoter sequence and a Sp6 promoter sequence; and / or, The sequence used for transcription to generate RNA aptamers is 5'-GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCC-3'.

6. The kit according to claim 1, characterized in that The RNA polymerase is one or more of T7 RNA polymerase, T3 RNA polymerase and Sp6 RNA polymerase.

7. The kit according to claim 1, characterized in that The strand displacement system further comprises one or more of a nucleic acid extracting agent, a nucleic acid releasing agent, and a reverse transcriptase; The in vitro transcription system also includes a substrate for in vitro transcription, a buffer required for in vitro transcription and an RNA inhibitor.

8. Use of the kit according to any one of claims 1 to 7 in detecting nucleotide variations on a DNA chain.

9. A method for detecting or assisting in detecting nucleotide variation sites on a DNA chain of a sample to be tested using the kit according to any one of claims 1 to 7, characterized in that: The steps include: S1. Design a blocker probe and a linear probe for a wild-type target, then use the alkaline solution to denature the sample to be tested and the wild-type target respectively, so that the blocker probe and the linear probe bind to the denatured DNA chain, and use the acidic solution to adjust the pH of the system to neutral, to obtain a complex to be tested in which the blocker probe and the linear probe are stably bound to the sample to be tested, and a wild-type complex in which the blocker probe and the linear probe are stably bound to the wild-type target; S2, respectively mixing the test complex and the wild-type complex with the in vitro transcription system, wherein the RNA aptamer obtained by transcription of the complex can specifically bind to the malachite green dye to generate a fluorescent signal, and if the fluorescent signal generated by the transcription of the test complex is stronger than the fluorescent signal generated by the transcription of the wild-type complex, a nucleotide site mutation occurs on the DNA chain of the test sample, that is, the test sample is a mutant sample; The nucleotide variation site on the DNA chain of the sample to be tested is located on the first fragment.

10. The method according to claim 9, characterized in that In step S1, the denaturation treatment time is 3 min to 5 min.

Images