Method for rapidly detecting streptococcus angina

Abstract

The invention discloses a method for rapidly detecting streptococcus angina, and relates to the technical field of biological detection. The detection method comprises the following steps: S1, collecting a sample, and extracting DNA from the sample; s2, amplifying the target DNA by adopting a PCR (Polymerase Chain Reaction) amplification system, wherein PCR amplification primers are a forward primer F and a reverse primer R of a specific targeting streptococcus angina 16srRNA gene; s3, carrying out a reaction on an amplification product obtained in the step S2 in a CRISPR / Cas system, wherein the CRISPR / Cas system comprises crRNA, a Cas protein and a fluorescence labeling probe; the fluorescence labeling probe is a fluorescence labeling ssDNA (single-stranded deoxyribonucleic acid) or ssRNA (single-stranded ribonucleic acid) or ssDNA-RNA (single-stranded deoxyribonucleic acid-ribonucleic acid) probe; and S4, monitoring the change of the fluorescence signal in real time, and judging the existence of streptococcus angina according to the fluorescence intensity. The detection method provided by the invention can rapidly detect streptococcus angina, has lower detection limit, better stability and specificity, and has the characteristics of timeliness and portability.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and particularly to a method for rapidly detecting Streptococcus anginosus. Background Art

[0002] Pathogen detection techniques mainly include traditional culture methods, immunological detection (such as ELISA), molecular biology detection, mass spectrometry technology, etc. As the gold standard, traditional culture methods require Streptococcus anginosus to be cultured on 5% CO 2 blood agar plates for 48 - 72 hours, with a sensitivity of about 10 2 CFU / mL, but it cannot distinguish dead bacteria from live bacteria. ELISA is based on the detection of surface antigens of Streptococcus anginosus (such as SpaP protein), with a sensitivity of about 1 ng / mL, but there is a cross - reaction with Streptococcus pneumoniae (cross - reaction rate > 15%), and it requires 4 - 6 hours of incubation. Commonly used molecular biology detections include conventional PCR, real - time fluorescence quantitative PCR (qPCR), and metagenomic sequencing (mNGS). The detection limit of conventional PCR is about 10 -5 ng / μL, but it requires electrophoresis analysis and is prone to contamination (false positive rate > 5%); the sensitivity of real - time fluorescence quantitative PCR (qPCR) is increased to 10 -6 ng / μL, but it depends on the design of fluorescence probes and has a high cost; the sensitivity of metagenomic sequencing (mNGS) reaches the single - cell level, but the instrument cost is very high and the data analysis is complex (average cycle > 24 hours). Mass spectrometry technology can quickly identify bacterial species, but it requires pure cultures and cannot directly detect low - abundance pathogens in clinical samples (detection limit > 10 3 CFU / mL).

[0003] Although traditional techniques are mature, they are time - consuming. For example, culturing Streptococcus anginosus by the culture method requires 2 - 3 days of culture time, and immunological detection (such as ELISA) requires at least 4 hours, or even longer; molecular biology techniques (such as mNGS) have become the mainstream development direction due to their high sensitivity and rapidity, but mNGS depends on expensive large - scale instrument equipment and cannot achieve rapid point - of - care testing. Based on the above, pathogen detection techniques are upgrading from traditional culture to molecular, mass spectrometry, and intelligent directions. In the future, rapid, accurate, and multi - pathogen synchronous detection will become the mainstream, and the combination of technologies such as CRISPR and mass spectrometry will further promote the application innovation in the clinical and public health fields.

[0004] This application uses a PCR - CRISPR / Cas detection system to make up for the shortcomings of traditional techniques and molecular biology techniques, and can accurately and rapidly detect Streptococcus anginosus. Summary of the Invention

[0005] The object of the present invention is to overcome the deficiencies of the prior art and provide a method for rapidly detecting Streptococcus anginosus, which can rapidly detect Streptococcus anginosus, has a low detection limit, good stability and specificity, and has the characteristics of timeliness and portability.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] A method for rapidly detecting Streptococcus anginosus, comprising:

[0008] S1, collecting a sample and extracting DNA from the sample;

[0009] S2, amplifying the target DNA using a PCR amplification system, and the primers for the PCR amplification are a forward primer F and a reverse primer R that specifically target the 16s rRNA gene of Streptococcus anginosus;

[0010] S3, reacting the amplification product of step S2 in a CRISPR / Cas system, and the CRISPR / Cas system includes: crRNA, Cas protein, and a fluorescently labeled probe; the fluorescently labeled probe is a fluorescently labeled ssDNA or ssRNA or ssDNA-RNA probe;

[0011] S4, monitoring the change of the fluorescence signal in real time and judging the presence of Streptococcus anginosus according to the fluorescence intensity.

[0012] Further, the nucleotide sequence of the forward primer F in step S2 is as shown in SEQ ID NO:2, and the nucleotide sequence of the reverse primer R is as shown in SEQ ID NO:3.

[0013] Further, the PCR amplification system in step S2 includes, in terms of final concentration: primer F 0.2-1 μM, primer R 0.2-1 μM; the conditions for the PCR amplification are: pre-denaturation: 95 °C for 5 min; cyclic amplification: 95 °C for 30 s, 55-60 °C for 30 s, 72 °C for 20 s, for a total of 38 cycles; final extension: 72 °C for 2 min.

[0014] Further, the CRISPR / Cas system in step S3 includes, in terms of final concentration: Cas protein 20-40 nM, crRNA 20-40 nM, fluorescently labeled ssDNA 150-250 nM; the conditions for the reaction of the CRISPR / Cas system are: incubation at 36-42 °C, and detecting the fluorescence every 10 minutes for 2 hours.

[0015] Further, the CRISPR / Cas system also contains 3.6 mL of NEB buffer, and the NEB buffer includes components with the following mass concentrations: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2 , 100 μg / ml BSA, pH 7.9, and the solvent is water.

[0016] Furthermore, the nucleotide sequence of the crRNA is as shown in SEQ ID NO: 1, which targets the 16S rRNA gene of the amplification product in step S2; the Cas protein is selected from Cas12a, Cas12b, Cas13a, Cas12a2, Cas12f or Cas12g; the fluorescently labeled ssDNA or ssRNA or ssDNA-RNA probe is a fluorophore-quencher dual-labeled reporter group.

[0017] Furthermore, the fluorescently labeled probe is a dual-labeled probe, labeled with Texas Red fluorophore at the 5' end and BHQ2 quenching group at the 3' end, and its sequence is Texas Red’-CCCCCC-BHQ2’.

[0018] Even further, the sample is a gastric biopsy, saliva or fecal sample; the method for extracting DNA from the sample is one of a genomic DNA extraction kit, a magnetic bead method DNA extraction kit, an alkaline lysis method, a lysis solution method, and a heating method.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) Rapidity: The detection time of the detection method provided by the present invention is shortened from 2 - 3 days of the traditional culture method to 2 hours, with a 50% speed increase compared to ELISA (more than 4 hours), and can quickly detect Streptococcus anginosus.

[0021] (2) High sensitivity: The lowest detection limit is 1×10 -7 ng / μL, which is better than conventional PCR (10 -5 ng / μL), indicating that the detection method provided by the present invention has strong detection ability, high sensitivity, and can detect Streptococcus anginosus at a lower concentration.

[0022] (3) Strong specificity: There is no cross-reaction with common pathogens such as Escherichia coli and Staphylococcus aureus.

[0023] (4) Portability: No large-scale instruments are required, only a conventional PCR instrument and a fluorescence detection device are needed, which can greatly reduce the detection cost and labor cost. Specific Embodiments

[0024] The present invention will be further described below in conjunction with embodiments, and the embodiments of the present invention include but are not limited to the following embodiments.

[0025] This embodiment provides a method for rapidly detecting Streptococcus anginosus, including:

[0026] I. Materials or Reagents: Genome extraction reagents; self-designed PCR primers and crRNA; CRISPR / Cas detection system (Buffer, Reporter, etc.)

[0027] II. Specific Detection Steps:

[0028] (1) Collect gastric biopsy, saliva or fecal samples, and extract DNA. The methods for DNA extraction include, but are not limited to, genomic DNA extraction kits, magnetic bead DNA extraction kits, alkaline lysis methods, lysis solution methods, heating methods, etc.

[0029] (2) Design crRNA and the F and R primers required for PCR;

[0030] The nucleotide sequence of crRNA is shown in SEQ ID NO:1;

[0031] The nucleotide sequence of the forward primer F is shown in SEQ ID NO:2;

[0032] The nucleotide sequence of the reverse primer R is shown in SEQ ID NO:3;

[0033] (3) crRNA targets the 16s rRNA gene; the F and R primers required for PCR specifically amplify the 16s rRNA gene;

[0034] (4) Using the DNA extracted in step (1) as the detection template for Streptococcus anginosus, perform amplification in a PCR system, and after amplification, the amplification product reacts in the CRISPR / Cas system; the PCR-CRISPR / Cas system also includes PCR amplification primers, Cas protein, fluorescently labeled ssDNA or ssRNA or ssDNA-RNA probe, PCR amplification system, and CRISPR / Cas cleavage reaction system;

[0035] Among them, the Cas protein includes, but is not limited to, Cas12a / Cas12b / Cas13a / Cas12a2 / Cas12f / Cas12g;

[0036] The fluorescently labeled ssDNA or ssRNA or ssDNA-RNA probe is a fluorescein-quencher dual-labeled reporter group, the fluorescein is carboxyfluorescein, the quencher is a dark quencher, and the sequence of the labeled probe in this example is Texas Red’-CCCCCC-BHQ2’;

[0037] The PCR amplification system includes, in terms of the final concentration: primer F 0.2 - 1 μM, primer R 0.2 - 1 μM; the conditions for PCR amplification are: amplification protocol: 95°C for 5 min; 95°C for 30 sec, 55 - 60°C for 30 sec, 72°C for 20 sec, 38 cycles; 72°C for 2 min; preferably, in this example, the concentration of primer F is 0.5 μM, the concentration of primer R is 0.5 μM, and the conditions for PCR amplification are 95°C for 5 min; 95°C for 30 sec, 55°C for 30 sec, 72°C for 20 sec, 38 cycles; 72°C for 2 min.

[0038] The CRISPR / Cas cleavage reaction system contains NEB buffer, and the NEB buffer includes components with the following mass concentrations: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , 100 μg / ml BSA, with a pH of 7.9 and water as the solvent;

[0039] The CRISPR / Cas cleavage reaction system includes, in terms of the final concentration: Cas protein 20 - 40 nM, crRNA 20 - 40 nM, fluorescently labeled ssDNA 150 - 250 nM; the conditions for the CRISPR / Cas cleavage reaction are: incubation at 36 - 42°C; preferably, in this example, the CRISPR / Cas cleavage reaction system includes, in terms of the final concentration: Cas protein 30 nM, crRNA 30 nM, fluorescently labeled ssDNA 200 nM; the conditions for the CRISPR / Cas cleavage reaction are: incubation at 40°C, and fluorescence is detected every 10 minutes for 2 hours.

[0040] (5) Then, real-time fluorescence detection is carried out.

[0041] The above detection method can be used to detect Streptococcus anginosus or serve as a biomarker for gastrointestinal tumors.

[0042] SEQ ID NO:1 (crRNA):

[0043] UAAUUUCUACUAAGUGUAGAUAAGCAUCUAACAUGUGUUACAUA

[0044] SEQ ID NO:2 (forward primer F): ACCGTAGCTTGCTACACCAT

[0045] SEQ ID NO:3 (reverse primer R): ACCACCTGTCACCGATGTTC

[0046] The following tests were carried out on the detection method provided in this example:

[0047] I. Detection limit experiment

[0048]

[0049] As can be seen from the above table, the PCR primers and crRNAs designed in this embodiment have good sensitivity and can detect samples at 1×10 -7 ng / μL.

[0050] II. Stability Experiment

[0051]

[0052]

[0053] As can be seen from the above table, the PCR-CRISPR / Cas system for detecting Streptococcus anginosus designed in this embodiment has good stability.

[0054] III. Specificity Experiment

[0055]

[0056]

[0057] As can be seen from the above table, the PCR-CRISPR / Cas system for detecting Streptococcus anginosus designed in this embodiment has good specificity.

[0058] IV. Detection of Clinical Samples

[0059]

[0060] As can be seen from the above table, the PCR-CRISPR / Cas system can detect Streptococcus anginosus in clinical samples. Patients No. 1 and No. 3 are positive, while patients No. 2, No. 4, and No. 5 are negative, and the results are consistent with the sequencing results.

[0061] In summary, the PCR-CRISPR / Cas system in this embodiment can detect Streptococcus anginosus, has a low detection limit, good stability and specificity, and the whole operation only takes 2 hours to interpret the results, featuring timeliness and convenience.

[0062] The above embodiments are only one of the preferred embodiments of the present invention and should not be used to limit the protection scope of the present invention. Any modifications or polishings made without substantial significance in the main design concept and spirit of the present invention, as long as the technical problems solved are still consistent with those of the present invention, should be included in the protection scope of the present invention.

Claims

1. A method for rapid detection of Streptococcus anginosus, characterized in that: include: S1, collect samples and extract DNA from samples; S2, amplifying the target DNA using a PCR amplification system, wherein the primers for PCR amplification are a forward primer F and a reverse primer R that specifically target the 16s rRNA gene of Streptococcus anginosus; S3, reacting the amplified product of step S2 in a CRISPR / Cas system, wherein the CRISPR / Cas system includes: crRNA, Cas protein, and a fluorescently labeled probe; the fluorescently labeled probe is a fluorescently labeled ssDNA or ssRNA or ssDNA-RNA probe; S4, real-time monitoring of the fluorescence signal changes, and judging the presence of Streptococcus anginosus based on the fluorescence intensity.

2. A method for rapid detection of Streptococcus anginosus according to claim 1, characterized in that: The nucleotide sequence of the forward primer F in step S2 is shown in SEQ ID NO:2, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO:

3.

3. A method for rapid detection of Streptococcus anginosus according to claim 2, characterized in that: In step S2, the PCR amplification system includes, in terms of final concentrations: primer F 0.2-1 μM, primer R 0.2-1 μM; the conditions for PCR amplification are: preliminary denaturation: 95°C for 5 min; cyclic amplification: 95°C for 30 s, 55-60°C for 30 s, 72°C for 20 s, for a total of 38 cycles; final extension: 72°C for 2 min.

4. A method for rapid detection of Streptococcus anginosus according to claim 3, characterized in that: In step S3, the CRISPR / Cas system includes, in terms of final concentrations: Cas protein 20-40 nM, crRNA 20-40 nM, and fluorescently labeled ssDNA 150-250 nM; the reaction conditions of the CRISPR / Cas system are: incubation at 36-42° C., and fluorescence detection every 10 minutes for 2 hours.

5. A method for rapid detection of Streptococcus anginosus according to claim 4, characterized in that: The CRISPR / Cas system also contains 3.6 mL of NEB buffer, which includes components with the following mass concentrations: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml BSA, pH 7.9, and the solvent is water.

6. A method for rapid detection of Streptococcus anginosus according to claim 5, characterized in that: The nucleotide sequence of crRNA is shown in SEQ ID NO: 1, which targets the 16S rRNA gene of the amplification product of step S2; the Cas protein is selected from Cas12a, Cas12b, Cas13a, Cas12a2, Cas12f or Cas12g; the fluorescently labeled ssDNA or ssRNA or ssDNA-RNA probe is a fluorescent-quencher dual-labeled reporter group.

7. A method for rapid detection of Streptococcus anginosus according to claim 6, characterized in that: The fluorescent labeling probe is a double labeling probe, the 5' end of which is labeled with Texas Red fluorescent element, and the 3' end of which is labeled with BHQ2 quenching group, and the sequence thereof is TexasRed'-CCCCCC-BHQ2'.

8. A method for rapid detection of Streptococcus anginosus according to claim 1, 3 or 7, characterized in that: The sample is a gastric biopsy, saliva or feces sample; the method for extracting DNA from the sample is one of a genomic DNA extraction kit, a magnetic bead DNA extraction kit, an alkaline lysis method, a lysis solution method, and a heating method.

Images