Application of AIM2 expression inhibitor in preparation of medicine for treating ovulation disorder of polycystic ovarian syndrome

Abstract

The invention provides application of an AIM2 expression inhibitor in preparation of a medicine for treating ovulation disorder of polycystic ovarian syndrome. Experiments show that AIM2 is highly expressed in ovaries and / or granulosa cells of a polycystic ovarian syndrome ovulation disorder patient and an animal model, and further show that by adding A151 to inhibit expression of AIM2, ovarian polycystic change can be reversed, the number of sinus follicles and atresia follicles is reduced, the number of corpus luteum, the number of oocytes and the rate of mature oocytes are increased, and the effect of inhibiting ovulation disorder of the polycystic ovarian syndrome is achieved. Therefore, the expression inhibitor of the AIM2 can be used for preparing a medicine for treating ovulation disorder of the polycystic ovarian syndrome.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the application of an AIM2 expression inhibitor in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome. Background Art

[0002] Polycystic ovary syndrome (PCOS) is a common reproductive endocrine and metabolic disease, and its prevalence rate is 8%-13% among women of childbearing age. It is often manifested as ovulation disorders, insulin resistance, hyperinsulinemia, obesity, hyperandrogenism, infertility, polycystic ovarian changes, and an increased cardiovascular risk, etc. Since its pathogenesis is unclear, the clinical treatment of PCOS mainly focuses on symptomatic treatment and adopts an individualized treatment plan. For PCOS patients with fertility requirements, the treatment methods mainly include lifestyle adjustments, menstrual cycle regulation, alleviating hyperandrogenism symptoms, etc. If pregnancy is still not achieved after the above treatment, the patient can choose to use ovulation induction and assisted reproductive technologies for treatment. However, the treatment results are still affected by many factors. Therefore, exploring the pathogenesis and molecular pathways of PCOS is of great significance for finding its treatment targets.

[0003] Granulosa cells (GCs) are the most important cell type in the ovary except for oocytes and play an important role in maintaining ovarian function. Granulosa cells (GCs), cumulus cells (CCs), oocytes, macrophages, and follicular fluid, etc. form a follicular microenvironment that promotes oocyte maturation and ovulation. Some studies have confirmed that GC apoptosis will lead to the loss of biological functions of follicles in PCOS patients and the imbalance of regulation among cells in the follicles, ultimately resulting in follicular atresia. Therefore, the disruption of the balance of the follicular microenvironment caused by various reasons will cause further abnormalities in follicular development, thus resulting in follicular atresia and ultimately leading to ovulation dysfunction.

[0004] Therefore, there is an urgent need to develop effective drug treatment targets for ovulation disorders in polycystic ovary syndrome and drugs for treating ovulation disorders in polycystic ovary syndrome. Summary of the Invention

[0005] The object of the present invention is to provide the application of AIM2 as a target in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome. Through experiments, the present invention has found that AIM2 is highly expressed in the ovaries and granulosa cells of patients with ovulation disorders in polycystic ovary syndrome. Further, it is found that adding A151 to inhibit the expression of AIM2 can reverse polycystic ovarian changes, reduce the number of antral follicles and atretic follicles, and increase the number of corpora lutea, the number of oocytes, and the mature oocyte rate. Therefore, an AIM2 expression inhibitor can be used in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, there is provided the use of AIM2 as a target in screening for drugs for alleviating and / or treating ovulation disorders in polycystic ovary syndrome, and the screening method includes screening for substances capable of inhibiting the expression of the AIM2 gene.

[0008] In the second aspect of the present invention, there is provided the use of an AIM2 expression inhibitor in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome.

[0009] Further, the AIM2 expression inhibitor includes at least one of the following components:

[0010] AIM2 inhibitor, antagonist, down-regulator, blocker, blocking agent;

[0011] AIM2 knockout reagent.

[0012] Further, the AIM2 inhibitor includes a protein that specifically binds to AIM2, a small interfering molecule that specifically interferes with the expression and processing of the AIM2 gene, or a recombinant vector containing the small interfering molecule that specifically interferes with the expression and processing of the AIM2 gene.

[0013] Further, the AIM2 inhibitor includes A151.

[0014] Further, the drug for treating ovulation disorders in polycystic ovary syndrome is a drug for improving nerve function injury and brain edema in SAH mice and reducing lipid peroxidation injury.

[0015] In the third aspect of the present invention, there is provided a drug for treating ovulation disorders in polycystic ovary syndrome, and the drug includes at least one of an AIM2 inhibitor and an AIM2 knockout reagent.

[0016] The AIM2 inhibitor includes A151. As a specific embodiment, it is purchased from MedChemExpress, catalog number: HY-150751.

[0017] ODN TTAGGG (A151), an inhibitory oligonucleotide (ODN), is an antagonist of TLR9, AIM2, and cGAS. ODNTTAGGG has immunosuppressive effects and can inhibit AIM2 inflammasome activation and cGAS activation by competing with DNA. ODN TTAGGG can be used in the research of related autoimmune diseases such as lupus erythematosus. The sequence of ODN TTAGGG is: 5'-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-T-T-A-G-G-G-3'.

[0018] The AIM2 knockout reagent described above includes: shRNA and / or gRNA targeting the target gene.

[0019] The drug also includes pharmaceutically acceptable excipients. The excipients include at least one of fillers, disintegrants, binders, excipients, diluents, lubricants, sweeteners, or colorants. The dosage forms of the drug include at least one of granules, tablets, pills, capsules, injections, or dispersants.

[0020] In the fourth aspect of the present invention, there is provided the use of AIM2 as a molecular marker in the preparation of diagnostic and / or prognostic products for drugs treating ovulation disorders in polycystic ovary syndrome.

[0021] Furthermore, the use of a detection reagent for AIM2 in the preparation of diagnostic and / or prognostic products for drugs treating ovulation disorders in polycystic ovary syndrome.

[0022] Furthermore, the detection reagent for AIM2 includes a detection reagent for AIM2 protein (such as an ELISA detection kit). In other embodiments, the detection reagent for AIM2 also includes detection primers for AIM2 or immunohistochemical detection reagents.

[0023] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0024] The present invention provides the use of AIM2 as a target in the preparation of a drug for treating ovulation disorders in polycystic ovary syndrome. Through research, it is found in the present invention that AIM2 is highly expressed in granulosa cells and ovaries of PCOS patients and can induce ovulation disorders. By providing the AIM2 inhibitor A151, ovulation disorders can be reversed. It is speculated that AIM2 may be involved in the pathogenesis of PCOS ovulation disorders. These results indicate that AIM2 is a new target for drug treatment of PCOS ovulation disorders. It shows that the AIM2 knockout reagent or / and AIM2 inhibitor is a potential new drug for the treatment of PCOS ovulation disorders. The present invention targets an important signaling pathway for the onset of PCOS ovulation disorders, finds the important molecular target AIM2 in the pathogenesis of PCOS, which can be used as a future treatment target for PCOS ovulation disorders, and provides new ideas for the research on the molecular mechanism of PCOS and treatment methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0026] Figure 1: The expression of AIM2 increases in PCOS granulosa cells and ovaries, and the expression of IFN-γ increases in PCOS ovaries and can induce the increase of AIM2 expression. (A): The expression of AIM2 at the mRNA level in granulosa cells of PCOS patients' ovaries, KGN cells in the DHT (Dihydrotestosterone) group, and granulosa cells of the ovaries of the PCOS mouse model induced by DHEA (Dehydroepiandrosterone). ** indicates P < 0.01, *** indicates P < 0.001. (B): The expression of AIM2 at the protein level in granulosa cells of PCOS patients' ovaries, KGN cells in the DHT group, and granulosa cells of the ovaries of the PCOS mouse model induced by DHEA. (C): The expression of IFN-γ at the mRNA level in granulosa cells of PCOS patients' ovaries, KGN cells in the DHT group, and granulosa cells of the ovaries of the PCOS mouse model induced by DHEA. ** indicates P < 0.01. (D): ELISA results of IFN-γ in the supernatant of primary granulosa cell culture medium, the supernatant of KGN cell culture medium in the DHT group, and the serum of the PCOS mouse model induced by DHEA. *** indicates P < 0.001. (E): The expression of AIM2 at the mRNA and protein levels in KGN cells in the LPS group, IFN-γ group, and LPS + IFN-γ group. *** indicates P < 0.001. (F): The expression of COX2 and HAS2 at the mRNA and protein levels after LPS + IFN-γ intervention in KGN cells. ** indicates P < 0.01, **** indicates P < 0.0001. (G): ELISA results of HA in the supernatant of primary granulosa cell culture medium, after LPS, IFN-γ, LPS + IFN-γ intervention in KGN cell culture supernatant, and the serum of the PCOS mouse model induced by DHEA. *** indicates P < 0.001. (H): ELISA results of PGE 2 in the supernatant of primary granulosa cell culture medium, after LPS, IFN-γ, LPS + IFN-γ intervention in KGN cell culture supernatant, and the serum of the PCOS mouse model induced by DHEA. *** indicates P < 0.001.

[0027] Figure 2: Inhibiting AIM2 can inhibit the indicators related to ovulatory disorders in granulosa cells. (A): The expression levels of AIM2 at the mRNA and protein levels in KGN cells after treatment with A151 in the LPS+IFN-γ group and after LPS+IFN-γ intervention in KGN cells, and in KGN cells treated with A151 alone. ** indicates P < 0.01, *** indicates P < 0.001. (B): The expression levels of COX2 at the mRNA and protein levels in KGN cells after treatment with A151 in the LPS+IFN-γ group and after LPS+IFN-γ intervention in KGN cells, and in KGN cells treated with A151 alone. *** indicates P < 0.001, **** indicates P < 0.0001. (C): The ELISA results of PGE 2 in the culture medium supernatant of KGN cells after LPS+IFN-γ intervention and treatment with A151 in the LPS+IFN-γ group. *** indicates P < 0.001.

[0028] Figure 3 : Schematic diagram of the mouse modeling and superovulation experiment pattern.

[0029] Figure 4 : The expression of AIM2 increases in the ovaries of PCOS mice. Inhibiting AIM2 can inhibit the indicators related to ovulatory disorders. (A): The expression levels of AIM2 at the mRNA and protein levels in ovarian granulosa cells of PCOS mouse models induced by DHEA and PCOS mouse models induced by DHEA and A151. ** indicates P < 0.01, *** indicates P < 0.001. (B): The expression levels of COX2 at the mRNA and protein levels in ovarian granulosa cells of PCOS mouse models induced by DHEA and PCOS mouse models induced by DHEA and A151. ** indicates P < 0.01. (C): The ELISA results of PGE 2 in the sera of PCOS mouse models induced by DHEA and PCOS mouse models induced by DHEA and A151. (D): Schematic diagram of vaginal smears and estrous cycles of PCOS mouse models induced by DHEA and PCOS mouse models induced by DHEA and A151. (E): Schematic diagram of HE staining of ovaries of PCOS mouse models induced by DHEA and PCOS mouse models induced by DHEA and A151. (F): Schematic diagram of the numbers of primordial follicles, primary follicles, secondary follicles, antral follicles, atretic follicles, and corpora lutea in the ovaries of PCOS mouse models induced by DHEA and PCOS mouse models induced by DHEA and A151.

[0030] Figure 5:Mouse model confirms that inhibiting AIM2 can reverse PCOS ovulation disorder. (A): Pictures of superovulated oocytes of PCOS mice and PCOS mice treated with A151. (B): Count of retrieved oocytes and rate of mature oocytes after superovulation in PCOS mice and PCOS mice treated with A151. * indicates P < 0.1, ** indicates P < 0.01. Detailed implementation manners

[0031] The present invention will be specifically described below in combination with the detailed implementation manners and examples, and the advantages and various effects of the present invention will be more clearly presented therefrom. Those skilled in the art should understand that these detailed implementation manners and examples are used to illustrate the present invention, rather than to limit the present invention.

[0032] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention pertains. In case of any contradiction, this specification shall prevail.

[0033] Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment, etc. used in the present invention can be obtained through market purchase or can be obtained by existing methods.

[0034] The application of AIM2 as a target in the preparation of a drug for treating ovulation disorder in polycystic ovary syndrome will be described in detail below in combination with examples and experimental data.

[0035] Example 1: Increased expression of AIM2 in PCOS granulosa cells and ovaries

[0036] I. Research objects and materials

[0037] 1. Research objects: PCOS patients (n = 37) and non-PCOS patients (n = 42) who visited the Reproductive Center of Renmin Hospital of Wuhan University from March to June 2022 were collected. The PCOS group was diagnosed according to the Rotterdam criteria in 2003 and met at least two of the following three symptoms: reduced or absent ovulation, clinical and / or biochemical signs of hyperandrogenism, and polycystic ovaries after excluding other etiologies. The control group consisted of women with infertility mainly due to male factors alone. This study has been approved by the Ethics Committee of Renmin Hospital of Wuhan University, and all patients have been informed and signed the informed consent form.

[0038] 2. Collection of follicular fluid (FF): Follicular fluid from 76 patients was obtained from the follicular aspirates collected during oocyte retrieval after a superovulation stimulation protocol.

[0039] II. Experimental methods

[0040] 1. Extraction and culture of primary human granulosa cells

[0041] (1) Extraction of GC: Centrifuge FF at 1500 rpm for 10 minutes, and then discard the supernatant. Suspend the precipitate in PBS (Gibco, Invitrogen Life Technologies), slowly add the cell suspension to Ficoll (Sigma) at a ratio of 1:1, and centrifuge at 1800 rpm for 20 minutes. Aspirate the middle white granulosa cell layer with a Pasteur pipette, incubate with red blood cell lysis buffer (Biosharp) for 5 minutes, and wash with PBS.

[0042] (2) Culture of GC: The washed GC is cultured in a 6-well plate of DMEM / F12 supplemented with 10% FBS, penicillin / streptomycin sulfate (100 U / mL and 100 μg / mL respectively) at 37 °C in 5% CO 2 (5×10 5 cells / well).

[0043] 2. Culture and treatment of human ovarian granulosa cell cancer cell line (KGN cell line)

[0044] (1) Source of KGN cells: Purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China).

[0045] (2) Culture of KGN cells: The culture method is the same as that of primary granulosa cells, and it is cultured in a 6-well plate of DMEM / F12 supplemented with 10% FBS, penicillin / streptomycin sulfate (100 U / mL and 100 μg / mL respectively) at 37 °C in 5% CO 2 (5×10 5 cells / well).

[0046] 3. Treatment of KGN cells: Both LPS and IFN-γ drug powders are prepared into drug solutions using 1×PBS, induce KGN cells with LPS and IFN-γ, and divide them into a control group, an LPS group, an IFN-γ group, and an LPS+IFN-γ group. Treat the cells with PBS, 1 ng / μl LPS, 100 ng / ml IFN-γ, 1 ng / μl LPS + 100 ng / ml IFN-γ for 24 h respectively. In addition, before co-inducing KGN cells with LPS+IFN-γ, pretreat KGN cells with A151 (1 μM) for 1 hour, denoted as the LPS+IFN-γ+A151 group.

[0047] 4. Construction of PCOS mouse model

[0048] Forty 21-day-old female ICR mice were housed in an SPF animal facility under standard conditions (22 - 24 °C and 60 - 70% relative humidity) with free access to food and water. The mice were randomly divided into three groups: a control group, a PCOS group, and a PCOS + A151 group. The control group was injected with olive oil and gavaged with normal saline daily. The PCOS group was injected with dehydroepiandrosterone (DHEA) (dissolved in olive oil, 6 mg / 100 g / day) and gavaged with normal saline daily. The PCOS + A151 group was injected with DHEA and intraperitoneally injected with A151 (dissolved in PBS, 300 μg / mouse), once every 7 days for a total of 3 times. During the intervention period, all animals were weighed daily, and vaginal smears were collected daily starting from the 10th day after the first DHEA injection until the end of the experiment. The mice were sacrificed 21 days after the first injection. After an overnight fast, blood was collected and centrifuged, and serum samples were collected and stored at -80 °C for further analysis. One ovary was dissected for PCR or western blot analysis, while the other ovary was fixed in 10% paraformaldehyde solution for sectioning, staining, and other experiments. All protocols and experiments were approved by the Animal Care and Use Committee of Wuhan University (Ethical Approval Number: WDRY2018-K009).

[0049] 5. By extracting RNA and reverse transcribing RNA into cDNA, real-time PCR was performed to detect the expression of target genes at the mRNA level

[0050] Granulosa cells were extracted from the follicular fluid of patients, KGN cells were intervened with DHT (500 nM, treated for 24 h), and a PCOS mouse model was induced by dehydroepiandrosterone (DHEA). Subsequently, RNA was extracted from granulosa cells, KGN cells, and mouse ovarian granulosa cells, reverse transcribed into cDNA, and real-time PCR was used to detect the expression of AIM2 at the mRNA level.

[0051] Human AIM2 gene target sequence:

[0052] F: GCTGCACCAAAAGTCTCTCCTC (SEQ ID NO.1);

[0053] R: CTGCTTGCCTTCTTGGGTCTCA (SEQ ID NO.2);

[0054] Mouse AIM2 gene target sequence:

[0055] F: AGGCTGCTACAGAAGTCTGTCC (SEQ ID NO.3);

[0056] R: TCAGCACCGTGACAACAAGTGG (SEQ ID NO.4).

[0057] III. Experimental Results

[0058] 1. RNA was extracted and reverse transcribed into cDNA, and real-time PCR was performed to detect the expression of the target gene at the mRNA level.

[0059] The results are as Figure 1 shown in (A). Compared with the control group, the expression of AIM2 at the mRNA level increased in ovarian granulosa cells of PCOS patients, DHT-treated KGN cells, and ovarian granulosa cells of PCOS mouse models induced by DHEA.

[0060] 2. Granulosa cells were extracted from follicular fluid, KGN cells were treated with DHT, and PCOS mouse models were induced by DHEA. Subsequently, the expression of AIM2 at the protein level was detected.

[0061] The results are as Figure 1 shown in (B). Compared with the control group, the expression of AIM2 at the protein level increased in ovarian granulosa cells of PCOS patients, DHT-treated KGN cells, and ovarian granulosa cells of PCOS mouse models induced by DHEA.

[0062] Example 2: IFN-γ expression increases in PCOS ovaries and can induce an increase in AIM2 expression

[0063] 1. Detection of IFN-γ mRNA expression level

[0064] After granulosa cells were extracted from the follicular fluid of patients, KGN cells were treated with dihydrotestosterone (DHT) (500 nM, for 24 hours), and PCOS mouse models were induced by DHEA. Granulosa cells, KGN cells, and ovarian RNA of PCOS mice were extracted, reverse transcribed into cDNA, and real-time PCR was performed to detect the expression level of IFN-γ mRNA. The target sequence of the human IFN-γ gene is F: GTGGAGACCATCAAGGAAGACA, R: GCGACAGTTCAGCCATCACT. The target sequence of the mouse IFN-γ gene is F: TCAGCAACAGCAAGGCGAAA, R: CTGGTGGACCACTCGGATGA.

[0065] The results are as Figure 1 shown in (C). Compared with the control group, the expression of IFN-γ at the mRNA level increased in ovarian granulosa cells of PCOS patients, DHT-treated KGN cells, and ovarian granulosa cells of PCOS mouse models induced by DHEA.

[0066] 2. The supernatant of the primary ovarian granulosa cell culture medium, the supernatant of the DHT-treated KGN cell culture medium, and the serum of PCOS mice induced by DHEA were taken, and the IFN-γ level was detected by ELISA.

[0067] The results are as Figure 1 (D) shows that compared with the control group, the levels of IFN-γ in the supernatant of primary ovarian granulosa cell culture medium, the supernatant of DHT-treated KGN cell culture medium, and the serum of PCOS mouse models induced by DHEA increased.

[0068] 3. Detect the AIM2 mRNA and protein levels in KGN cells of the LPS group, IFN-γ group, and LPS + IFN-γ group. The method is the same as above. The results are as Figure 1 (E) shows that compared with the control group, the expression of AIM2 in KGN cells of the LPS + IFN-γ group increased at both the mRNA and protein levels.

[0069] 4. Detect the expression of HAS2 and COX2 in KGN cells of the control group, LPS group, IFN-γ group, and LPS + IFN-γ group at the mRNA and protein levels. The method is the same as above. The target sequence of the human HAS2 gene is F: TCCTGGATCTCATTCCTCAGC, R: TGCACTGAACACACCCAAAATA.

[0070] The results are as Figure 1 (F) shows that compared with the control group, the expression levels of HAS2 and COX2 mRNA and protein in KGN cells of the LPS group and IFN-γ group increased significantly, while the expression levels of HAS2 and COX2 mRNA and protein in KGN cells of the LPS + IFN-γ group increased more significantly.

[0071] 5. Take the supernatant of primary ovarian granulosa cell culture medium, the supernatant of KGN cells in the LPS group, IFN-γ group, and LPS + IFN-γ group, and the serum of PCOS mouse models induced by DHEA, and detect the levels of HA and PGE 2 by ELISA.

[0072] The results are as Figure 1 (G) and Figure 1 (H) show that compared with the control group, the levels of HA and PGE 2 in the supernatant of primary ovarian granulosa cell culture medium, the supernatant of KGN cells in the LPS group, IFN-γ group, and LPS + IFN-γ group, and the serum of PCOS mouse models induced by DHEA increased.

[0073] Example 3: Inhibiting AIM2 can inhibit the ovulation disorder-related indicators of granulosa cells

[0074] 1. Use A151 to inhibit the expression of AIM2

[0075] Detect the AIM2 and COX2 mRNA and protein levels in KGN cells of the control group, LPS+IFN-γ group, LPS+IFN-γ+A151 group, and A151 group. The method is the same as above. The results are as Figure 2 (A) and Figure 2 (B) show that compared with the control group, the expression levels of AIM2 and COX2 mRNA and protein in KGN cells of the LPS+IFN-γ group increased, while those in KGN cells of the LPS+IFN-γ+A151 group decreased. After treating KGN cells with A151 alone, there was no significant change in the expression levels of AIM2 mRNA and protein.

[0076] 2. Detect HA and PGE 2 levels

[0077] Detect the PGE 2 secretion levels in the culture medium supernatant of KGN cells in the control group, LPS+IFN-γ group, and LPS+IFN-γ+A151 group. The method is the same as above. The results are as Figure 2 (C) show that compared with the control group, the PGE 2 level in the culture medium supernatant of KGN cells in the LPS+IFN-γ group increased, while the PGE 2 level in the culture medium supernatant of KGN cells in the LPS+IFN-γ+A151 group decreased.

[0078] 3. Detect the related indicators of granulosa cell ovulation disorder

[0079] Detect the AIM2 at the mRNA and protein levels in ovarian granulosa cells of the mouse models in the control group, DHEA group, and DHEA+A151 group. The method is the same as above. The results are as Figure 4 (A) show that compared with the control group of mice, the expression of AIM2 at the mRNA and protein levels in ovarian granulosa cells of the mouse models in the DHEA group and DHEA+A151 group increased.

[0080] Detect the COX2 at the mRNA and protein levels in ovarian granulosa cells of the mouse models in the control group, DHEA group, and DHEA+A151 group. The method is the same as above. The results are as Figure 4 (B) show that compared with the control group of mice, the expression of COX2 at the mRNA and protein levels in ovarian granulosa cells of the mouse models in the DHEA group and DHEA+A151 group increased.

[0081] Detect the PGE 2 secretion levels in the sera of the control group, DHEA group, and DHEA+A151 group of mice. The method is the same as above. The results are as Figure 4 (C) show that compared with the control group of mice, the PGE 2The level of PGE in the serum of mice in the DHEA+A151 group was 2 Levels dropped significantly.

[0082] The mice in the control group, DHEA group, and DHEA+A151 group underwent vaginal smears and observed their estrous cycles for 14 consecutive days. Figure 4 (D) As shown, compared with the control group, the estrous cycle of PCOS mice was disrupted, while after PCOS mice were treated with A151, the estrous cycle of the mice returned to normal.

[0083] The ovaries of mice in the control group, DHEA group, and DHEA+A151 group were stained with HE. The results are as follows: Figure 4 As shown in (E), the ovaries of PCOS mice showed polycystic changes, and A151 treatment of PCOS mice could reverse the polycystic changes in the ovaries of mice.

[0084] The ovaries of mice in the control group, DHEA group, and DHEA+A151 group were sliced ​​and the follicles of various levels in the ovarian slices were counted. The results are as follows: Figure 4 As shown in (F), compared with the control group, the number of antral follicles and atretic follicles in PCOS mice increased, and the number of corpora lutea decreased. However, after PCOS mice were treated with A151, the number of antral follicles in PCOS mice did not change significantly, the number of atretic follicles decreased, and the number of corpora lutea increased.

[0085] 4. Mouse modeling and superovulation experiments

[0086] Mice were superovulated by intraperitoneal injection of PMSG (5 IU / mouse), and HCG (5 IU / mouse) was injected intraperitoneally 48 hours later. Rats were killed at a predetermined time after superovulation. 16 hours after HCG injection, cumulus-oocyte complexes (COCs) were collected from the oviduct. Oocytes were released from cumulus cells by digestion with 0.1% hyaluronidase (Vitrolife, Frolunda, Sweden) for 5 minutes. Photos were taken under a microscope, and the oocytes reaching the MII stage were recorded and the mature oocyte rate was calculated.

[0087] The results are as follows Figure 5 (A) and Figure 5 As shown in (B), compared with the control group, the number of oocytes and the rate of mature oocytes in PCOS mice were significantly reduced, while after PCOS mice were treated with A151, the number of oocytes and the rate of mature oocytes in PCOS mice were increased.

[0088] Finally, it should also be noted that the term "comprising", "including" or any other variation thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or elements inherent to such process, method, article or apparatus.

[0089] Although the preferred embodiments of the present invention have been described, additional changes and modifications can be made to these embodiments by those skilled in the art once they learn of the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention.

[0090] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. Use of AIM2 as a target in screening drugs for alleviating and / or treating ovulation disorders in polycystic ovary syndrome, characterized in that: The screening method includes screening substances that can inhibit AIM2 gene expression or downregulate AIM2 expression.

2. Application of an AIM2 expression inhibitor in the preparation of a drug for treating ovulatory disorders caused by polycystic ovary syndrome.

3. The use according to claim 2, characterized in that: The AIM2 expression inhibitor comprises at least one of the following components: AIM2 inhibitors, antagonists, downregulators, blockers, blocking agents; Knockdown reagent for AIM2.

4. The use according to claim 3, characterized in that: The AIM2 inhibitor includes a protein that specifically binds to AIM2, a small interfering molecule that specifically interferes with the expression and processing of the AIM2 gene, or a recombinant vector containing the small interfering molecule that specifically interferes with the expression and processing of the AIM2 gene.

5. The use according to claim 3, characterized in that: The AIM2 inhibitors include A151.

6. The use according to claim 2, characterized in that: The drug for treating ovulation disorder caused by polycystic ovary syndrome is a drug that reverses polycystic changes in the ovaries, reduces the number of antral follicles and atretic follicles, and increases the number of corpora lutea, the number of oocytes and the rate of mature oocytes.

7. A drug for treating ovulation disorder caused by polycystic ovary syndrome, characterized in that: The active ingredient of the drug includes at least one of an AIM2 inhibitor and an AIM2 knockout agent.

8. Application of AIM2 as a molecular marker in the preparation of diagnostic and / or prognostic products for polycystic ovary syndrome ovulatory disorders.

9. Use of AIM2 detection reagent in the preparation of diagnostic and / or prognostic products for polycystic ovary syndrome ovulation disorder drugs.

10. The use according to claim 9, characterized in that: The AIM2 detection reagent includes an AIM2 detection primer or an immunohistochemical detection reagent.

Images