CircRNA (Ribonucleic Acid) molecule for inhibiting malignant transformation of cervical cancer and application of circRNA molecule

Abstract

The invention relates to an application of a circ0002828 detection agent in preparation of a cervical cancer or cervical cancer prognosis reagent or kit. The circ0002828 has a nucleotide sequence as shown in SEQ ID NO. 1. The invention also provides an application of the circ0002828 in preparation of drugs for treating cervical cancer or metastasis of cervical cancer. The circ0002828 has a nucleotide sequence shown as SEQ ID NO.1. The invention discloses the tumor inhibition effect of the circ0002828 in cervical cancer for the first time. The circ0002828 has the functions of inhibiting proliferation, metastasis and angiogenesis of cervical cancer in vivo and in vitro. In mechanism, circ0002828 and DLGAP5 mRNA can be competitively combined with EIF4A3, so that the expression of DLGAP5 is reduced, the expression of gankyrin is increased, a p53 signal channel is activated, and tumor generation is inhibited. The circ0002828 is expected to become a candidate molecule for developing a novel cervical cancer treatment strategy.

Description

Technical Field

[0001] The present invention belongs to the fields of disease diagnosis and drug targets, and specifically relates to, specifically, a circRNA molecule that inhibits the malignant transformation of cervical cancer and its application. Background Art

[0003] Cervical cancer is the fourth most common cancer globally, seriously threatening women's health.

[0004] Human papillomavirus (HPV) is a small circular double-stranded DNA virus. Approximately 5% of cancers are associated with HPV infection, but almost all cervical cancer patients can be attributed to high-risk HPV subtype infections. However, not all high-risk HPV subtype infections lead to cervical cancer. 85%-90% of HPV infections can be spontaneously cleared, and only 10%-15% of persistent infections lead to cervical intraepithelial neoplasia and then progress to cervical cancer. Currently, prophylactic cervical cancer vaccines have been marketed, and the vaccination of HPV vaccines is an effective primary prevention measure for cervical cancer; the screening of HPV infection and cervical cytology testing have also become effective methods for cervical cancer screening. For women with cervical precancerous lesions or cervical cancer, the vaccination of HPV vaccines is ineffective. Therefore, it is urgent to further clarify the molecular mechanism of the occurrence and development of cervical cancer and actively screen for potential novel specific molecular targets for the treatment of cervical cancer, which has important scientific significance for improving the cure rate and reducing the mortality rate of cervical cancer.

[0005] Biological Characteristics and Application Potential of Circular RNAs

[0006] Circular RNA (circRNA) is a class of non-coding RNAs with a closed-loop structure that lacks a 5'-end cap and a 3'-end tail. These unique structures of circRNA endow it with the characteristics of rich expression, structural stability, and tissue specificity, enabling it to survive in a complex microenvironment. With the progress of gene sequencing and bioinformatics technologies in recent years, a large number of circRNAs have been found to be involved in various biological processes such as cancer proliferation, migration, invasion, and drug resistance. The mechanism of action of circRNA is also complex and diverse. The most common mechanism of action is the ceRNA mechanism. Most circRNA sequences contain miRNA binding sites, which enables them to interact with miRNAs. This interaction prevents the binding of miRNAs and mRNAs, thereby forming a circRNA-miRNA-mRNA functional network. CircRNAs containing RNA-binding protein (RBP) binding sites can participate in protein translation; circRNAs can also serve as scaffolds for protein complex assembly; circRNAs containing internal ribosome entry site (IRES) elements and open reading frames can be translated into proteins or polypeptides, etc. The roles of some circRNAs such as circTPCN and circZFR in cervical cancer have been reported. However, the functions of most circRNAs have not been elucidated. There is an urgent need to further clarify the molecular mechanism of the occurrence and development of cervical cancer and actively screen for potential novel specific molecular targets for the treatment of cervical cancer, which is of great scientific significance for improving the cure rate and reducing the mortality rate of cervical cancer.

[0007] Chinese patent document CN115369165A discloses the use of circular RNA circ-0036602 or its detection reagent in the preparation of drugs for preventing or treating cervical cancer or evaluating the prognosis of cervical cancer. The present invention also discloses a reagent or kit for detecting the expression level of circular RNA circ-0036602 in cervical cancer tissues or cells, normal cervical cells, or HPV16-negative cells. The circular RNA (circ-0036602) disclosed in the present invention is a reliable molecular target related to the prognosis of HPV16-positive cervical cancer. The prognosis can be judged by detecting the expression level of this type of gene in patients, guiding the formulation of individualized chemotherapy regimens in clinical practice, and improving the curative effect.

[0008] However, there has been no report on a circ_0002828 molecule that inhibits the malignant transformation of cervical cancer and its application. Summary of the Invention

[0009] The object of the present invention is to provide a circ_0002828 molecule and its application in view of the deficiencies in the prior art.

[0010] In a first aspect, the present invention provides the use of a detection agent for circ_0002828 in the preparation of a cervical cancer reagent or kit, wherein circ_0002828 has the nucleotide sequence shown in SEQ ID NO.1.

[0011] As a preferred example, the detection agent is a quantitative detection agent.

[0012] As another preferred example, the quantitative detection agent comprises reagents applicable to at least one of the following methods: fluorescence dye method, digital PCR, resonance light scattering method, real-time fluorescence quantitative PCR, sequencing, or biomass spectrometry.

[0013] In a second aspect, the present invention provides the use of a detection agent for circ_0002828 in the preparation of a cervical cancer prognosis reagent or kit, wherein circ_0002828 has the nucleotide sequence shown in SEQ ID NO.1.

[0014] As a preferred example, the detection agent is a quantitative detection agent.

[0015] As another preferred example, the quantitative detection agent comprises reagents applicable to at least one of the following methods: fluorescence dye method, digital PCR, resonance light scattering method, real-time fluorescence quantitative PCR, sequencing, or biomass spectrometry.

[0016] In a third aspect, the present invention provides the use of circ_0002828 in the preparation of a drug for treating cervical cancer or the metastasis of cervical cancer, wherein circ_0002828 has the nucleotide sequence shown in SEQ ID NO.1.

[0017] In a fourth aspect, the present invention provides the use of an enhancer of circ_0002828 in the preparation of a drug for treating cervical cancer or the metastasis of cervical cancer, characterized in that circ_0002828 has the nucleotide sequence shown in SEQ ID NO.1.

[0018] In a fifth aspect, the present invention provides the use of circ_0002828 or its enhancer in the preparation of an experimental reagent, and the uses are selected from:

[0019] (1) Inhibiting the proliferation, metastasis, and angiogenesis of cervical cancer cells in vitro;

[0020] (2) Inhibiting the migration ability of cervical cancer cells in vitro;

[0021] (3) Inhibiting the tumor size in a cervical cancer animal model.

[0022] The circ_0002828 has the nucleotide sequence shown in SEQ ID NO.1.

[0023] The advantages of the present invention are as follows: The present invention firstly reveals the tumor-suppressive effect of circ_0002828 in cervical cancer. Circ_0002828 has the functions of inhibiting the proliferation, metastasis and angiogenesis of cervical cancer in vitro and in vivo. Mechanistically, circ_0002828 can competitively bind to DLGAP5 mRNA with EIF4A3, resulting in a decrease in DLGAP5 expression and an increase in gankyrin expression, thereby activating the p53 signaling pathway and inhibiting tumorigenesis. Circ_0002828 is expected to become a candidate molecule for developing new treatment strategies for cervical cancer. By revealing the key role of circ_0002828 in cervical cancer, the present invention proposes a brand-new treatment idea, which has important scientific significance and clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : Circ_0002828 is significantly down-regulated in cervical cancer and is negatively correlated with the tumor size of cervical cancer patients.

[0025] Figure 2 : Circ_0002828 has a stable circular structure and is mainly distributed in the cytoplasm.

[0026] Figure 3 : Circ_0002828 can inhibit the proliferation of cervical cancer.

[0027] Figure 4 : Circ_0002828 can inhibit the metastasis of cervical cancer.

[0028] Figure 5 : Circ_0002828 can inhibit the angiogenesis of cervical cancer.

[0029] Figure 6 : Circ_0002828 can bind to EIF4A3, but does not affect its expression and cell distribution.

[0030] Figure 7 : Circ_0002828 regulates the degradation of DLGAP5 by recruiting EIF4A3. DETAILED DESCRIPTION OF THE INVENTION

[0031] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, it should be understood that after reading the content recorded in the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

[0032] The >hsa_circ_0002828 in the present invention has the following sequence:

[0033] GGAGGTGGTTGACTCAATGGTTCAGCATTTTAAAGTAACTATATTTGGAGACCGTAGACCAGTTTATGATGGAAAAAGAAGTCTTTACACCGCCAATCCACTTCCTGTGGCAACTACAGGGGTAGATTTAGACGTTACTTTACCTGGGGAAGGTGGAAAAGATCGACCTTTCAAGGTGTCAATCAAATTTGTCTCTCGGGTGAGTTGGCACCTACTGCATGAAGTACTGACAGGACGGACCTTGCCTGAGCCACTGGAATTAGACAAGCCAATCAGCACTAACCCTGTCCATGCCGTTGATGTGGTGCTACGACATCTGCCCTCCATGAAATACACACCTGTGGGGCGTTCATTTTTCTCCGCTCCAGAAGGATATGACCACCCTCTGGGAGGGGGCAGGGAAGTGTGGTTTGGATTCCATCAGTCTGTTCGGCCTGCCATGTGGAAAATGATGCTTAATATCGATG(SEQ ID NO:1).

[0034] Example 1

[0035] Experimental materials and methods

[0036] (1) Analyze the expression and clinical significance of circ_0002828 in cervical cancer

[0037] 1) Collection and processing of clinical tissue and blood samples: 100 cases of cancer and adjacent tissue samples and peripheral blood samples of cervical cancer patients were collected respectively, and 100 cases of peripheral blood samples of healthy volunteers were collected. None of the patients included in the study had other tumors and none had received any preoperative radiotherapy or chemotherapy. After adding anticoagulant, the peripheral blood samples were stored in a -80 °C refrigerator or used for subsequent tests after serum precipitation; some of the tissue samples were directly used for subsequent experiments, and some were immediately frozen in liquid nitrogen for later use; the clinical data and follow-up data of the above samples were collected, and the histological type of the samples was based on routine pathological examination.

[0038] 2) Detect the expression of circ_0002828 in each sample by qRT-PCR;

[0039] 3) Analyze the relationship between the expression level of circ_0002828 and clinicopathological features such as histological type, FIGO stage, tumor size and lymph node metastasis of cervical cancer patients.

[0040] (2) In vitro and in vivo verification of the effect of circ_0002828 on the malignant phenotypes of cervical cancer

[0041] 1) In vitro experiments:

[0042] ① Use the above method to construct stable transfected cervical cancer cell lines overexpressing / silencing circ_0002828.

[0043] ② Detect the proliferation, migration and invasion abilities of cells in each group through EdU proliferation assay, colony formation assay, scratch assay and Matrigel invasion assay.

[0044] ③ Evaluate the vasculogenic mimicry formation ability of cells by the tube formation assay of cells in each group and the expression of VEGFA and VE-cadherin in cells.

[0045] ④ After co-culturing the above-mentioned cells with human umbilical vein endothelial cells for 24 h, detect the tube formation ability of the latter.

[0046] 2) In vivo experiments:

[0047] ① Subcutaneous tumor model of cervical cancer in nude mice: Inject the cells in each group subcutaneously into the back of nude mice (1x10 7 , 100 μl), and measure the tumor size weekly. After 4 weeks, sacrifice the nude mice, dissect the tumor tissues and weigh them. Then further verify the angiogenesis of tumor tissues in each group by CD31 / PAS double staining.

[0048] ② Tail vein metastasis model: Inject the cells in each group into nude mice via the tail vein (5x10 6 , 150 μl). After 5 weeks, sacrifice the nude mice, dissect the liver and lung tissues, observe the number of metastatic nodules, and verify by HE staining.

[0049] (3) Determine that circ_0002828 can bind to EIF4A3 and participate in the occurrence and development of cervical cancer

[0050] 1) Cellular localization of circ_0002828:

[0051] ① Subcellular fractionation analysis: Isolate RNA from the cytoplasm and nucleus respectively, and detect the expression of circ_0002828 in each fraction by qRT-PCR.

[0052] ② FISH: Hybridize the labeled circ_0002828 and EIF4A3 probes overnight, counterstain the cell nucleus with DAPI, and collect images by confocal microscopy to analyze the localization of the two.

[0053] 2) Verification of the binding of circ_0002828 to EIF4A3:

[0054] ①Search for the protein EIF4A3 that binds to circ_0002828 by combining the CircInteractome database and RNA pulldown experiments.

[0055] ②Verify the binding of the two by RIP experiments.

[0056] ③Verify the co - localization of the two by FISH experiments.

[0057] 3) Effects of circ_0002828 on the expression and cellular distribution of EIF4A3:

[0058] Observation objects: Stable transfected cervical cancer cell lines overexpressing / silencing circ_0002828

[0059] ①Detect the expression of EIF4A3 in each group by qRT - PCR.

[0060] ②Detect the cellular distribution of EIF4A3 in each group by immunofluorescence and nucleocytoplasmic fractionation experiments.

[0061] (4) Mechanism study of circ_0002828 regulating DLGAP5 degradation by recruiting EIF4A3

[0062] 1) Screening of downstream targets of circ_0002828 / EIF4A3:

[0063] Cell grouping: circ_0002828 silencing group, circ_0002828 overexpression group, EIF4A3 silencing group, EIF4A3 overexpression group, empty vector control group. Perform high - throughput sequencing on each group of cells, and verify the expression correlation between circ_0002828, EIF4A3 and target genes by qRT - PCR and Western Blot.

[0064] 2) Expression and clinical significance of DLGAP5 in cervical cancer:

[0065] ①Detect the expression of DLGAP5 in cervical cancer cells and tissues by qRT - PCR and Western Blot

[0066] ②Analyze the correlation between DLGAP5 and clinicopathological parameters such as FIGO stage and tumor size of cervical cancer patients.

[0067] ③Determine the expression correlation between circ_0002828 and DLGAP5 in cervical cancer samples by Person correlation analysis.

[0068] 3) Confirm that EIF4A3 can increase the stability of DLGAP5:

[0069] ①Confirm the binding of EIF4A3 to DLGAP5 by RIP experiments.

[0070] ②Observation object: Stable transfection cervical cancer cell lines with overexpressed / silenced EIF4A3

[0071] Use actinomycin D to evaluate the stability of DLGAP5 in each group of cells: Add 2 μg / ml actinomycin D to the cells, and detect the expression of DLGAP5 in each group of cells at the specified time to evaluate the half-life of DLGAP5.

[0072] Ubiquitination experiment to verify the degradation of DLGAP5 in each group of cells: Co-transfect the DLGAP5 vector and the ubiquitin vector into the cells. After 24 h, add a proteasome inhibitor, extract and separate the protein samples in each group of cells, and detect the ubiquitination situation by chemiluminescence method.

[0073] 4) Verification that circ_0002828 is involved in the occurrence and development of cervical cancer by regulating the expression of DLGAP5

[0074] ①Use actinomycin D and ubiquitination experiments to detect the stability and degradation of DLGAP5 in cervical cancer cells with overexpressed / silenced circ_0002828.

[0075] ②Rescue experiment cell grouping: Empty control group, overexpressed circ_0002828 group, overexpressed circ_0002828 + overexpressed DLGAP5 group; sh-NC group, sh-circ_0002828 group, sh-circ_0002828 + sh-DLGAP5 group.

[0076] In vitro, detect the malignant phenotypes such as proliferation, metastasis and angiogenesis of each group of cells.

[0077] In vivo, detect the tumor growth and metastasis of each group of nude mice.

[0078] 5) Screening and verification of the downstream action pathway of the circ_0002828 / EIF4A3 / DLGAP5 axis

[0079] ①Detect the expression of related pathways of tumor proliferation, metastasis and angiogenesis in each group of cells by Western Blot.

[0080] ②Add the specific agonist and inhibitor of this pathway to cervical cancer cells respectively, and detect the functional changes of the cells.

[0081] Experimental results:

[0082] (1) Screening of differentially expressed circRNAs in cervical cancer samples and determination of target circRNAs

[0083] The circRNA datasets GSE102686 and GSE113696 related to cervical cancer were selected from the Gene Expression Omnibus (GEO) database of the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov / geo / ). The GEO online tool GEO2R was used to analyze the expression differences of circRNAs in the two datasets. The differentially expressed circRNAs with |logFC| > 1 and adjusted P-value < 0.05 in the two datasets were intersected, and the circRNA with more obvious down-regulation, namely circ_0002828 (circ_100173), was obtained. The expression of circ_0002828 in tissue samples and cells was detected by qRT-PCR, and the results showed that circ_0002828 was lowly expressed in cervical cancer. The clinical analysis results showed that the low expression of circ_0002828 was closely related to the tumor size of cervical cancer patients. See Figure 1 : circ_0002828 was significantly down-regulated in cervical cancer and was negatively correlated with the tumor size of cervical cancer patients.

[0084] (2) Identification of the circular characteristics and cellular localization of circ_0002828

[0085] The base sequence of circ_0002828 was detected by Sanger sequencing, and the results showed that circ_0002828 was formed by the head-to-tail back-splicing of exons 3-5 of the AGO3 gene located on chromosome 1. The continuous amplification of the splicing site confirmed the circular structure of circ_0002828.

[0086] Compared with linear genes, circular structures usually have better stability. We detected the stability of circ_0087429 using RNase R and actinomycin D, and the results showed that circ_0002828 was structurally stable relative to the linear gene AGO3. In addition, we detected the cellular localization of circ_0002828 by subcellular fractionation analysis and fluorescence in situ hybridization respectively; the results of both experiments confirmed that it was mainly distributed in the cytoplasm. The above results provided the possibility for the post-transcriptional regulation of circ_0002828. See Figure 2 : circ_0002828 has a stable circular structure and is mainly distributed in the cytoplasm.

[0087] (3) The specific role of circ_0002828 in cervical cancer

[0088] To determine the role of circ_0002828 in cervical cancer, we constructed a stable cervical cancer cell line with overexpressed circ_0002828. The results of EdU assay and colony formation assay showed that overexpression of circ_0002828 significantly inhibited the proliferation of cervical cancer cells. The results of the subcutaneous xenograft tumor model in nude mice showed that the volume and weight of the tumors were significantly reduced after overexpression of circ_0002828, as shown in Figure 3 : circ_0002828 can inhibit the proliferation of cervical cancer.

[0089] The migration and invasion abilities of cells in each group were detected by scratch assay and Transwell invasion assay, respectively. The results showed that overexpression of circ_0002828 significantly inhibited the migration and invasion of cervical cancer cells. The results of the tail vein metastasis model experiment showed that the number of metastatic nodules in the liver and lung tissues of nude mice was significantly reduced after overexpression of circ_0002828. These results confirmed the tumor suppressive role of circ_0002828 in cervical cancer, as shown in Figure 4 : circ_0002828 can inhibit the metastasis of cervical cancer.

[0090] The malignant phenotype of tumors is often accompanied by angiogenesis. To further clarify the role of circ_0002828 in cervical cancer angiogenesis, we evaluated the effect of circ_0002828 on the formation of vascular mimicry (VM) of cervical cancer cells by tube formation assay, and further detected the expression changes of VEGFA and VE-cadherin in cells of each group. The results showed that the number of VM formations and the expressions of VE-cadherin and VEGFA were significantly reduced after overexpression of circ_0002828. Then, we co-cultured cervical cancer cells overexpressing circ_0002828 with HUVECs and detected the tube formation ability of HUVECs after co-culture in each group. The results showed that the tube formation ability of HUVECs in the circ_0002828 overexpression group was significantly reduced. Finally, we used CD31-PAS double staining to detect the VM structure in the subcutaneous tumor tissues of nude mice. The results showed that the number of VMs was significantly reduced in the tissues with overexpressed circ_0002828. The above results suggest that circ_0002828 can inhibit the angiogenesis of cervical cancer, as shown in Figure 5 : circ_0002828 can inhibit the angiogenesis of cervical cancer.

[0091] (4) Mechanism of action of circ_0002828 in cervical cancer

[0092] Studies have shown that circRNAs in the cytoplasm can play a role in the occurrence and development of cancer by binding to proteins. The results of the CircInteractome (https: / / circinteractome.nia.nih.gov / ) database showed that EIF4A3 had the most binding sites with circ_0002828. RNA pulldown experiments and RIP experiments verified the binding of circ_0002828 to EIF4A3. Next, we explored whether circ_0002828 affected the expression and cellular distribution of EIF4A3. Western Blot results showed that circ_0002828 did not affect the expression of EIF4A3. The results of IF and nucleocytoplasmic fractionation indicated that circ_0002828 did not affect the cellular distribution of EIF4A3.

[0093] Previous studies have shown that EIF4A3 can participate in the post-transcriptional regulation of RNA and thus affect the expression of downstream genes. Based on the previous results, we proposed the hypothesis that circ_0002828 regulates the expression of downstream genes by recruiting EIF4A3. Combining the UALCAN (https: / / ualcan.path.uab.edu / index.html) and TCGA databases, we found that EIF4A3 might play a role by binding to DLGAP5 in cervical cancer. Through qRT-PCR and Western Blot, we confirmed that the expression of circ_0002828 was negatively correlated with that of DLGAP5, and the expression of EIF4A3 was positively correlated with that of DLGAP5. RIP experiments confirmed the binding of EIF4A3 to DLGAP5. Next, we used actinomycin D to detect the effect of EIF4A3 on the stability of DLGAP5 mRNA. The results showed that EIF4A3 could enhance the stability of DLGAP5 mRNA. However, circ_0002828 could reduce the stability of DLGAP5 mRNA by weakening the binding of EIF4A3 to DLGAP5. The above results indicated that circ_0002828 could reduce the stability of DLGAP5 mRNA in an EIF4A3-dependent manner, thereby reducing its expression. See Figure 6 : circ_0002828 can bind to EIF4A3 (eukaryotic translation initiation factor 4A3), but does not affect its expression and cellular distribution. Figure 7 : circ_0002828 regulates the degradation of DLGAP5 (Discs large homologous affinity protein 5) by recruiting EIF4A3.

[0094] Summary:

[0095] Our study for the first time reveals the tumor-suppressive role of circ_0002828 in cervical cancer. Circ_0002828 has the functions of inhibiting the proliferation, metastasis and angiogenesis of cervical cancer in vitro and in vivo. Mechanistically, circ_0002828 can competitively bind to DLGAP5 mRNA with EIF4A3, resulting in decreased DLGAP5 expression and increased gankyrin expression, thereby activating the p53 signaling pathway and inhibiting tumorigenesis.

[0096] Circ_0002828 is expected to be a candidate molecule for developing new treatment strategies for cervical cancer. The existing treatment methods have limited efficacy in cervical cancer, and there is an urgent need for new targets and strategies to improve the prognosis of patients. Therefore, by revealing the key role of circ_0002828 in cervical cancer, the present invention proposes a brand-new treatment idea, which has important scientific significance and clinical application value.

[0097] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the method of the present invention, several improvements and supplements can be made, and these improvements and supplements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a detection agent of circ_0002828 in the preparation of a cervical cancer reagent or kit, wherein the nucleotide sequence of circ_0002828 is as shown in SEQ ID NO.

1.

2. Use of a detection agent of circ_0002828 in the preparation of a cervical cancer prognosis reagent or kit, wherein the nucleotide sequence of circ_0002828 is as shown in SEQ ID NO.

1.

3. The use according to claim 1 or 2, characterized in that: The detection agent is a quantitative detection agent.

4. The use according to claim 3, characterized in that: The quantitative detection agent includes a reagent suitable for at least one of the following methods: fluorescent dye method, digital PCR, resonance light scattering method, real-time fluorescence quantitative PCR, sequencing or biological mass spectrometry.

5. Use of circ_0002828 in the preparation of a drug for treating cervical cancer or cervical cancer metastasis, characterized in that: The nucleotide sequence of circ_0002828 is as shown in SEQ ID NO.

1.

6. Use of a promoter of circ_0002828 in the preparation of a drug for treating cervical cancer or cervical cancer metastasis, characterized in that The nucleotide sequence of circ_0002828 is as shown in SEQ ID NO.

1.

7. Use of circ_0002828 or its promoter in the preparation of experimental reagents, characterized in that: The use is selected from: (1) Inhibit the proliferation, metastasis and angiogenesis of cervical cancer cells in vitro; (2) Inhibit the migration ability of cervical cancer cells in vitro; (3) Inhibit tumor size in animal models of cervical cancer. The nucleotide sequence of circ_0002828 is as shown in SEQ ID NO.1.

Images