Molecular genetic marker YZU-GOOSE-OE-1 for goose eye opening character and application of molecular genetic marker YZU-GOOSE-OE-1

By screening nucleic acid polymorphic sites on the goose FREM1 and PTPRM genes, it was found that the molecular genetic marker YZU-GOOSE-OE-1, which was significantly associated with eye-splitting traits, solved the problems of difficulty in identifying goose genders and risk of disease transmission, and achieved high-accurate eye-splitting trait selection and rapid cultivation of self-specified male and female supporting systems.

CN120060479APending Publication Date: 2025-05-30YANGZHOU UNIV

Patent Information

Application Number
CN202411565687.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-05
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately identify the male and male gender of goose, and artificial anal repellent identification has a risk of disease transmission, which affects the healthy development of goose raising industry.

Method used

By screening nucleic acid polymorphic sites on the goose FREM1 and PTPRM genes, it was found that the molecular genetic marker YZU-GOOSE-OE-1, which is significantly associated with the eye-splitting trait, including the GG genotype and the TT genotype, was used to assist in the selection of eye-splitting traits and cultivated from the male and female matching systems.

Benefits of technology

It improves the accuracy of selecting goose eye phenotypes, reduces the size of breeding population, reduces breeding costs, shortens the cultivation time, and reduces the risk of disease transmission, and promotes the healthy development of the goose raising industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060479A_ABST
    Figure CN120060479A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular genetic marker YZU-GOOSE-OE-1 for a goose eye opening character and an application of the molecular genetic marker YZU-GOOSE-OE-1. The molecular genetic marker comprises a GG genotype and / or a TT genotype, and the molecular genetic marker of the GG genotype is a sequence located at the SNP1 site of the FREM1 gene; the molecular genetic marker of the TT genotype is a sequence located at the SNP3 site of the PTPRM gene; the login number of the FREM1 gene is NC089912, and the login number of the FREM1 gene is NC089912; and the login number of the PTPRM gene is NC089874. According to the method, the selection accuracy of the goosefoot phenotype of the goosefoot is improved, the breeding population scale is reduced and the breeding cost is reduced by utilizing the molecular genetic marker obviously associated with the goosefoot character, and on the basis, the sex-associated genetic characteristic of the goosefoot character is utilized to cultivate the goosefoot character auto-sex specialized line, so that compared with phenotype selection, the cultivation process is obviously accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a molecular genetic marker YZU-GOOSE-OE-1 for goose eye-opening trait and application thereof, belonging to the technical field of poultry breeding. Background Art

[0002] With the intensive production of goose farming in my country and the use of hybrid breeding lines, sexing individual goslings has become increasingly necessary. Currently, goose sexing still relies on manual vent rotation. Using self-sexed breeding lines for sexing is not only fast, accurate, and simple, but also harms the poultry and prevents cross-infection of pathogens. This reduces labor costs, improves sexing accuracy, and reduces indirect economic losses caused by disease transmission. Therefore, breeding goose self-sexed breeding lines for sexing has broad market application prospects. However, a quicker approach to breeding self-sexed breeding lines is to identify molecular genetic markers for sex-linked traits, especially for complex traits controlled by multiple genes. Molecular genetic markers can be used to purify relevant genes, thereby reducing the cost of breeding self-sexed breeding lines, increasing the success rate, and accelerating the breeding process. Currently, molecular genetic markers are not expensive and are expected to become increasingly affordable with technological advances. For most breeding companies, molecular genetic marker analysis is a simple and accessible technology.

[0003] The open-eyed trait is the most prominent breed characteristic of the open-eyed goose and is easily observed. Studies have shown that the open-eyed trait in geese may be controlled by a recessive gene located on a sex chromosome and a gene located on an autosome, resulting in sex-linked inheritance. Through selection, it is possible to breed a pair of male and female strains with the open-eyed trait. Indeed, Yu Jincheng et al. discovered that a nucleic acid polymorphic site on the FREM1 gene is significantly associated with the open-eyed trait, suggesting that it could serve as a molecular genetic marker for the open-eyed trait. However, further screening is needed to determine whether a more closely associated molecular marker exists. Additionally, there have been reports that the PTPRM gene is also a candidate gene for the open-eyed trait in geese, but whether PTPRM is significantly associated with the open-eyed trait in geese, and which nucleic acid polymorphic sites are significantly associated, are currently unclear. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a molecular genetic marker YZU-GOOSE-OE-1 for the goose eye-opening trait and its application.

[0005] Technical solution: In order to solve the above technical problems, the present invention provides a molecular genetic marker YZU-GOOSE-OE-1 for the open-eyed trait of geese, which includes a GG genotype and / or a TT genotype. The molecular genetic marker of the GG genotype is a base sequence located at the SNP1 site of the FREM1 gene; the molecular genetic marker of the TT genotype is a base sequence located at the SNP3 site of the PTPRM gene; the accession number of the FREM1 gene is NC_089912; the accession number of the PTPRM gene is NC_089874.

[0006] The present invention also provides a detection kit containing the molecular genetic marker YZU-GOOSE-OE-1.

[0007] The present invention also provides application of the molecular genetic marker and the detection kit in determining the genotype of the eye-opening trait of geese.

[0008] The present invention also provides application of the molecular genetic marker or the detection kit in selecting goose eye-loosening individuals.

[0009] Among them, the application of GG genotype and TT genotype in the selection of goose eye-opening individuals is included.

[0010] This includes the application of GG genotype or TT genotype in the selection of goose eye-opening individuals.

[0011] The present invention also provides application of the molecular genetic marker or the detection kit in establishing a self-sexed matching system of goose fangyan.

[0012] The present invention targets the FREM1 and PTPRM genes of geese, screens nucleic acid polymorphic sites, and analyzes the degree of association between the nucleic acid polymorphic sites and the open-eyed trait of goslings, thereby finding the molecular genetic markers most closely associated with the open-eyed trait of goslings, which are then applied to marker-assisted selection of the open-eyed trait and accelerate the cultivation of goose open-eyed self-differentiated male and female matching lines.

[0013] The results showed that a nucleic acid polymorphism site (SNP1) was screened in the upstream regulatory region of the FREM1 gene, which was more significantly associated with the molecular marker discovered by Yu Jincheng et al. In the test population of this study, the correlation between the molecular marker (SNP2) discovered by Yu Jincheng et al. and the eye-opening trait reached a significance level of P = 0.02, while the significance level of SNP1 was P = 1.3×10 -4. In addition, the present invention has also screened a molecular marker (SNP3) closely associated with the open-eyed trait of geese in the exon region of the PTPRM gene. The use of this marker can further improve the accuracy of distinguishing the open-eyed trait. Therefore, SNP1 and SNP3 can be used as molecular markers for auxiliary selection of the open-eyed trait of geese. The present invention will promote the cultivation of self-differentiated male and female matching lines of geese with open eyes, and will greatly save breeding costs and shorten breeding time by improving selection accuracy and reducing the size of the breeding population.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0015] 1) The present invention utilizes molecular genetic markers significantly associated with the open-eye trait to improve the accuracy of selection for the open-eye phenotype in geese, thereby reducing the size of the breeding population and lowering breeding costs. Furthermore, the present invention utilizes the sex-linked inheritance characteristics of the open-eye trait to breed self-sexed, male-female, and female-matched lines for the open-eye trait. This significantly accelerates the breeding process compared to phenotypic selection.

[0016] 2) The self-sexing goslings bred using the present invention will help reduce the cost of sex identification of goslings, reduce the risk of disease transmission caused by artificial sex determination by anal rotation, and be beneficial to the healthy development of the goose farming industry, creating certain social and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the electrophoresis diagram of PCR products of 21 Huoyan goose DNA samples at SNP1 site of FREM1 gene;

[0018] Figure 2 The sequencing peaks corresponding to different genotypes of SNP1 in the FREM1 gene are shown: Figure A represents the GG genotype, Figure B represents the AA genotype, and Figure C represents the GA genotype;

[0019] Figure 3 This is an example of partial sequencing results for different individuals with SNP1 in the FREM1 gene;

[0020] Figure 4 This is the electrophoresis diagram of PCR products of 23 Huoyan goose DNA samples at SNP2 site of FREM1 gene;

[0021] Figure 5 The sequencing peaks corresponding to different genotypes of FREM1 gene SNP2: Figure A represents the CC genotype, Figure B represents the TT genotype, and Figure C represents the CT genotype;

[0022] Figure 6 This is an example of partial sequencing results for different individuals at the SNP2 site of the FREM1 gene;

[0023] Figure 7This is the electrophoresis diagram of PCR products of 19 Huoyan goose DNA samples at SNP3 site of PTPRM gene;

[0024] Figure 8 The sequencing peaks corresponding to different genotypes of SNP3 of the PTPRM gene: Figure A represents the CC genotype, Figure B represents the TT genotype, and Figure C represents the CT genotype;

[0025] Figure 9 Examples of partial sequencing results for SNP3 of the PTPRM gene in different individuals. DETAILED DESCRIPTION

[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0027] The present invention is specifically described with a batch of 90 open-eyed geese as an example:

[0028] 1) Selection of open-eyed geese and non-open-eyed individuals to be tested: 90 individuals that met the requirements in appearance were selected from a group of geese (derived from the National Waterfowl Gene Bank in Taizhou City, Jiangsu Province).

[0029] 2) Blood collection and DNA extraction: 0.1 mL of blood was drawn from the wing vein of the test individual, and DNA template was extracted using a DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP348).

[0030] 3) Polymerase chain reaction and product detection: The extracted DNA was used as a template in PCR, and PCR amplification was performed using primers for SNP1, SNP2, and SNP3 in Table 1 according to the operating instructions of 2× RapidTaq Master Mix (Novozymes Biotechnology Co., Ltd., P222-01). The primers were synthesized by Genwi (Suzhou) Biotechnology Co., Ltd.

[0031] Table 1 PCR amplification primers

[0032]

[0033]

[0034] Take 5 μL of the product and perform electrophoresis on 1% agarose gel. If a single band is present (see Figure 1 ) (For reference sequences, see SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 in the appendix. The underlined sequences are the upstream and downstream primer sequences. For the electrophoresis diagram, see the appendix. Figure 1 、 4 , 7, band size refers to the 750bp position of the marker band), then send the PCR product to a sequencing company for testing. Among them, SEQ ID NO.1:

[0035] CTGCTGCAAAGAGGAAGGTG CTAAAAGTTAGCAAGAGATGGGTTCAGAATTGACAGGAATGAGACTCCAGAGGATTATATTGGTGATGCATACGGAGATCAGGAATGAGAAAACTTGAGCTGAATATGGTAATATGGAAGAGACAGAACATCATTTTGAGTTAAGATATTATTTAAAACAAACGAACAAACAAACAAACAAAAACACTTCAATGAGACCTTTCCACTCTTTTGCTAGAAACACAGTGACTTTCTGTTACTGGTGCTACCTGTTTGGCCCGCTCAAACTAAAACTCTGGAAAAAGCATCTAAAATGTGTTTTGGCTGAAGCTTTTGGTTTATACATGGATTAAAAAACCACTATAGTGTCTTTGATCCATTTGATATGATTGCCTTCTCTATATTTAATAGTGGGTTTCAGTCAAAATTTATGAATCCTAGGGGGATAAAGCCCGATCCTCAAGGGTAAAATCTCTAATGCCATTGTCACAGCTCTGACTGGATTTAGTGGAGAGGGGCTCTCACCCAAAAACCTCACCAGAACAGAAGGTCTGCATTTTTGTAGCTTGCCTATATCCCTGTCTATAACATATCCTGTTAAGTGTGTAAGCTGTCGTCTACATAACCCAGGCCAGCCTTGGAAATAAAGGCACCATATTAGAAACATGAAAATTAGCATTTTCACTCAGATGGACAATGTCTCTTGTCTGGCCTTGTCAGTGGACCACATAGTGCTGGAGAACGAAGTGGGAGGCAGGTGCGATAAGTGAGGGGGATTTTCTGGCCAGCCCTAGTTCATGTTAAGTACTGAAGTCAGCATTTAGTTTACATTGAACGCTAAGGCATGGTTAAAAACTTGCCCTTAAACTTTAGATGAGGCTTGGCTGTGCGTGGGCCGCAAGGGCCTAAGTGCTGGAAGGGCCAGGTAACTGCCTGTAAC TCCCTGTAAACTGCCACTGT

[0036] SEQ ID NO.2:

[0037] GCAGTATCACCACAGGCAAG TCCTGTAGTAAAGGTGTGTGTTATCATTTCATTTCAGTAGATGGTGAATCAAGACACATGTTGAAGACTACCTTGCCTCTTTTTGCCA GATTCATCATCAGCAATGGACTGAGGACTAAGCATGGGACATTCATGATCTCCTTGGAGGCAGTCGACCAAGTTTTGCCGACACTATCTAGGAACACGGGGTTAAGATTAGTGGAAGGTGCTATGGTACTCCTTTCTCCTGATGTCCTGCAGCTTTCAGATCCAGACACAGCTAATGAAGACCTTACCTTCCTCTTGGCTCAGCTCCCCCAATATGGTCATCTCTATTATCGAGGGGCTGTGCTACTACAGTACAATTTCACCCAGAGAGATGTGGACAACATGGATGTTGCATACAAGCACCGAGGTGGGGATTCCCAGATTGACAGATTTACATTTGTTGCAACAGATAGGACTAATCAAGGCTTCATCGTGAATGGGAGGGTGCAGATCGAGCCAGTGGCATTCACCATTCAGGCAAGTGTGACCACAGGCCTACTTAAAAGAGATATATAGCATGATAAGGTGGGAAATGCACTGATTTTGACTAAGCTTAGAATTCCTACTTGCTGCAACCTATTATTTAACAGAGATATTTATAAGCTAAAAGGCTTGCTTTCTGTGTTCTAAGTAATTACAACAATACATTACTCAGAGAAATATATATACATATCTATAGATAGATAGATAGATATAGGAAAGAAAGAGATTAAGAGATACACAGAATTTGTGTTGCTCTCCCAAGCATGTGCTGTATCTCACTGCATGACGCAAGCAATT GTGCAAACA GAGCCTGGAAA

[0038] SEQ ID NO.3:

[0039] CGCAGCTTAGTACCAAATGCCTAATCTAAAACTCATTTA1TGATCAGCTAGCATTATTTAAAGCAATATTATAGTTTGGACTGCTCTGCAATGCTTCCAT1TGTAGAATCATGGAATTTGCCTTCATTCCAATCAGTCTTGCAATTTCCCTGTGTAAACTGCTCCATGGATTTACTGTTCTTCTGGCATATAGCCTT CACAGACAGAAGCAATGTTGATGGTGTCAGATTTCTGCCATTCCTCTAGAAATCTGTGTAATTTGTATTTTTGTTAATAAGTGAAAATGAGCCAGTACATTATGAGATACTCTTTTCCTAGATGAAACCCATACGATGGTCAGTGACACAAGCAGCCTGGTTCAATCCCATACCTAC AAGAAGCGAGATCCTGTGGATGTTCCTTACCAGACCGGACAGCTTCATCCAGCCATCCGTGTAGCTGACTTGCTACAGCACATCACCCAAATGAAGTGTGCAGAAGGCTATGGATTTAAAGAGGAGTATGAAGTAAGTGTCAGGTCTAATGATCTGATTATTATGTCTTCTGCACTG TCGGCTTTATCTGTCTGGTACCTGTACCACTGAACAGGTGAGAAATGATTACTCAACCCAGAACAGGAGAACAGGAGAAATAATTACTCAATCCAGTAAGCCAGCTGCCGTGTGAGGGAAGATATTGAATGGAAAGAATCACGTCTACAGTGAGCAAAGTTTCTGGTAGAAACAAGG CAGGGTGAGGAGTGAGAAGT

[0040] For the SEQ ID NO.2 sequence, the accession number of the FREM1 gene reference sequence in GenBank is NC_089912; for the SEQ ID NO.1 sequence, the reference sequence in GenBank is the 1000bp sequence upstream of the FREM1 gene (accession number NC_089912); for the SEQ ID NO.3 sequence, the accession number of the PTPRM gene reference sequence in GenBank is NC_089874. Figure 1 The band in the middle (959 bp in size) is the electrophoresis pattern of PCR products of 21 Homo sapiens DNA samples at the SNP1 site of the FREM1 gene; Figure 4The band in the middle (847 bp in size) is the electrophoresis pattern of PCR products of 23 samples of DNA from Huoyan geese at the SNP2 site of the FREM1 gene; Figure 7 The band in the figure (747 bp in size) is the electrophoresis diagram of the PCR products of the SNP3 site of the PTPRM gene of 19 geese.

[0041] 4) Sequencing and determining mutation type: Send the PCR product and primers (primers are the same as those in Table 1) to a sequencing company for sequencing, and determine the mutation type based on the sequencing results (see Figure 2 、 3 , 5, 6, 8, 9). Figure 2 Among the sequencing chromatograms shown, Figure A is the chromatogram of the homozygous wild-type allele at the SNP1 site of the FREM1 gene, and the flanking sequence of the wild-type allele G is ATCCT(G)GGGGG; Figure B is the chromatogram of the homozygous mutant allele at the SNP1 site of the FREM1 gene, and the flanking sequence of the mutant allele A is ATCCT(A)GGGGG; Figure C is the chromatogram of the heterozygous allele AG at the SNP1 site of the FREM1 gene, and its flanking sequence is ATCCT(R)GGGGG, where R represents the AG genotype; the SNP1 site is located in the 1000bp sequence upstream of the FREM1 gene in GenBank. Figure 3 Shows the sequencing results of SNP1 and its adjacent regions for individuals with different genotypes. Figure 3 In the figure, the blue base sequences A and R respectively indicate that the individual's genotype at the SNP1 site is AA homozygote and A / G heterozygote. Figure 5 Among the sequencing chromatograms shown, Figure A is the chromatogram of the homozygous wild-type allele at the SNP2 site of the FREM1 gene, and the flanking sequence of the wild-type allele C is CCAAG(C)TTTGC; Figure B is the chromatogram of the homozygous mutant allele at the SNP2 site of the FREM1 gene, and the flanking sequence of the mutant allele T is CCAAG(T)TTTGC; Figure C is the chromatogram of the heterozygous CT allele at the SNP2 site of the FREM1 gene, and its flanking sequence is CCAA(Y)CTTTGC, where Y represents the CT genotype; the SNP2 site is located at position c.4514 of the FREM1 gene in GenBank. Figure 6 Shows the sequencing results of different genotype individuals at SNP2 and its adjacent regions. Figure 6 In the figure, the blue base sequences T and Y indicate that the individual's genotype at SNP2 is TT homozygous and CT heterozygous, respectively. Figure 8Among the sequencing chromatograms shown, Figure A is the chromatogram of the homozygous wild-type allele at the SNP3 site of the PTPRM gene, and the flanking sequence of the wild-type allele C is AGCAG(C)CTGGT; Figure B is the chromatogram of the homozygous mutant allele at the SNP3 site of the PTPRM gene, and the flanking sequence of the mutant allele T is AGCAG(T)CTGGT; Figure C is the chromatogram of the heterozygous CT allele at the SNP3 site of the PTPRM gene, and its flanking sequence is AGCAG(Y)CTGGT, where Y represents the CT genotype; the SNP3 site is located at position c.2625 of the PTPRM gene in GenBank. Figure 9 Shows the sequencing results of SNP3 and its adjacent regions for individuals with different genotypes. Figure 9 In the figure, the blue base sequences T and Y respectively indicate that the individual's genotype at the SNP3 site is TT homozygous and CT heterozygous.

[0042] 5) Significance analysis: In order to analyze the degree of association between molecular markers and the open-eye trait, a chi-square test was performed on the association between the mutation types of this batch of open-eye geese and the open-eye trait (see Table 2 for details).

[0043] Table 2 Association between genotypes and alleles of marker gene polymorphisms and eye-opening traits

[0044]

[0045] The results showed that the SNP1 site of the FREM1 gene was significantly associated with the open-eyed trait (P=0.000131); the SNP2 site of the FREM1 gene was also significantly associated with the open-eyed trait (P=0.022), but the significance level of SNP1 was higher than that of SNP2; the SNP3 site of the PTPRM gene was significantly associated with the open-eyed trait at the allele level (P=0.039). Note: This step can be skipped in actual application of this invention. According to the breeding goal of the open-eyed trait, the corresponding genotype is selected. Among all individuals with the GG genotype at the SNP1 site of the FREM1 gene, 85% have open-eyed, and among all individuals with the TT genotype at the SNP3 site of the PTPRM gene, 88.2% have open-eyed. Individuals with the GG genotype of FREM1 at the SNP1 site and the TT genotype of PTPRM at the SNP3 site are selected for breeding.

[0046] 6) Analysis of Discrimination Accuracy: Using the above method, genomic DNA was extracted from blood samples from three batches of newborn geese and analyzed by PCR and sequencing. Without considering heterozygous genotypes, the open-eye phenotype of geese was identified based on the GG genotype at SNP1 of the FREM1 gene and the TT genotype at SNP3 of the PTPRM gene. The accuracy of molecular markers for identifying open-eye phenotypes was analyzed using conventional visual phenotyping methods (see Table 3 for details).

[0047] Table 3 Analysis of the accuracy of molecular markers for identifying open-eyes

[0048]

[0049] The results showed that the accuracy rate of determining the open-eye trait in individuals with the GG genotype at the FREM1 gene SNP1 site was 83.9%, the accuracy rate of determining the open-eye trait in individuals with the TT genotype at the PTPRM gene SNP3 site was 86.7%, and the accuracy rate of determining the open-eye trait in individuals with the GG genotype at the FREM1 gene SNP1 site and the TT genotype at the PTPRM gene SNP3 site was 100%. In practical applications of the present invention, this step can be skipped.

Claims

1. A molecular genetic marker for the oval eye trait of goose, YZU-GOOSE-OE-1, characterized in that: The molecular genetic marker includes a GG genotype and / or a TT genotype, wherein the molecular genetic marker of the GG genotype is a base sequence located at the SNP1 site of the FREM1 gene; the molecular genetic marker of the TT genotype is a base sequence located at the SNP3 site of the PTPRM gene; the accession number of the FREM1 gene is NC_089912; and the accession number of the PTPRM gene is NC_089874.

2. A detection kit, characterized in that: It contains the molecular genetic marker YZU-GOOSE-OE-1 described in claim 1.

3. Application of the molecular genetic markers described in claim 1 and the detection kit described in claim 2 in determining the genotype of the eye-opening trait in geese.

4. Use of the molecular genetic marker described in claim 1 or the detection kit described in claim 2 in selecting goose eye-loosening individuals.

5. The application according to claim 4, characterized in that: Including the application of GG genotype and TT genotype in the selection of goose eye-opening individuals.

6. The use according to claim 4, characterized in that: Including the application of GG genotype or TT genotype in the selection of goose eye-opening individuals.

7. Use of the molecular genetic markers according to claim 1 or the detection kit according to claim 2 in establishing a self-sexed matching system of geese.

Citation Information

Patent Citations

  • Automatic-sexing breeding method for specialized strains of Huoyan male and female meat geese

    CN109197779A

  • SNP (Single Nucleotide Polymorphism) site combination for identifying Huoyan goose variety and identification method thereof

    CN117587141A

Cited By

  • Structural variation molecular marker related to goose open eye character and application of structural variation molecular marker in breeding of Wulong goose auto-sexing commercial line

    CN120888665A