Molecular marker for identifying duck feed utilization rate character based on SIRT4 gene and identification method and application thereof

Abstract

The invention relates to a molecular marker for identifying the duck feed utilization rate character based on an SIRT4 gene and an identification method and application thereof, and belongs to the technical field of molecular markers, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, and the 601st basic group of the nucleotide sequence is C or T. The invention also relates to a method for identifying the duck feed utilization rate character based on the SIRT4 gene. The molecular marker is developed on the basis of research on the relationship between the SIRT4 gene and the duck feed utilization rate character, the duck feed utilization rate character can be selected by identifying the type of the molecular marker in a duck genome, and a breeding method for early selection of the poultry feed utilization rate is established. The invention provides a novel molecular marker-assisted breeding method for detecting the growth traits of ducks, and the method is simple, rapid and low in cost, does not need special instruments, and is suitable for the needs of molecular marker-assisted breeding experiments.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker for identifying the feed utilization rate trait of ducks based on the SIRT4 gene, and an identification method and application thereof. Background Art

[0002] Residual Feed Intake (RFI) is defined as the difference between the actual feed intake and the expected feed intake of an animal given its body weight and weight gain. Therefore, the larger the value of RFI, the lower the relative feed efficiency. In recent years, more and more breeders have begun to use RFI as the main indicator for measuring feed efficiency, and with the development of the times, this trend has become more and more obvious. This is because using RFI for breeding can not only take into account daily weight gain and metabolic body weight, but also has a relatively weak impact on important economic traits such as market weight. Moreover, the heritability of RFI is between 0.2 and 0.4 (Chen C, Su Z, Li Y, et al. Estimation of the genetic parameters of traits relevant to feed efficiency: result from broiler lines divergent for high or low abdominal fat content [J]. Poult Sci, 2021, 100(2): 461 - 466; Zhang Y, Guo Z B, Xie M, et al. Genetic parameters for residual feed intake in a random population of Pekin duck [J]. Asian - Australas J Anim Sci, 2017, 30(2): 167 - 170.), which belongs to a medium heritability trait. Therefore, RFI can be used as an indicator for measuring feed efficiency in breeding.

[0003] SIRT4 is a member of the sirtuin family and a key factor in adipogenesis, regulating the proliferation and differentiation of preadipocytes (HO L, TITUS A S, BANERJEE K K, et al. SIRT4 regulates ATP homeostasis and mediates a retrograde signaling via AMPK[J]. Aging(Albany NY), 2013, 5(11):835-49; LAURENT G, DE BOER V C, FINLEY L W, et al. SIRT4 represses peroxisome proliferator-activated receptor α activity to suppress hepatic fat oxidation[J]. Mol Cell Biol, 2013, 33(22):4552-61.). Recent studies have found that SIRT4 is a key regulator of lipid homeostasis, inhibiting fatty acid oxidation and promoting lipid anabolism, indicating that SIRT4 can regulate the balance between fat oxidation and synthesis.Overexpression of SIRT4 can increase lipogenesis and reduce fatty acid oxidation, while knockdown of SIRT4 has the opposite effects on lipid synthesis and catabolism in mouse adipocytes and myocyte cell lines (LI Y, ZHOU Y, WANG F, et al. SIRT4 is the last puzzle of mitochondrial sirtuins [J]. Bioorg Med Chem, 2018, 26(14): 3861-5; PARIK S, TEWARY S, AYYUB C, et al. Loss of mitochondrial SIRT4 shortens lifespan and leads to a decline in physical activity [J]. J Biosci, 2018, 43(2): 243-7.), so SIRT4 coordinates lipid homeostasis by promoting lipid anabolism and inhibiting lipid catabolism (DOLINSKY V W. The role of sirtuins in mitochondrial function and doxorubicin-induced cardiac dysfunction [J]. Biol Chem, 2017, 398(9): 955-74; HERSHBERGER K A, MARTIN A S, HIRSCHEY M D. Role of NAD(+) and mitochondrial sirtuins in cardiac and renal diseases [J]. Nat Rev Nephrol, 2017, 13(4): 213-25.).In the study, it was found that the mRNA expression of SIRT4 was relatively high in subcutaneous fat of cattle; the expression of SIRT4 increased before the 7th day of differentiation and then decreased with the differentiation of bovine adipocytes; in addition, SIRT4 knockdown significantly inhibited the expression of marker genes that promote the differentiation of bovine adipocytes. These results indicate that SIRT4 may play an important role in regulating the development of bovine adipose tissue (AHUJA N, SCHWER B, CAROBBIO S, et al. Regulation of insulin secretion by SIRT4, a mitochondrial ADP-ribosyltransferase[J]. J Biol Chem, 2007, 282(46):33583-92; HAIGIS M C, MOSTOSLAVSKY R, HAIGIS K M, et al. SIRT4 inhibits glutamate dehydrogenase and opposes the effects of calorie restriction in pancreatic beta cells[J]. Cell, 2006, 126(5):941-54.).

[0004] Based on the above existing findings, it can be inferred that the SIRT4 gene may be an important candidate gene for regulating duck feed efficiency. However, current research on the SIRT4 gene mainly focuses on mice, fish, and humans. In the field of poultry, especially for ducks, the research is still insufficient, and most of the existing research content focuses on the metabolic regulation of fatty acids and the deposition mechanism of lipids in the body. Therefore, it is particularly important to deeply explore the specific effects of the variation of the SIRT4 gene and its expression pattern on the feed conversion rate of meat ducks and to reveal the underlying molecular mechanism. This not only helps us to more comprehensively understand the key role of the SIRT4 gene in the growth and development and feed utilization of meat ducks, but also provides a strong theoretical basis for improving the feed efficiency of meat ducks, helps to reduce the breeding cost of meat ducks, and promotes the sustainable development of the poultry industry. Based on the above content, the present invention proposes a molecular marker for identifying the feed utilization trait of ducks based on the SIRT4 gene, as well as an identification method and application thereof. Summary of the Invention

[0005] The object of the present invention is to provide a molecular marker for identifying the feed utilization trait of ducks based on the SIRT4 gene, as well as an identification method and application thereof in order to solve the above problems.

[0006] The present invention achieves the above object through the following technical solutions:

[0007] The present invention provides a molecular marker for identifying the feed utilization trait of ducks based on the SIRT4 gene. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein the 601st base of the nucleotide sequence is C or T.

[0008] The present invention also provides an application of the molecular marker in identifying the feed utilization trait of ducks.

[0009] As a further optimized scheme of the present invention, if the molecular marker type of the duck to be tested is TT type, the feed utilization trait of this duck is the best; if the molecular marker type of the duck to be tested is CT type, the feed utilization trait of this duck is medium; if the molecular marker type of the duck to be tested is CC type, the feed utilization trait of this duck is poor.

[0010] The present invention also provides a method for identifying the feed utilization trait of ducks using the above molecular marker, which includes the following steps:

[0011] (1) Extract the total DNA of the medial metatarsal vein blood of the duck to be tested;

[0012] (2) Design specific amplification primers with the nucleotide sequence of the molecular marker as the target sequence, use the total DNA as the template, and perform PCR amplification with the specific amplification primers to obtain an amplification product;

[0013] (3) Sequence and perform genotyping detection on the amplification product to obtain the molecular marker type of the duck to be tested;

[0014] (4) Judge the feed utilization trait of the duck according to the molecular marker type.

[0015] As a further optimized scheme of the present invention, the sequences of the specific amplification primers are:

[0016] SEQ ID NO.2: Forward primer: TACCTGCCCTGTGTTCTGTT;

[0017] SEQ ID NO.3: Reverse primer: ACCCTGACTGAGACACGAGA.

[0018] As a further optimized scheme of the present invention, the method for genotyping detection is to obtain a digested product by digesting the amplification product with an enzyme, detect the digested product by agarose gel electrophoresis, and perform genotyping according to the image. If the digested product: contains 1 band, it is TT type; contains 2 bands, it is CC type; contains 3 bands, it is CT type.

[0019] As a further optimized scheme of the present invention, the amplification product is digested with PspⅩⅠ restriction endonuclease.

[0020] The beneficial effects of the present invention are as follows:

[0021] Based on the research on the relationship between the SIRT4 gene and the feed utilization rate trait of ducks, the present invention has developed molecular markers. By identifying the types of these molecular markers present in the duck genome, the feed utilization rate trait of ducks can be selected, and a breeding method for early selection of poultry feed utilization rate has been established, providing a new molecular marker-assisted breeding method for detecting the growth traits of ducks. This method is simple, fast, low-cost, does not require special instruments, and meets the needs of molecular marker-assisted breeding experiments. Description of the Drawings

[0022] Figure 1 It is the agarose gel electrophoresis pattern of the PCR amplification products of some samples;

[0023] Figure 2 It is the agarose gel electrophoresis pattern of the digestion products obtained by digesting the PCR amplification products of some samples;

[0024] Figure 3 It is the genotype verification sequencing result of the C7966571T locus (the 601st locus in SEQ ID NO.1) in the duck SIRT4 gene. Detailed Embodiments

[0025] The following further describes the present application in detail. It is necessary to point out here that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0026] 1. Materials

[0027] The methods used in this embodiment are all conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are all commercially available products unless otherwise specified.

[0028] 2. Methods

[0029] 2.1 Primer Design

[0030] The DNA sequence corresponding to the SIRT4 gene (Gene ID: NC_051787.1) shown in SEQ ID NO.1 was found from the duck genome database, and specific amplification primers were designed using the DNA partial sequence of the SIRT4 gene (the sequence composed of the locus where the molecular marker is located and the upstream and downstream bases) as a template. The sequences of the specific amplification primers are as follows:

[0031] SEQ ID NO.2: Forward primer: TACCTGCCCTGTGTTCTGTT;

[0032] SEQ ID NO.3: Reverse primer: ACCCTGACTGAGACACGAGA。

[0033] The length of the amplifiable region of this primer is 590 bp, and the amplified sequence is as shown in SEQ ID NO.4, which contains a molecular marker of the C7966571T site (the 601st site in SEQ ID NO.1) C / T mutation.

[0034] 2.2 Extraction of total blood DNA

[0035] Select 475 Qiangying ducks, collect blood from the medial metatarsal vein, extract total blood DNA, and use the blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. to extract the total DNA in the blood sample of the medial metatarsal vein of ducks. The extraction steps can be carried out according to the kit instructions.

[0036] 2.3 PCR amplification

[0037] Use the Mix produced by Shanghai Yisheng Biotech Co., Ltd. to perform a PCR amplification reaction on the target fragment of the SIRT4 gene through the synthesized sequencing-specific primers. The PCR amplification system is shown in Table 1:

[0038] Table 1 PCR amplification system

[0039] Component Dosage DNA template 1 μL Forward primer 1 μL Reveres primer 1 μL Mix 10 μL <![CDATA[ddH 2 O]]> 7 μL Total 20 μL

[0040] The PCR reaction conditions are as follows: pre-denaturation at 95°C for 5 min; the first step, denaturation at 95°C for 45 s; the second step, annealing at 64.8°C for 45 s (the annealing temperature is set according to the primer); the third step, extension at 72°C for 30 s. Among them, the second step to the third step are cycled 31 times, for a total of 32 cycles; extension at 72°C for 10 min.

[0041] 2.4 Detection and sequencing of PCR amplification products

[0042] Use 2% (mass ratio) agarose gel electrophoresis to detect the PCR amplification products. As Figure 1 shown, after imaging with a gel imager, a band with a length approximately 590 bp is obtained, which is consistent with the predicted length, indicating that the target fragment has been obtained. Send the PCR product to Beijing Qingke Biotech Co., Ltd. (Nanjing). The sequence is as shown in SEQ ID NO.4, which is consistent with the predicted result.

[0043] 2.5 Genotyping

[0044] 2.5.1 Prepare the enzyme digestion system as shown in Table 2. The enzyme digestion condition is a water bath at 37°C for 1 hour. Use the PspⅩⅠ restriction endonuclease from Beijing BioLabo Technology Co., Ltd. to digest the PCR amplification products;

[0045] Table 2 Restriction Enzyme Digestion System

[0046] Component Dosage PCR amplification product 0.4 μL PspⅩⅠ 0.4 μL (5 U / μL) buffer 2 μL <![CDATA[ddH 2 O]]> 7.2 μL Total 10 μL

[0047] 2.5.2 Detection was carried out by 1.5% mass ratio low-voltage agarose gel electrophoresis, and the results (partial results) as shown in Figure 2 were obtained; among them, if the restriction enzyme digestion product contains 1 band, it is the TT type; if it contains 2 bands, it is the CC type; if it contains 3 bands, it is the CT type.

[0048] 2.6 Verification by Restriction Enzyme Digestion and Sequencing

[0049] The agarose gel electrophoresis patterns of gene restriction enzyme digestion typing were statistically analyzed to obtain three types: TT, CT, and CC. One individual was selected from each of these three types for sequencing comparison. The sequencing comparison diagram is as shown in Figure 3 . In the sequencing results, C mutated to T, and the mutation position was marked by an arrow, which was consistent with the restriction enzyme digestion typing results.

[0050] 2.7 Effect Verification

[0051] To determine the association between the C / T polymorphism at the C7966571T locus of the duck SIRT4 gene and important phenotypic traits of ducks, 475 Qiangying ducks in 2.2 were used as experimental materials, and the feed intake (ADFI), average daily gain (ADG), metabolic body weight gain (MBW 0.75 ), feed conversion ratio (FCR), and residual feed intake (RFI) from 21 to 42 days of age were statistically analyzed. Using the 2.5 gene typing method, 475 Qiangying ducks were genotyped, and the results are shown in Table 3:

[0052] Table 3 Genotype Detection Results of Individuals with Different Phenotypes

[0053]

[0054] Experimental conclusion: The chi-square test results showed that the genotype of the experimental duck population was in Hardy-Weinberg equilibrium (P>0.05).

[0055] 2.8 Statistical Analysis

[0056] The least squares analysis method in SAS9.4 software was used to analyze the association between the three genotypes and the duck feed utilization traits. The results of the association analysis between different genotypes and each trait are shown in Table 4:

[0057] Table 4 Association Analysis of Duck SIRT4 Genotypes and Duck Feed Utilization Traits

[0058]

[0059] Note: Different lowercase letters in the same row indicate significant differences (P < 0.05), and different capital letters in the same row indicate extremely significant differences (P < 0.01).

[0060] Experimental conclusion: As can be seen from Table 4, for the C7966571T locus of the SIRT4 gene, the feed conversion ratio (FCR) of CC genotype individuals is significantly higher than that of TT genotype individuals, and the feed conversion ratio (FCR), average daily feed intake (ADFI), and residual feed intake (RFI) of CC genotype individuals are extremely significantly higher than those of TT genotype individuals. There are no significant differences in average daily gain (ADG) and metabolic body weight gain (MBW0.75) among the three genotypes. It can be concluded that TT genotype individuals have the best feed utilization traits, CT genotype individuals have medium feed utilization traits, and CC genotype individuals have poor feed utilization traits, that is, TT type is the favorable genotype.

[0061] The above embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation to the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A molecular marker for identifying duck feed utilization traits based on SIRT4 gene, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the 601st base of the nucleotide sequence is C or T.

2. Use of the molecular marker as claimed in claim 1 in identifying the feed utilization trait of ducks.

3. The use according to claim 2, characterized in that: If the molecular marker type of the duck to be tested is TT type, the duck has the best feed utilization trait; if the molecular marker type of the duck to be tested is CT type, the duck has a medium feed utilization trait; if the molecular marker type of the duck to be tested is CC type, the duck has a poor feed utilization trait.

4. A method for identifying the trait of feed utilization rate of ducks using the molecular marker according to claim 1, characterized in that: The following steps are involved: (1) Extracting total DNA from the medial metatarsal vein blood of the duck to be tested; (2) designing specific amplification primers using the nucleotide sequence of the molecular marker as the target sequence, using the total DNA as a template, and performing PCR amplification using the specific amplification primers to obtain an amplified product; (3) sequencing and genotyping the amplified products to obtain the molecular marker type of the duck to be tested; (4) Determine the feed utilization traits of ducks based on the molecular marker type.

5. The method for identifying duck feed utilization traits using molecular markers according to claim 4, characterized in that: The sequence of the specific amplification primer is: SEQ ID NO.2: Forward primer: TACCTGCCCTGTGTTTCTGTT; SEQ ID NO.3: Reverse primer:ACCCTGACTGAGACACGAGA.

6. The method for identifying duck feed utilization traits using molecular markers according to claim 4, characterized in that: The method of genotyping detection is to obtain a digestion product by digesting the amplified product, detect the digestion product by agarose gel electrophoresis, and perform genotyping according to the image. If the digestion product: If it contains 1 band, it is TT type; If it contains 2 bands, it is CC type; If it contains 3 bands, it is CT type.

7. The method for identifying duck feed utilization traits using molecular markers according to claim 6, characterized in that: The amplified product was digested with PspⅩⅠ restriction endonuclease.

Images