Application of trnP gene in identification of single female line of bemisia tabaci of C-and C + lines, primer pair and identification method
By designing specific primers to differential bases targeting the whitefly trnP gene, combined with PCR amplification and restriction enzyme digestion, the rapid and accurate identification of whitefly C- and C+ lines was achieved, and the problems of complex operation, high cost and insufficient results stability in the prior art were solved.
Patent Information
- Application Number
- CN202510264545.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-03-07
AI Technical Summary
The prior art has defects such as complex operation, high cost, insufficient results stability, and insufficient specificity when identifying whitefly C- and C+ strains, making it difficult to achieve rapid, accurate and intuitive identification.
The differential bases of the trnP gene were used to design specific primer pairs, and PCR amplification and restriction enzyme digestion were combined with agarose gel electrophoresis detection to identify the C- and C+ lines of tobacco.
The rapid, accurate and intuitive identification of different strains of whitefly is achieved, reducing operational complexity and cost, and improving the stability and specificity of the results.
Smart Images

Figure CN120060489A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of agricultural biological detection, and specifically relates to the application of the trnP gene in identifying single female lines of Bemisia tabaci C- and C+ strains, primer pairs, and identification methods. Background Art
[0002] Bemisia tabaci is a global agricultural pest, and there are significant differences in biological characteristics, host adaptability, and drug resistance between its C- and C+ strains. Accurately identifying these two strains is of great significance for the prevention and control of Bemisia tabaci, drug resistance management, and ecological research. However, traditional morphological methods are difficult to distinguish between C- and C+ strains, so molecular biology and genetics techniques need to be used for accurate identification.
[0003] Currently, the methods for identifying Bemisia tabaci C- and C+ strains mainly include PCR, AFLP, DNA sequencing, SDS-PAGE, Western Blot, etc. Among them, although the PCR method is simple to operate and low in cost, it depends on the design of specific primers and may have false positive or false negative results; AFLP has high resolution, but is complex to operate and high in cost; the results of DNA sequencing technology are accurate and reliable, but the data analysis is complex and the cost is high; although SDS-PAGE can visually display the detection results, the resolution is limited and it is difficult to distinguish highly similar proteins; Western Blot depends on the quality and specificity of antibodies.
[0004] In summary, the existing methods for identifying Bemisia tabaci C- and C+ strains have defects such as complex operation, high cost, insufficient result stability, and insufficient specificity, and there is an urgent need to develop a method for identifying Bemisia tabaci C- and C+ strains that is simple to operate, low in cost, stable in results, and high in specificity. Summary of the Invention
[0005] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide the application of the trnP gene in identifying single female lines of Bemisia tabaci C- and C+ strains, primer pairs, and identification methods.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] The application of the trnP gene in identifying single female lines of Bemisia tabaci C- and C+ strains. In the single female line of Bemisia tabaci C- strain, a partial fragment of the trnP gene is as shown in SEQ ID NO.3; in the single female line of Bemisia tabaci C+ strain, a partial fragment of the trnP gene is as shown in SEQ ID NO.4.
[0008] A primer pair for identifying single female lines of Bemisia tabaci C- and C+ strains, the primer pair being used for PCR amplification of a sequence containing the differential sites of the trnP gene of Bemisia tabaci C- and C+ strains. In the single female line of Bemisia tabaci C- strain, a partial fragment of the trnP gene is shown as SEQ ID NO.3; in the single female line of Bemisia tabaci C+ strain, a partial fragment of the trnP gene is shown as SEQ ID NO.4.
[0009] On the basis of the above scheme, the primer pair sequences are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0010] A method for identifying single female lines of Bemisia tabaci C- and C+ strains, extracting the genomic DNA of the to-be-detected Bemisia tabaci as a template, performing PCR amplification using a specific primer pair, performing enzyme digestion on the PCR amplification product using a restriction endonuclease, and performing agarose gel electrophoresis on the product obtained by enzyme digestion to detect the fragment length and the number of bands; the primer pair sequences are shown as SEQ ID NO.1 and SEQ ID NO.2; the restriction endonuclease is SspI.
[0011] On the basis of the above scheme, the Bemisia tabaci is the Q-type Bemisia tabaci.
[0012] On the basis of the above scheme, the agarose gel electrophoresis pattern shows a band with a fragment length of 779 bp, indicating that the to-be-detected Bemisia tabaci is the C- strain; the agarose gel electrophoresis pattern shows two bands of 524 bp and 255 bp, indicating that the to-be-detected Bemisia tabaci is the C+ strain.
[0013] On the basis of the above scheme, the amplification system for the PCR amplification is: 2 μL of genomic DNA solution, 1 μL of each of the 10 μM sense and antisense primers, 12.5 μL of Premix Taq, and made up to 25 μL with DEPC water.
[0014] On the basis of the above scheme, the reaction conditions for the PCR amplification are: pre-denaturation at 95 °C for 2 minutes; denaturation at 98 °C for 10 seconds, annealing at 60 °C for 30 seconds, extension at 72 °C for 60 seconds, for 35 cycles; extension at 72 °C for 2 minutes.
[0015] On the basis of the above scheme, the enzyme digestion conditions for the restriction endonuclease are: 37 °C, 60 minutes.
[0016] Advantages of the technical solution of the present invention
[0017] Based on the differential bases of the mitochondrial trnP gene in the mtDNA of Bemisia tabaci C- and C+ strains, the present invention developed a primer pair for amplifying the sequence containing the differential bases. Using the genomic DNA of the tested Bemisia tabaci as a template, PCR amplification was performed with this primer pair, and the amplified product was digested with a restriction endonuclease. The length and number of bands of the digested fragments were detected by agarose gel electrophoresis, thereby achieving the purpose of identifying the single-female lines of Bemisia tabaci C- and C+ strains.
[0018] The method for identifying the single-female lines of Bemisia tabaci based on PCR-RFLP of the present invention can quickly, accurately, and intuitively identify different strains of Bemisia tabaci, laying a foundation for the identification of heat-tolerant single-female lines of Bemisia tabaci, the identification of the population dynamics of Bemisia tabaci, and the research on its biology and invasion mechanism. Brief Description of the Drawings
[0019] Figure 1 It is the agarose gel electrophoresis pattern of the PCR product before digestion and after digestion with SspI in Example 3 (where M: Marker 2000, from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp);
[0020] Figure 2 It is the agarose gel electrophoresis pattern of the PCR product after digestion with SspI in Example 4 (where the sample wells 1-5 are Bemisia tabaci C- strain from Shouguang area, Shandong Province, and 6-10 are Bemisia tabaci C+ strain from Shouguang area, Shandong Province);
[0021] Figure 3 It is the agarose gel electrophoresis pattern of the PCR product after digestion with SspI in Example 5 (where the sample wells 1-5 are Bemisia tabaci C- strain from Lingshui area, Hainan Province, and 6-10 are Bemisia tabaci C+ strain from Lingshui area, Hainan Province). Detailed Embodiments
[0022] The terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art unless otherwise specified. The present invention will be further described in detail below with reference to specific examples and data. The following examples are only for illustrating the present invention and do not limit the scope of the present invention in any way.
[0023] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The test materials, reagents, drugs, etc. used in the following examples can be obtained through general channels unless otherwise specified.
[0024] In the following examples, the SspI endonuclease was purchased from Yugong Biotechnology Co., Ltd., Premix Taq (Ex Taq) was purchased from Takara Co., Ltd., the autoclaved STE (TNE) buffer (pH 8.0) was purchased from Solarbio Co., Ltd., Proteinase K was purchased from Aikery Biotechnology Co., Ltd., and other reagents and consumables were all ordinary commercially available products.
[0025] The whitefly in the following examples is the Q biotype whitefly (MED cryptic species).
[0026] Example 1
[0027] Obtaining the differential sites of the trnP gene in different strains (C- and C+) of whiteflies
[0028] (1) Whiteflies were collected from Shouguang (SG) in Shandong Province and Lingshui (LS) in Hainan Province respectively, and were detected according to the method described in [Li H, Wei X, Ding T, Chu D. Genome-Wide Profiling of Cardinium-Responsive MicroRNAs in the Exotic Whitefly, Bemisia tabaci (Gennadius) Biotype Q. Front Physiol. 2018 Nov 12; 9: 1580. doi: 10.3389 / fphys.2018.01580. PMID: 30483149; PMCID: PMC6241202.]. They were divided into the C- strain and C+ strain of whiteflies, and single-female lines C+ and C- with the same genetic background were constructed respectively for the whiteflies collected from Shouguang (SG) in Shandong Province and Lingshui (LS) in Hainan Province according to the method described therein. These two strains have significant differences in biological characteristics, such as heat tolerance.
[0029] (2) Based on the mitochondrial genomes of the two strains (C- and C+) of whiteflies established by the above method, the molecular software SnapGene 5.2 was used to align the mitochondrial genome sequences of the two strains, and it was found that there was a recognition site for a restriction endonuclease in the differential sequences of the trnP gene of the two strains. In the C+ strain, it was the recognition site of the restriction endonuclease SspI (restriction site 5'-AAT^ATT-3').
[0030] Example 2
[0031] Application of the differential site sequence of the trnP gene of whiteflies in identifying single-female lines of C- and C+ strain whiteflies
[0032] Primers were designed on the sequences before and after the differential site of the trnP gene in the C- and C+ strains of Bemisia tabaci (the primer sequences are shown as SEQ ID NO.1 and SEQ ID NO.2). Using the genomic DNA of the tested Bemisia tabaci as a template, a partial fragment of the trnP gene containing this site was amplified by PCR. In the single female line of the C- strain of Bemisia tabaci, the partial fragment of the trnP gene amplified by PCR is shown as SEQ ID NO.3; in the single female line of the C+ strain of Bemisia tabaci, the partial fragment of the trnP gene amplified by PCR is shown as SEQ ID NO.4.
[0033] Forward primer: 5’-TTATTCGCAATGGACCTCTACACT-3’ (SEQ ID NO.1);
[0034] Reverse primer: 5’-GAAGTATAAAACGTTGTGATTTTCCAT-3’ (SEQ ID NO.2);
[0035] SEQ ID NO.3 (5’→3’)
[0036] TTATTCGCAATGGACCTCTACACTTTTTGATAATTTCATAAATAATTAATAAACAGAGTAAAAGATAAAAGATAAGAAAAAATGAAAATAAACTAAAAGGAACTAACATAAATTTAAAAACAAAATAAAATTCATATAAGTTAATTTTAAAAGTTGAAACAAAAATAGAGAAATAAATAAAATTAGATTTAATAATTTGCCCAAATAAAACACCCAAAATTAAGATTCAGATAAATCTTAAATAAAATTTATAAATTATAGAAATTTTTTCAACAATGATTACACCACACATGTAAGCCAAAAGAATCACAGTTCCTCTTATAAATAACATAAATAATAAAAATCTATAAAAATAAGAATTAACAATAAATACAAGAGAAATTCTCGAAAAAATGAGACATAAAATAAAAAATAAAATTAAAATCACTGGATTAAACATTATAAAAACAACTAGAAAAGTCAATAACTTCAATCAGTAAATAATTTAAGATAAAATACTAATCTTGGAAATTAGAAATAATGATATTTTTACTGATACTTTAAACCTAGAAAAGATTTCATTGAATTACAAAATCAACATTTTTTTATAAACTACTAAAATTATGAAAATAGAAGAAATAGTTTTACCCATTTTATTAATAGTAATAATTTATCTGGTTTCAAAGATAAATATAATTAGCAGATTAATTATAATTGAATACATCTCTATCATAGTAATTATCACAATAATGATTTTAATTAAAACTGTGAATATGGAAAATCACAACGTTTTATACTTC
[0037] SEQ ID NO.4(5’→3’)
[0038] TTATTCGCAATGGACCTCTACACTTTTTGATAATTTCATAAATAATTAATAAACAGAGTAAAAGATAAAAGATAAGAAAAAATGAAAATAAACTAAAAGGAACTAACATAAATTTAAAAACAAAATAAAATTCATATAAGTTAATTTTAAAAGTTGAAACAAAAATAGAGAAATAAATAAAATTAGATTTAATAATTTGCCCAAATAAAACACCCAAAATTAAGATTCAGATAAATCTTAAATAAAATTTATAAATTATAGAAATTTTTTCAACAATGATTACACCACACATGTAAGCCAAAAGAATCACAGTTCCTCTTATAAATAACATAAATAATAAAAATCTATAAAAATAAGAATTAACAATAAATACAAGAAAAATTCTCGAAAAAATGAGACATAAAATAAAAAATAAAATTAAAATCACTGGATTAAACATTATAAAAACAACTAGAAAAGTCAATAACTTCAATCAGTAAATAATTTAAGATAAAATACTAATCTTGGAAATTAGAAATAATAATATTTTTACTGATACTTTAAACCTAGAAAAGATTTCATTGAATTACAAAATCAACATTTTTTTATAAACTACTAAAATTATGAAAATAGAAGAAATAGTTTTACCCATTTTATTAATAGTAATAATTTATCTGGTTTCAAAGATAAATATAATTAGCAGATTAATTATAATTGAATACATCTCTATCATAGTAATTATCACAATAATGATTTTAATTAAAACTGTGAATATGGAAAATCACAACGTTTTATACTTC
[0039] Example 3
[0040] A method for identifying single female lines of Bemisia tabaci C- and C+ strains is as follows:
[0041] (1) Extract the genomic DNA of Bemisia tabaci
[0042] Place a single-headed female Bemisia tabaci in a 0.2 mL centrifuge tube containing 30 μL of alkaline lysis solution. The alkaline lysis solution is a high-pressure sterilized STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). After thoroughly grinding and homogenizing with a sealing pipette tip, place it in a PCR instrument at 65 °C for 15 min; after 95 °C for 10 min, a Bemisia tabaci genomic DNA solution is prepared.
[0043] (2) PCR amplification of a partial fragment of the Bemisia tabaci trnP gene
[0044] Using the genomic DNA solutions of Bemisia tabaci from Lingshui C-strain (LSC-), Shouguang C-strain (SGC-), Lingshui C+ strain (LSC+), and Shouguang C+ strain (SGC+) in Hainan and Shandong respectively as templates for PCR amplification to obtain PCR amplification products; the primer sequences used for amplification are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0045] The PCR amplification system is: 2 μL of genomic DNA solution, 1 μL each of 10 μM sense and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and made up to 25 μL with DEPC water;
[0046] PCR amplification conditions: Pre-denaturation at 95 °C for 2 minutes; denaturation at 98 °C for 10 seconds, annealing at 60 °C for 30 seconds, extension at 72 °C for 60 seconds, for 35 cycles; extension at 72 °C for 2 minutes; 4 °C, ∞.
[0047] (3) Detect the PCR amplification products prepared in step (2) by agarose gel electrophoresis (as shown in Figure 1 lanes 1-4).
[0048] Sequence the above PCR amplification products. The sequences of the PCR amplification products of the Lingshui C-strain and Shouguang C-strain in Hainan are shown in SEQ ID NO.3, and the sequences of the PCR amplification products of the Lingshui C+ strain and Shouguang C+ strain in Hainan are shown in SEQ ID NO.4.
[0049] (4) Digest the PCR amplification products prepared in step (3) with the restriction endonuclease SspI to obtain digestion products;
[0050] The digestion system: 2 μL of 10X CutOne Buffer, 5 μL of PCR amplification products, 1 μL of SspI endonuclease, and made up to 20 μL with DEPC water.
[0051] Reaction conditions: Place in a PCR instrument at 37 °C for 60 minutes.
[0052] (5) Separate the enzyme digestion products obtained in step (4) by agarose gel electrophoresis, image them on a UV gel imager, and observe their polymorphisms.
[0053] The results showed that for the enzyme digestion results of the restriction endonuclease SspI, there was a band with a fragment length of 779 bp on the imaging films of the Hainan Lingshui C-strain (LSC-) and the Shandong Shouguang C-strain (SGC-). The electrophoretograms of the Hainan Lingshui C+ strain (LSC+) and the Shandong Shouguang C+ strain (SGC+) showed two bands of 524 bp and 255 bp for the tested samples (as Figure 1 shown in lanes 6-9).
[0054] Example 4
[0055] A method for identifying single female lines of Bemisia tabaci C- and C+ strains is as follows:
[0056] (1) Extract the genomic DNA of Bemisia tabaci
[0057] In the two single female lines of Shandong Shouguang C- and C+ established in the laboratory, randomly select 5 female Bemisia tabaci and place them in a 0.2 mL centrifuge tube containing 30 μL of alkaline lysis solution. The alkaline lysis solution is a high-pressure sterilized STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). After thoroughly grinding and homogenizing with a sealed pipette tip, place it in a PCR instrument at 65 °C for 15 min; after 95 °C for 10 min, a genomic DNA solution of Bemisia tabaci is obtained.
[0058] (2) PCR amplify a partial fragment of the trnP gene of Bemisia tabaci
[0059] Respectively use the genomic DNA solutions of Bemisia tabaci of the Shandong Shouguang C- strain (SGC-) and the Shandong Shouguang C+ strain (SGC+) as templates for PCR amplification to obtain PCR amplification products; the primer sequences used for amplification are as shown in SEQ ID NO.1 and SEQ ID NO.2.
[0060] The PCR amplification system is: 2 μL of genomic DNA solution, 1 μL each of 10 μM sense and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and made up to 25 μL with DEPC water;
[0061] PCR amplification conditions: pre-denaturation at 95 °C for 2 minutes; denaturation at 98 °C for 10 seconds, annealing at 60 °C for 30 seconds, extension at 72 °C for 60 seconds, for 35 cycles; extension at 72 °C for 2 minutes; 4 °C, ∞.
[0062] (3) Digest the PCR amplification products obtained in step (2) with the restriction endonuclease SspI to obtain enzyme digestion products;
[0063] Restriction digestion system: 2 μL of 10X CutOne Buffer, 5 μL of PCR amplification product, 1 μL of SspI endonuclease, and made up to 20 μL with DEPC water.
[0064] Reaction conditions: Place in a PCR instrument at 37 °C for 60 minutes.
[0065] (4) Separate the restriction digestion products obtained in step (3) by agarose gel electrophoresis, image on a UV gel imager, and observe their polymorphisms.
[0066] The results showed that there was a band with a fragment length of 779 bp on the imaging film of sample wells 1 - 5 for the Shandong Shouguang C - strain; the electrophoretogram of sample wells 6 - 10 for the Shandong Shouguang C + strain showed two bands of 524 bp and 255 bp for the tested sample (as Figure 2 ).
[0067] Example 5
[0068] A method for identifying single female lines of Bemisia tabaci C - and C + strains, the steps are as follows:
[0069] Using two single female lines of Hainan Lingshui C - and C + established in the laboratory as detection samples, extract their genomic DNA; the detection method is the same as in Example 4.
[0070] Image the agarose gel electrophoresis results on a UV gel imager, showing that there was a band with a fragment length of 779 bp on the imaging film of sample wells 1 - 5 for the Hainan Lingshui C - strain; the electrophoretogram of sample wells 6 - 10 for the Hainan Lingshui C + strain showed two bands of 524 bp and 255 bp for the tested sample (as Figure 3 ).
[0071] The above - mentioned are only the preferred embodiments of the present invention, and are not limitations to the present invention in other forms. Any person skilled in the relevant art may use the disclosed technical content to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modifications, equivalent changes, and modifications made to the above - mentioned embodiments based on the technical essence of the present invention without departing from the technical solution content of the present invention still fall within the protection scope of the technical solution of the present invention.
Claims
1. The application of trnP gene in distinguishing C- and C+ strains of Bemisia tabaci monogyne, characterized in that: In the C- strain Bemisia tabaci monogynous line, the partial fragment of the trnP gene is shown as SEQ ID NO.3; in the C+ strain Bemisia tabaci monogynous line, the partial fragment of the trnP gene is shown as SEQ ID NO.
4.
2. A primer pair for distinguishing C- and C+ strains of Bemisia tabaci monogyne, characterized in that: The primer pair is used for PCR amplification of a sequence containing a differential site of the trnP gene of C- and C+ strains of whitefly. In the C- strain whitefly monogynous line, a partial fragment of the trnP gene is shown as SEQ ID NO.3; in the C+ strain whitefly monogynous line, a partial fragment of the trnP gene is shown as SEQ ID NO.
4.
3. The primer pair for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 2, characterized in that: The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.
2.
4. A method for distinguishing C- and C+ strains of Bemisia tabaci monogyne, characterized in that: The genomic DNA of the whitefly to be tested is extracted as a template, a specific primer pair is used for PCR amplification, a restriction endonuclease is used to digest the PCR amplification product, and the product obtained by digestion is subjected to agarose gel electrophoresis to detect the length of the fragment and the number of bands; the primer pair sequence is shown in SEQ ID NO.1 and SEQ ID NO.2; and the restriction endonuclease is SspI.
5. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 4, characterized in that: The whitefly is a Q-type whitefly.
6. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 4, characterized in that: The agarose gel electrophoresis pattern showed a band with a fragment length of 779 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 524 bp and 255 bp, indicating that the tested whitefly was a C+ strain.
7. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to any one of claims 4 to 6, characterized in that: The amplification system of the PCR amplification is: 2 μL of genomic DNA solution, 1 μL of 10 μM forward and antisense primers, 12.5 μL of Premix Taq, and DEPC water to make up to 25 μL.
8. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 7, characterized in that: The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.
9. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 8, characterized in that: The restriction endonuclease digestion conditions are: 37° C., 60 minutes.
Citation Information
Patent Citations
Primer and method for rapidly detecting symbiotic bacterium Cardinium in biotype Q bemisia tabaci
CN107254536A
Method and kit capable of simultaneously identifying six bemisia tabaci biological types
CN112575091A
Bemisia tabaci OBP-12 gene and application thereof in prevention and control of bemisia tabaci
CN116949051A
Human genes and gene expression products
SG94432A1