ZNF423 gene molecular marker related to chicken carcass traits and application of ZNF423 gene molecular marker
By analyzing the SNP loci in the ZNF423 gene, primer pairs and kits are designed to identify chicken carcasses traits, which solves the problem of molecular marking related to chicken carcasses traits in the prior art, and achieves accurate identification of chicken carcasses performance and improvement of breeding efficiency.
Patent Information
- Application Number
- CN202510289637.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-12
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-03-12
AI Technical Summary
The prior art has failed to effectively explore the molecular markers of ZNF423 gene related to chicken carcasses traits, resulting in poor breeding efficiency and effectiveness of chicken carcasses.
By analyzing the ZNF423 gene, it was found that it had multiple single nucleotide polymorphic sites (SNPs) significantly related to chicken carcasses performance, and corresponding primer pairs and kits were designed to identify chicken carcasses traits.
Accurate identification of chicken carcasses traits is achieved, and new SNP molecular marking tools are provided, which improves the efficiency and effectiveness of chicken carcasses performance breeding.
Smart Images

Figure CN120060490A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a ZNF423 gene molecular marker related to chicken carcass traits and its application. Background Art
[0002] In commercial production, as one of the important poultry species, the carcass performance of chickens, such as abdominal fat, leg weight, semi-eviscerated rate, eviscerated rate and other traits, is regarded as important indicators affecting its economic value. Single nucleotide polymorphism (SNP) is the most common type of genetic variation in the genomes of humans and animals, accounting for more than 90% of all known polymorphisms. SNP refers to the variation of a single nucleotide at the genomic level, including base transitions, transversions, insertions or deletions. A large number of studies have shown that SNPs in gene structures have a significant impact on the actual production performance of animals and can be used as an important tool for molecular marker-assisted selection (MAS) to improve the efficiency and effectiveness of breeding.
[0003] The zinc finger protein 423 encoded by the ZNF423 gene (Zinc Finger Protein 423 Gene, ZNF423) belongs to the zinc finger protein family. It acts as a DNA-binding transcription factor by using different zinc fingers and plays an important role in the signal transduction process of animal adipogenesis. Some studies have shown that the ZNF423 gene plays a regulatory role in the differentiation of chicken adipocytes and the development of abdominal adipose tissue. However, there is currently no report on the relationship between the ZNF423 gene and avian carcass performance. Summary of the Invention
[0004] The purpose of the present invention is to provide a ZNF423 gene molecular marker related to chicken carcass traits and its application to solve the problems existing in the above-mentioned prior art. This molecular marker is significantly related to chicken carcass traits, providing a new SNP molecular marker for MAS and applying it to the breeding of chicken carcass traits.
[0005] To achieve the above purpose, the present invention provides the following solutions:
[0006] The present invention provides a ZNF423 gene molecular marker related to chicken carcass traits. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and there are four sites, SNP1 - SNP4, on the sequence shown in SEQ ID NO: 1;
[0007] SNP1: It is the site at the 462nd position, and there is a G>A mutation at this site, which is divided into three genotypes: GG, AA, and GA;
[0008] SNP2: It is the locus at position 510. There is an A>G mutation at this locus, and it is divided into three genotypes: GG, AA, and GA;
[0009] SNP3: It is the locus at position 741. There is an A>G mutation at this locus, and it is divided into three genotypes: GG, AA, and GA;
[0010] SNP4: It is the locus at position 753. There is a T>C mutation at this locus, and it has three genotypes: TT, CC, and TC.
[0011] The present invention also provides a primer pair for amplifying the above-mentioned molecular marker, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 2-3.
[0012] The present invention also provides a kit for identifying chicken carcass traits, and the kit includes a primer pair for detecting the above-mentioned molecular marker, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 2-3.
[0013] The present invention also provides a method for identifying chicken carcass traits, including the following steps:
[0014] Using the DNA of the chicken genome to be tested as a template, amplifying the above-mentioned molecular marker with the primer pair, analyzing the genotypes of four SNP loci on the nucleotide sequence of the molecular marker, and judging the chicken carcass traits according to the genotypes;
[0015] Among them, the nucleotide sequences of the primer pair are shown in SEQ ID NO: 2-3, and the chicken carcass traits include keel length, dressing percentage, a value of pectoral muscle, b value of pectoral muscle, and intramuscular fat width.
[0016] Preferably, the genotypes GG, AA, and GA of the SNP1 locus are all significantly correlated with keel length and dressing percentage, and the keel length of the GG genotype is higher than that of the AA genotype and GA genotype; the dressing percentage of the GG genotype is higher than that of the AA genotype;
[0017] The genotypes GG, AA, and GA of the SNP2 locus are all significantly correlated with the a value and b value of pectoral muscle, and the a value of pectoral muscle of the AA genotype is higher than that of the GG genotype and AA genotype, and the b value of pectoral muscle of the AA genotype is higher than that of the GG genotype and AA genotype;
[0018] The genotypes GG, AA, and GA of the SNP3 locus are all significantly correlated with intramuscular fat width, and the intramuscular fat width of the GG genotype is lower than that of the AA genotype and GA genotype;
[0019] The genotypes TT, CC, and TC at the SNP4 locus are all significantly correlated with the width of intramuscular fat and the keel length. Moreover, the width of intramuscular fat of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.
[0020] The present invention also provides the use of the said molecular marker, or the said primer pair, or the said kit in identifying chicken carcass traits, and the chicken carcass traits include keel length, slaughter rate, a value of breast muscle, b value of breast muscle, and width of intramuscular fat.
[0021] Preferably, the genotypes GG, AA, and GA at the SNP1 locus are all significantly correlated with the keel length and the slaughter rate. Moreover, the keel length of the GG genotype is higher than that of the AA genotype and the GA genotype; the slaughter rate of the GG genotype is higher than that of the AA genotype.
[0022] The genotypes GG, AA, and GA at the SNP2 locus are all significantly correlated with the a value of breast muscle and the b value of breast muscle. Moreover, the a value of breast muscle of the AA genotype is higher than that of the GG genotype and the AA genotype, and the b value of breast muscle of the AA genotype is higher than that of the GG genotype and the AA genotype.
[0023] The genotypes GG, AA, and GA at the SNP3 locus are all significantly correlated with the width of intramuscular fat. Moreover, the width of intramuscular fat of the GG genotype is lower than that of the AA genotype and the GA genotype.
[0024] The genotypes TT, CC, and TC at the SNP4 locus are all significantly correlated with the width of intramuscular fat and the keel length. Moreover, the width of intramuscular fat of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.
[0025] The present invention also provides the use of the said molecular marker, or the said primer pair, or the said kit in chicken breeding.
[0026] Preferably, the chicken breeding is for chicken carcass trait breeding, and the chicken carcass traits include keel length, slaughter rate, a value of breast muscle, b value of breast muscle, and width of intramuscular fat.
[0027] Preferably, the genotypes GG, AA, and GA at the SNP1 locus are all significantly correlated with the keel length and the slaughter rate. Moreover, the keel length of the GG genotype is higher than that of the AA genotype and the GA genotype; the slaughter rate of the GG genotype is higher than that of the AA genotype.
[0028] The genotypes GG, AA, and GA at the SNP2 locus are all significantly correlated with the a value of breast muscle and the b value of breast muscle. Moreover, the a value of breast muscle of the AA genotype is higher than that of the GG genotype and the AA genotype, and the b value of breast muscle of the AA genotype is higher than that of the GG genotype and the AA genotype.
[0029] The genotypes GG, AA, and GA at the SNP3 locus are all significantly correlated with the width of intramuscular fat, and the width of intramuscular fat with the GG genotype is lower than that with the AA genotype and the GA genotype.
[0030] The genotypes TT, CC, and TC at the SNP4 locus are all significantly correlated with the width of intramuscular fat and the keel length. The width of intramuscular fat with the CC genotype and the TC genotype is lower than that with the TT genotype, and the keel length with the TC genotype is higher than that with the TT genotype.
[0031] The present invention discloses the following technical effects:
[0032] By analyzing the ZNF423 gene, the present invention finds that there are multiple SNP loci significantly correlated with chicken carcass performance in this gene, providing new SNP molecular markers for MAS. Through experimental verification, it is found that the locus NC_052542.1:g.6451855(rs312510956) is significantly correlated with the keel length and the slaughter rate (P<0.05). Among them, the difference in the keel length between the GG genotype and the AA and GA genotypes is significant (P<0.05), and the difference in the slaughter rate between the GG genotype and the AA genotype is significant (P<0.05); the locus NC_052542.1:g.6451903(rs14960791) is significantly correlated with the a value and b value of breast muscle (P<0.05). Among them, the difference in the b value of breast muscle between the GG genotype and the AA genotype is significant (P<0.05), and the difference in the a value of breast muscle between the AA genotype and the GG and GA genotypes is significant (P<0.05); the locus NC_052542.1:g.6452134(rs14021029) is significantly correlated with the width of intramuscular fat (P<0.05). Among them, the difference in the width of intramuscular fat between the AA genotype and the GA genotype is significant (P<0.05); the locus NC_052542.1:g.6452146(rs13745360) is significantly correlated with both the width of intramuscular fat and the keel length (P<0.05). Among them, the difference in the width of intramuscular fat between the CC genotype and the TC genotype is significant (P<0.05), and the difference in the keel length between the TC genotype and the TT genotype is significant (P<0.05). The correlation between other SNP loci and carcass traits does not reach a significant level (P>0.05). It can be seen that the molecular markers provided by the present invention can accurately identify the carcass traits of chickens, providing scientific data for the breeding of chickens. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0034] Figure 1 It is a schematic diagram of the position of the ZNF423 gene on the chromosome and primer design;
[0035] Figure 2 It is the SNP site of the ZNF423 gene. Detailed implementation manners
[0036] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0037] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0038] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0039] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and embodiments of the present invention are only exemplary.
[0040] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.
[0041] Embodiment
[0042] 1. Materials and Methods
[0043] 1.1 Animal Samples
[0044] A total of 325 small white - feather broilers, slow - growing yellow - feather broilers, and fast - growing white - feather broilers at 45 days of age were selected. 2 mL of subcutaneous venous blood was collected and stored at - 80 °C for use as DNA extraction samples. Record the carcass traits of the selected population, including chest angle, chest depth, chest width, live body weight, shank length, shank circumference, body diagonal length, keel length, comb height, dressed weight, subcutaneous fat thickness, intramuscular fat width, semi - eviscerated weight, eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, chicken claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi - eviscerated percentage, eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage, etc.
[0045] All the above carcass trait indicators are common measurement indicators. Without special instructions, they can be measured according to conventional methods.
[0046] 1.2 Main Reagents
[0047] Blood sample DNA extraction kit (Brand: OMEGA; Catalog number: D3392; Guangzhou Feiyang Biotechnology Co., Ltd.), 2xRapid Taq Master Mix (Dye) (Brand: Novoprotein; Catalog number: P222 - 01; Nanjing Novoprotein Biotechnology Co., Ltd.), DNAmarker (Brand: TransGen Biotech; Catalog number: BM101 - 01; Beijing TransGen Biotech Co., Ltd.), high - purity low - electroendosmosis agarose (Brand: Tsingke; Catalog number: TSJ001; Beijing Tsingke Biotechnology Co., Ltd.).
[0048] 1.3 Experimental Methods
[0049] 1.3.1 Primer Design
[0050] According to the sequence of the chicken (Gallus gallus domesticus) ZNF423 gene (NC_052542.1) published by NCBI (National Center for Biotechnology Information Search database), primers were designed using the Primer - BLAST tool of NCBI, and primer synthesis services were provided by Guangzhou Tsingke Biotechnology Co., Ltd. The relevant information of the primer sequences is shown in Table 1.
[0051] Table 1 PCR Amplification Primer Sequences
[0052]
[0053] 1.3.2 Blood sample DNA extraction
[0054] Extract the blood sample DNA with reference to the operation manual of the blood sample DNA extraction kit.
[0055] 1.3.3 PCR amplification of ZNF423 gene sequence
[0056] Use the genomic DNA of the blood samples of the above 325 chickens as a template and follow the following reaction system: template DNA 2 μL, 2×ES Taq Master Mix (Dye) 15 μL, upstream primer 1.2 μL, downstream primer 1.2 μL, ddH 2 O 10.6 μL.
[0057] Reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 15 s, 34 cycles; final extension at 72°C for 5 min; store at 4°C. The PCR products were sent to Guangzhou Qingke Biotechnology Co., Ltd. for Sanger first-generation sequencing.
[0058] 1.3.4 SNPs determination and genotyping
[0059] Use the Seqman tool in DNAStar software to analyze the sequence peak maps of the Sanger first-generation sequencing results of the PCR products to determine potential SNP sites. Align the sequencing data of each sample through the SeqMan tool of DNAStar software for genotyping.
[0060] 1.3.5 Association analysis of genotype and carcass traits
[0061] The carcass trait data of the individuals corresponding to the SNPs sites and genotypes were subjected to association analysis using SPSS 26.0.
[0062] 2. Results
[0063] 2.1 PCR amplification of ZNF423 gene sequence and SNP screening
[0064] Select the above 325 chicken individuals, use the blood sample DNA of each individual as a template for PCR amplification, and perform Sanger first-generation sequencing on the obtained PCR products (the nucleotide sequence is shown in SEQ ID NO: 1). Compare and analyze the sequencing peak maps, and a total of 4 SNP sites are detected, namely: NC_052542.1: g.6451855(rs312510956), NC_052542.1: g.6451903(rs14960791), NC_052542.1: g.6452134(rs14021029), NC_052542.1: g.6452146(rs13745360) sites, as Figure 1 shown. The following mutations exist at the above four sites respectively: NC_052542.1: g.6451855(rs312510956) G﹥A, NC_052542.1: g.6451903(rs14960791) A﹥G, NC_052542.1: g.6452134(rs14021029) A﹥G, NC_052542.1: g.6452146(rs13745360) T﹥C.
[0065] SEQ ID NO: 1 is as follows:
[0066] ACAGCCTGTAACTGGGATTTTAGGAAGGAGGTGGATCTCCAAATCCACGTGAAGCATAGTCATTTGGGGAATCCATCAAAGTCTCACAAATGTATCTTCTGTGGTGAGACTTTTAGCACAGAGGTAGAACTGCAGTGCCACATCACAACCCACAGCAAGAAATACAACTGCAAGTTTTGTAGCAAAGCTTTTCATGCCATCATCTTGCTTGAAAAACACTTGCGGGAAAAACACTGCGTTTTTGATGCGAGCACTGAAAATGGTACAGCTAATGGCATGACCCCAACAAATAAGAAGACAGAAGGGGCAGATATCCAGAACATGTTAATGAAGAATCCAGATACCTCCAACAGTCATGAGGCCAGTGAGGATGATGTAGATGCTTCTGAGCCCATGTACGGCTGTGACATCTGTGGCGCTGCCTACACTATGGAGGTCCTCTTGCAAAACCATCGCTTGAG GGATCATAACATCAGGCCTGGGGAGGACGACTGCTCTAGGAAGAAAGC A GAGTTCATCAAAGGTAGCCACAAGTGTAATATCTGCTCAAGGACCTTTTTCTCAGAAAATGGCCTGAGAGAGCACATGCAGACCCATCGAGGCCCAGCAAAGCACTACATGTGCCCCATCTGTGGGGAGCGCTTCCCGTCGCTCCTGACCCTCACTGAGCACAAAGTCACTCACAGCAAGAGTTTGGATACAGGAACGTGTCGGATCTGCAAAATGCCGCTGCAGAGTGA A GAGGAATTCAT T GAGCACTGCCAGATGCATCCAGACCTCAGAAACTCCCTCACTGGGTTTCGCTGCGTTGTC。
[0067] The bold and underlined bases in the sequence are the mutation sites.
[0068] 2.2 Association analysis of SNP sites in the ZNF423 gene sequence and carcass traits
[0069] Association analysis was performed on the above 4 SNP sites and carcass traits (chest angle, chest depth, chest width, live weight, shank length, shank circumference, body slant length, keel length, comb height, carcass weight, subcutaneous fat thickness, intramuscular fat width, semi-eviscerated weight, eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, chicken claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, slaughter rate, semi-eviscerated rate, eviscerated rate, abdominal fat rate, breast muscle rate, leg muscle rate, etc.).
[0070] As shown in Table 2, the results showed that there was a significant correlation between the NC_052542.1:g.6451855 (rs312510956) site and keel length and slaughter rate (P<0.05). Among them, there was a significant difference in keel length between the GG genotype and the AA and GA genotypes (P<0.05), and GG was the dominant genotype; there was a significant difference in slaughter rate between the GG genotype and the AA genotype (P<0.05), and GG was the dominant genotype.
[0071] Table 2 Association of SNP sites with carcass traits
[0072]
[0073] Note: Different superscript letters (a - b) indicate significant differences (P < 0.05).
[0074] As shown in Table 3, the results showed that there was a significant correlation between the locus NC_052542.1:g.6451903 (rs14960791) and the a-value and b-value of breast muscle (P < 0.05). Among them, there was a significant difference in the b-value of breast muscle between the GG genotype and the AA genotype (P < 0.05), and AA was the dominant genotype; there was a significant difference in the a-value of breast muscle between the AA genotype and the GG and GA genotypes (P < 0.05), and AA was the dominant genotype.
[0075] Table 3 Association between SNP Loci and Carcass Traits
[0076]
[0077] Note: Different superscript letters (a - b) indicate significant differences (P < 0.05).
[0078] As shown in Table 4, the results showed that there was a significant correlation between the locus NC_052542.1:g.6452134 (rs14021029) and the width of intramuscular fat (P < 0.05). Among them, there was a significant difference in the width of intramuscular fat between the AA genotype and the GA genotype (P < 0.05); GG was the dominant genotype.
[0079] Table 4 Association between SNP Loci and Carcass Traits
[0080]
[0081]
[0082] Note: Different superscript letters (a - b) indicate significant differences (P < 0.05).
[0083] As shown in Table 5, the results showed that there was a significant correlation between the locus NC_052542.1:g.6452146 (rs13745360) and both the width of intramuscular fat and the keel length (P < 0.05). Among them, there was a significant difference in the width of intramuscular fat between the TT genotype and the CC and TC genotypes (P < 0.05), and CC was the dominant genotype; there was a significant difference in the keel length between the TC genotype and the TT genotype (P < 0.05), and TC was the dominant genotype.
[0084] Table 5 Association between SNP Loci and Carcass Traits
[0085]
[0086] Note: Different superscript letters (a - b) indicate significant differences (P < 0.05).
[0087] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A ZNF423 gene molecular marker associated with chicken carcass traits, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and there are four sites SNP1-SNP4 in the sequence shown in SEQ ID NO: 1; SNP1: It is the 462nd position, where there is a G>A mutation, which is divided into three genotypes: GG, AA and GA; SNP2: It is the 510th site, where there is an A>G mutation, which is divided into three genotypes: GG, AA and GA; SNP3: It is the 741st site, where there is an A>G mutation, which is divided into three genotypes: GG, AA and GA; SNP4: It is the 753rd site, where there is a T﹥C mutation, which is divided into three genotypes: TT, CC and TC.
2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NOs: 2-3.
3. A kit for identifying the characteristics of chicken carcasses, characterized in that: The kit comprises a primer pair for detecting the molecular marker according to claim 1, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.
4. A method for identifying the characteristics of chicken carcasses, characterized in that: The following steps are involved: Using the DNA of the chicken genome to be tested as a template, using primer pairs to amplify the molecular marker of claim 1, analyzing the genotype of the four SNP sites on the nucleotide sequence of the molecular marker, and judging the chicken carcass traits according to the genotype; The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3, and the chicken carcass traits include keel length, slaughter rate, breast muscle a value, breast muscle b value and intermuscular fat width.
5. The method according to claim 4, characterized in that The genotypes GG, AA and GA of the SNP1 locus are significantly correlated with keel length and slaughter rate, and the keel length of the GG genotype is longer than that of the AA genotype and GA; the slaughter rate of the GG genotype is higher than that of the AA genotype; The genotypes GG, AA and GA of the SNP2 locus are significantly correlated with the pectoral muscle a value and the pectoral muscle b value, and the pectoral muscle a value of the AA genotype is higher than the pectoral muscle a value of the GG genotype and the AA genotype, and the pectoral muscle b value of the AA genotype is higher than the pectoral muscle b value of the GG genotype and the AA genotype; The genotypes GG, AA and GA of the SNP3 locus are all significantly correlated with the intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and the GA genotype; The genotypes TT, CC and TC of the SNP4 locus are significantly correlated with the intermuscular fat width and keel length, and the intermuscular fat width of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.
6. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in identifying chicken carcass traits, characterized in that: The chicken carcass traits include keel length, slaughter rate, breast muscle a value, breast muscle b value and intermuscular fat width.
7. The use according to claim 6, characterized in that The genotypes GG, AA and GA of the SNP1 locus are significantly correlated with keel length and slaughter rate, and the keel length of the GG genotype is longer than that of the AA genotype and GA; the slaughter rate of the GG genotype is higher than that of the AA genotype; The genotypes GG, AA and GA of the SNP2 locus are significantly correlated with the pectoral muscle a value and the pectoral muscle b value, and the pectoral muscle a value of the AA genotype is higher than the pectoral muscle a value of the GG genotype and the AA genotype, and the pectoral muscle b value of the AA genotype is higher than the pectoral muscle b value of the GG genotype and the AA genotype; The genotypes GG, AA and GA of the SNP3 locus are all significantly correlated with the intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and the GA genotype; The genotypes TT, CC and TC of the SNP4 locus are significantly correlated with the intermuscular fat width and keel length, and the intermuscular fat width of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.
8. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in chicken breeding.
9. The use according to claim 8, characterized in that The chicken breeding is chicken carcass trait breeding, and the chicken carcass traits include keel length, slaughter rate, breast muscle a value, breast muscle b value and intermuscular fat width.
10. The use according to claim 9, characterized in that The genotypes GG, AA and GA of the SNP1 locus are significantly correlated with keel length and slaughter rate, and the keel length of the GG genotype is longer than that of the AA genotype and GA; the slaughter rate of the GG genotype is higher than that of the AA genotype; The genotypes GG, AA and GA of the SNP2 locus are significantly correlated with the pectoral muscle a value and the pectoral muscle b value, and the pectoral muscle a value of the AA genotype is higher than the pectoral muscle a value of the GG genotype and the AA genotype, and the pectoral muscle b value of the AA genotype is higher than the pectoral muscle b value of the GG genotype and the AA genotype; The genotypes GG, AA and GA of the SNP3 locus are all significantly correlated with the intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and the GA genotype; The genotypes TT, CC and TC of the SNP4 locus are significantly correlated with the intermuscular fat width and keel length, and the intermuscular fat width of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.
Citation Information
Patent Citations
Hornless livestock
CN105142396A
Primer combination for detecting Langya chicken specific genetic loci and application
CN112626226A
LncEDCH1 gene molecular marker related to chicken carcass traits and application of LncEDCH1 gene molecular marker
CN116694774A
Diagnostic system for selecting nutrition and pharmacological products for animals
US20100153016A1
Cited By
Molecular marker related to broiler carcass traits and meat quality traits, amplification primer and application of molecular marker
CN120648814A
Molecular marker related to chicken carcass traits and meat quality traits, amplification primer pair and application
CN120758641A