SNP (Single Nucleotide Polymorphism) molecular marker for identifying pork quality, primer and application of SNP molecular marker

Abstract

The invention relates to the technical field of pig breeding, in particular to an SNP molecular marker for identifying pork quality, a primer and application of the SNP molecular marker, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, N at the 140th site of the sequence is an SNP site, and the polymorphism is T or C; the unfreezing water loss rate and intramuscular fat content of the pork with the CC genotype are higher than those of the pork with the TT genotype and CT genotype, and the molecular marker can be used for detecting the difference of pork quality and is applied to continuous breeding of the Songhua black pigs and early breeding in production.

Description

Technical Field

[0001] The present invention relates to the technical field of pig breeding, and particularly relates to an SNP molecular marker, a primer for identifying pork quality, and their applications. Background Art

[0002] With the development of the economy and the improvement of the living standards of residents, consumers pay more and more attention to pork quality. Relying on traditional breeding methods, it is difficult to improve muscle quality in a short period of time. Modern molecular breeding technology provides a new means for pig breeding. By detecting specific molecular markers in a population through molecular biology techniques, the growth, meat quality, and reproductive performance of individuals can be predicted at an early stage. Combining with traditional performance measurement techniques can increase the selection intensity and improve the production performance of the population in a relatively short time.

[0003] Songlei black pig is a new black pig variety (strain) being cultivated by crossing the male parent Songliao black pig with Leixiang pig. It has excellent germplasm characteristics such as good meat quality, all-black hair, and being resistant to roughage. However, the current selection intensity is low, and the production performance and meat quality show segregation within the population. There is an urgent need for selection to meet the market demand.

[0004] Containing fibronectin III and SPRY domain 2, abbreviated as FSD2 in English, is one of the members of the fibronectin III / SPRY family, which is located on chromosome 7 of pigs. Members of this family mediate the interaction between cells and the cell matrix and participate in various biological processes such as cell adhesion, growth, migration, and differentiation. At present, the FSD2 gene is related to muscle water content, intramuscular fat content, and meat color. However, further exploration and research are still needed to develop corresponding SNP molecular markers for these two phenotypes of pork thawing loss rate and intramuscular fat content. Summary of the Invention

[0005] The purpose of the present invention is to provide an SNP molecular marker, a primer for identifying pork quality, and their applications to solve the above technical problems.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The present invention provides an SNP molecular marker for identifying pork quality, whose nucleotide sequence is as shown in SEQ ID NO.1. The N at the 140th position of this sequence is the SNP site, and the polymorphism is T or C. The pork thawing loss rate and intramuscular fat content of pigs with the CC genotype at this site are higher than those of pigs with the TT genotype and CT genotype at this site.

[0008] Based on the collection of the longissimus dorsi muscle of Songlei black pigs, this invention conducts an analysis of meat quality traits, uses the direct sequencing method to detect the polymorphism of the 4th exon of the FSD2 gene, analyzes the correlation between the existing polymorphic sites and meat quality traits, obtains molecular markers related to pork quality, and can be applied to the continuous breeding of Songlei black pigs and early seed selection in production.

[0009] This invention also provides a pair of specific primers for amplifying the above SNP molecular markers, including the upstream primer shown in SEQ ID NO.2 and the downstream primer shown in SEQ ID NO.3.

[0010] This invention also provides a kit for identifying pork quality, and the kit includes the above specific primers.

[0011] Furthermore, the kit also includes 2×Premix buffer.

[0012] This invention also provides the application of the above SNP molecular markers, the specific primers or the kit in identifying pork meat color and intramuscular fat content.

[0013] This invention also provides the application of the above SNP molecular markers, the specific primers or the kit in pig breeding or assisting pig breeding, and the assisted pig breeding is to breed pork with high intramuscular fat content and low thawing loss rate.

[0014] This invention also provides a method for identifying pork quality, including the following steps:

[0015] S1. Extract the genomic DNA of the pig to be tested;

[0016] S2. Using the genomic DNA of the pig to be tested as a template, amplify with the above specific primers to obtain an amplification product;

[0017] S3. Identify the genotype at the 140th position of the amplification product, and judge the thawing loss rate and intramuscular fat content of the pork according to the genotype;

[0018] S4. The judgment method is as follows: The thawing loss rate and intramuscular fat content of the pork of pigs with the CC genotype at the 140th SNP site of the amplification product are both higher than those of pigs with the TT genotype and CT genotype at this site.

[0019] Furthermore, the reaction system for amplification is: 0.4 - 0.6 μL of each of the upstream and downstream primers, 0.4 - 0.6 μL of the genomic DNA of the pig to be tested, 9 - 11 μL of 2×Premix buffer, and 10 - 12 μL of water;

[0020] The reaction procedure is as follows:

[0021] (1) Pre-denature at 94 - 98°C for 4 - 6 min;

[0022] (2) Denature at 94 - 97°C for 25 - 35 s;

[0023] (3) Anneal at 55 - 65°C for 25 - 35 s;

[0024] (4) Extend at 70 - 74°C for 35 - 45 s;

[0025] (5) Repeat steps (2) - (4) for 25 - 35 cycles;

[0026] (6) Extend at 70 - 74°C for 4 - 6 min.

[0027] The present invention has the following beneficial effects:

[0028] In the present invention, a single nucleotide T / C mutation occurs at the 4th exon of porcine FSD2 on chromosome 7 of the porcine genome. Using primer pairs to perform PCR amplification on the target sequence containing this single nucleotide mutation site can quickly identify the polymorphism of the FSD2 gene, thereby detecting the differences in pork quality and accelerating the breeding process of breeding pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0030] Figure 1 It is the sequencing map of different genotypes of the SNP locus of the porcine FSD2 gene. Among them, A is the sequencing map of the TT genotype, B is the sequencing map of the CT genotype, and D is the sequencing map of the CC genotype. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The following will describe in detail the specific embodiments of the present invention, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0032] Example 1: Development of SNP molecular markers for identifying pork quality.

[0033] I. Experimental setup.

[0034] The experimental pig breed in this application is Songlei Black Pig, and the samples are sourced from Jilin Xinghui Qipan Agricultural Science and Technology Co., Ltd. 139 Songlei Black Pigs weighing about 100 kg were selected for slaughter. The longissimus dorsi muscle was collected 24 hours after slaughter. The thawing water loss rate was determined by measuring the water loss of the longissimus dorsi muscle before and after thawing. The initial moisture was determined by the 65°C drying method. The meat color and pH value were measured using a meat colorimeter and a pH meter. The pressurized water loss rate was determined by the pressurized weight method. The intramuscular fat content and shear force were determined using the extraction method and the cutting method.

[0035] For the extraction of porcine genomic DNA, the tissue was first minced with a sterilized ophthalmic scissors, and after homogenization, the genomic DNA kit (DP304) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. was used for extraction.

[0036] II. SNP molecular marker development.

[0037] 1. Primer design and synthesis.

[0038] Primers were designed based on the sequence of exon 4 of the porcine FSD2 (Ensembl ID: ENSSSCT00000002022.5) gene in Ensemble, and the sequence synthesis was carried out by Genewiz (Suzhou) Inc. The primer sequence information is shown in Table 1.

[0039] Table 1: Primer sequences of porcine FSD2 gene

[0040] Primer Sequence 5′-3′ SEQ ID NO. F AAACGTCTCTGGAGAGGCAC 2 R ACCTACTCTGGCCACAACCA 3

[0041] 2. PCR amplification.

[0042] Using the above primers, PCR amplification was performed on the mixed genomic DNA of 60 Songlei Black Pigs. The PCR reaction system: 0.5 μL of each upstream and downstream primer, 0.5 μL of mixed genomic DNA, 10 μL of 2×Premix buffer, and 11 μL of water added. The PCR running program was: 95°C, 5 min; 95°C, 30 s, 60°C, 30 s, and 72°C, 40 s for a total of 30 cycles; 72°C, 5 min. The SNP molecular marker sequence information is shown as SEQ ID NO.1:

[0043] SEQ ID NO.1: AAACGTCTCTGGAGAGGCACATTTTCATGTCCCCAAA TGACTCTGTCGTGAACATTCATACACTGAAATGATGGCTGAGGTTGACTATCTTGCAGGAGAATTTTGGAAGACAAGAACAAAACTTTGAGTCACATTACAANGAGATCTTGGAAACACTTGCTCAAAAATACGAAGAAAAAATACAAGCTCTAGGGGAGAAAAAGAAAGAGAAGCTAGAAGCCTTGTATGGACAGCTGGTCAGCTGTGGAGAAAATCTTGATACCTGCAAAGAACTAATGGAAACAATAGAGGAGATGTGTCACGAAGAGAAGGTTGATTTCATAAAGGTCAGTAGCAAGGAGTTCCCACTGTGGTACAAAGGGATCAGAGCGTCTCTGCAGCACCAGGACGCAGGTTCGATCCCTGGCCTGGCACAGTGGGTTAAACGATCTGGCATTGCCATAGCTGCAGCATAGGTCGCAGCTGCAGCTTGGATGTGATCCCTCGACTGGGAAGTCCATATGCTGTGGGGCAGCCTCCCAAGCCCCCAAAAAAGAAAAAAGAAAAAAGGTCAGTAACAAAGTGAAATGAAATAATGAACTGAAATGATGGTTGTGGCCAGAGTAGGT。

[0044] 2. Detection of polymorphisms in the porcine FSD2 gene.

[0045] Use SeqMan in DNASTAR to align the sequences in the Ensemble database with the sequenced nucleotide sequences to screen for polymorphic sites. PCR amplification was performed on the fragments containing polymorphic sites. The reaction system and procedure were as shown above. After amplification, PCR product sequencing was carried out. The SeqMan alignment of the sequencing results is as Figure 1 shown. One SNP site was found at 140 bp in the PCR product sequencing results, and there were three genotypes: TT, TC, and CC.

[0046] III. Verification of the association analysis between SNP molecular markers and pork quality.

[0047] 1. Genotype frequency and gene frequency.

[0048] The genotype frequencies and gene frequencies of the above SNP loci were analyzed, and TT and T were the dominant allele genotypes and the dominant allele, respectively. Chi-square test showed that the above SNP loci were in Hardy-Weinberg equilibrium (P>0.05).

[0049] Table 2: Analysis of genotype frequencies and gene frequencies

[0050]

[0051] 2. Verification of the association analysis between SNP loci and meat quality.

[0052] The meat quality traits of 139 Songlei black pigs weighing about 100 kg were statistically analyzed, and the T-TEST was used to analyze the significant differences in meat quality traits among different genotype groups. As shown in Table 3, the thawing loss rate, shear force, and intramuscular fat content of TT genotype individuals were extremely significantly lower than those of CC genotype individuals, and the initial moisture was extremely significantly higher than that of CC genotype individuals. Selecting TT genotype black pig individuals can reduce the thawing loss rate, improve tenderness and initial moisture content, and selecting CC genotype individuals can increase the intramuscular fat content for early breeding selection, thus accelerating the breeding process of breeding pigs.

[0053] Table 3: Verification of the association analysis between SNP loci and meat quality

[0054] TT CT CC Number of individuals (heads) 65 65 9 Thawing water loss rate (%) <![CDATA[6.85±2.91 B > <![CDATA[6.73±2.90 B > <![CDATA[9.87±3.11 A > Brightness 45.02±3.34 45.69±3.94 46.08±3.40 Redness 5.92±1.13 5.98±1.46 5.30±0.74 Yellowness 3.96±1.61 3.82±1.53 3.63±1.36 Initial moisture content (%) <![CDATA[72.53±1.59 A > <![CDATA[72.16±1.69 A > <![CDATA[70.56±2.27 B > Intramuscular fat content (%) <![CDATA[2.40±0.60 B > <![CDATA[2.88±0.76 B > <![CDATA[3.17±0.86 A > Pressurized water loss rate (%) 26.19±5.00 27.35±5.32 27.84±2.81 pH 5.94±0.17 5.91±0.17 5.92±0.17 Shearing force (N) <![CDATA[33.60±8.80 B > <![CDATA[35.97±9.39 AB > <![CDATA[44.14±7.50 A >

[0055] Note: Different capital letters represent extremely significant differences (P<0.01).

[0056] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concept.

[0057] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and deformations.

Claims

1. A SNP molecular marker for identifying pork quality, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1. The N at position 140 of the sequence is a SNP site, and the polymorphism is T or C. The thawing water loss rate and intramuscular fat content of pork of pigs with CC genotype at this site are higher than those of pigs with TT genotype and CT genotype at this site.

2. A specific primer for amplifying the SNP molecular marker according to claim 1, characterized in that: It includes an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.

3.

3. A kit for identifying pork quality, characterized in that: The kit comprises the specific primer according to claim 2.

4. The kit according to claim 3, characterized in that The kit also includes 2×Premix buffer.

5. Use of the SNP molecular marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in identifying pork quality.

6. Use of the SNP molecular marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in pig breeding or assisted pig breeding, characterized in that: The assisted pig breeding is to cultivate pork with high intramuscular fat content and low thawing water loss rate.

7. A method for identifying pork quality, characterized in that: The following steps are involved: S1, extracting the pig genomic DNA to be tested; S2, using the pig genomic DNA to be tested as a template, and using the specific primers described in claim 2 to perform amplification to obtain an amplified product; S3, identifying the genotype of position 140 of the amplified product, and determining the thawing water loss rate and intramuscular fat content of pork according to the genotype; S4. The judgment method is: when the SNP site at position 140 of the amplification product is CC genotype, the thawing water loss rate and intramuscular fat content of the pork are higher than those of the pigs with TT genotype and CT genotype at the site.

8. The method for identifying pork quality according to claim 7, characterized in that: The amplification reaction system is: 0.4-0.6 μL of upstream and downstream primers, 0.4-0.6 μL of pig genomic DNA to be tested, 9-11 μL of 2×Premix buffer, and 10-12 μL of water; The reaction procedure is as follows: (1) Pre-denaturation at 94-98°C for 4-6 min; (2) Denaturation at 94-97°C for 25-35 seconds; (3) Annealing at 55-65°C for 25-35 seconds; (4) 70-74°C for 30-45 seconds; (5) Repeat (2) to (4) for 25 to 35 cycles; (6) Elongate at 70-74°C for 4-6 min.

Images