Primer group, kit and method for detecting snails in shrub
By designing specific primer sets and combining fluorescence quantitative PCR technology, detection kits and methods for shrub snails were developed, which solved the problem of difficult to quickly and accurately detect and identify shrub snails in the prior art, and achieved high sensitivity and accuracy detection effects.
Patent Information
- Application Number
- CN202510326612.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-19
- Publication Date
- 2025-05-30
AI Technical Summary
The existing technology is difficult to quickly and accurately detect and identify shrub snails, resulting in frequent false reporting and concealment during the inspection of inbound and outbound species, seriously endangering the biosecurity of the country and the health of humans and animals.
A primer set for detecting shrub snails is provided, including forward primer GCF1, reverse primer GCR1 and TaqMan probe GCP1, combined with fluorescence quantitative PCR technology, to develop kits and detection methods for shrub snails.
The specific detection of shrub snails is realized, with high sensitivity and can detect shrub snails at a DNA concentration of 1fg/μL. The results are accurate and intuitive, and are easy to operate. They are suitable for fast and reliable detection and identification.
Smart Images

Figure CN120060494A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of biological detection, and in particular to a primer set, a kit and a method for detecting scrub snails. Background Art
[0002] With the increasing development and maturity of international trade and logistics, the risk of harmful foreign snails being introduced into the country through cargo, wooden packaging, containers and other means of transportation is increasing, seriously threatening the country's biological security. Harmful snails not only seriously endanger agricultural and forestry production, but are also the intermediate hosts of some major zoonotic parasitic diseases, which have a great impact on human and animal health. In recent years, harmful foreign mollusks such as scrub snails have been frequently intercepted in cargo imported from Europe at ports such as Fujian and Tianjin in my country. Arianta arbustorum (Linnaeus, 1758), belonging to the phylum Mollusca, class Gastropoda, order Stylommatophora, family Helicidae, genus Arianta, is an alien species that poses a major potential threat to agricultural production, natural ecosystems, human health and trade. The snail originated in Europe and has now invaded Canada. The United States has implemented quarantine on the snail, and it is currently not distributed in my country. Risk assessment shows that its introduction risk is very high, and quarantine must be strengthened to prevent it from entering my country.
[0003] Correct species identification is the basis for research in systematics, biology, ecology, physiology, etc. At present, the detection and identification of scrub snails mainly use shell morphology and common PCR amplification sequencing comparison. Due to historical reasons, the plant protection colleges of domestic agricultural and forestry colleges have neither courses on harmful snails nor professional research forces, and the research and development of agricultural harmful snails are slightly lagging behind. Due to the lack of effective rapid detection and identification methods for scrub snails, false reporting and concealment are often seen in the inspection of inbound and outbound species, which seriously endangers the biological safety of the country and the health of humans and animals.
[0004] The appearance of the bush snail and its similar species is very similar, and it is difficult to distinguish them based on the shell morphology alone, which requires identification personnel to have high professional knowledge and background. Secondly, the shells of bush snails are often affected by external geographical environment, climate factors, etc., and often mutate, making detection and identification more difficult. Furthermore, in actual quarantine and identification work, border ports often intercept juvenile snails or incomplete snails, making it impossible to conduct morphological identification.
[0005] Ordinary PCR amplification requires sequencing, alignment and construction of phylogenetic trees, which not only requires technicians to master the use of multiple molecular software, but also requires time-consuming and labor-intensive outsourcing sequencing, which requires high professional knowledge and molecular software application. In addition, due to the limitation of whether the database has relevant gene sequences, it cannot be guaranteed that accurate identification can be achieved through alignment or construction of phylogenetic trees.
[0006] Real-time fluorescence PCR is a mature nucleic acid qualitative and quantitative analysis technique, which plays a fundamental role in the biological field and has been widely applied in the fields of viruses, bacteria, fungi, etc. However, it is a leading technology in the field of snail detection and identification. So far, no fluorescence quantitative PCR primer sets and kits have been reported for the detection and identification of bush snails. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to provide a primer set, a kit and a method for detecting bush snails, which have strong specificity, high sensitivity and good practicability.
[0008] To solve the above technical problem, the technical solution adopted by the present invention is to provide a primer set for detecting bush snails, including: forward primer GCF1, reverse primer GCR1 and TaqMan probe GCP1; The sequence of the forward primer GCF1 is as follows: SEQ ID NO.1; The sequence of the reverse primer GCR1 is as follows: SEQ ID NO.2; The sequence of the TaqMan probe GCP1 is as follows: SEQ ID NO.3.
[0009] Further, in the above primer set for detecting bush snails, the 5' end of the TaqMan probe GCP1 is labeled with FAM and the 3' end is labeled with BHQ1.
[0010] Another technical solution of the present invention is to provide a kit for detecting bush snails, which includes the above primer set, 2×GoTaq Probe qPCR Master Mix, positive control, negative control and ddH 2 O.
[0011] Another technical solution of the present invention is to provide a method for detecting bush snails, including: Extracting sample DNA; Performing fluorescence quantitative PCR on the sample DNA using the above kit; Under the conditions that the Ct value of the positive control ≤ 30 and a typical amplification curve appears, and the blank control and the negative control have no Ct value and no amplification curve; When a typical amplification curve appears in the test sample and the Ct value is less than or equal to 37, it is determined as positive; When the Ct value is equal to 40, it is determined as negative or the DNA template concentration is low; When the Ct value is greater than 37 and less than 40, it is determined as a suspected bush snail; When it is determined as a suspected bush snail, re-extract DNA for retesting; If the retested Ct value is equal to 40, it is determined as negative or the DNA template concentration is low; if the retested Ct value is less than 40 and a typical amplification curve appears, it is determined as positive.
[0012] Further, in the above method for detecting bush snails, the fluorescence quantitative PCR program is: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 1 min, for 40 cycles; end the reaction.
[0013] The beneficial effects of the present invention are as follows: The primer set, kit and method for detecting bush snails of the present invention have the following advantages: 1. Strong specificity: It can perform dual control on the target species, and there are no non-specific amplification curves for similar species.
[0014] 2. High sensitivity: The lower limit of detection sensitivity for bush snails reaches 1 fg / μL.
[0015] 3. Accurate and intuitive result determination: The kit and method obtained in the present invention have been tested and verified on a total of 8 representative snail species, namely Bradybaena ravida ravida, Bradybaena similaris, Bradybaena kiangsiensis, Bradybaena similaris, Bradybaena shensiensis, Cathaica fasciola, Bradybaena brevispira, and Helix aspersa. Moreover, the PCR amplification results can be directly displayed on a computer without other additional steps. Therefore, the result determination is accurate and intuitive.
[0016] 4. Simple operation: It does not require complex instruments and special reagents, and only a fluorescence quantitative PCR instrument is needed for reaction and detection, with simple and convenient operation.
[0017] 5. Good practicability: When it is difficult to identify bush snails by traditional taxonomic methods, the method of the present invention makes up for it with molecular biology techniques, thus obtaining a fluorescence quantitative PCR method for quickly, accurately and highly sensitively detecting bush snails. Therefore, this method has good practicability and can meet the need for rapid and reliable detection and identification of bush snails. Description of the Drawings
[0018] Figure 1 It is the specific amplification curve diagram of fluorescence quantitative PCR of bush snails in Example 1 of the specific implementation manner of the present invention; Figure 2 It is the sensitivity amplification curve diagram of fluorescence quantitative PCR of bush snails in Example 2 of the specific implementation manner of the present invention; Figure 3 It is the standard curve diagram of fluorescence quantitative PCR of bush snails in Example 2 of the specific implementation manner of the present invention. Specific Implementation Manner
[0019] To describe the technical content, achieved purpose and effects of the present invention in detail, the following is described in conjunction with the implementation manners and accompanied by the drawings.
[0020] The key concept of the primer set, kit and method for detecting bush snails in the present invention lies in: 1. The present invention is not affected by characteristics such as individual morphology, size, and integrity, avoiding the limitations existing in morphological identification, and can directly provide rich discrimination bases at the gene level to effectively distinguish interspecies differences. In actual work, as long as the personnel with basic molecular operation techniques can use the kit and method for detection and identification, and the operation is simple and reliable. The fluorescence quantitative PCR kit and method established in the present invention provide a new technical means for accurately detecting and identifying bush snails, filling the technical gaps in the domestic and international industries.
[0021] 2. The fluorescence PCR probe method of the present invention is used to identify the molecular characteristics of bush snails by designing specific primers, which cannot be achieved by existing conventional or published primers. The fluorescence PCR probe method of the present invention is adopted for bush snails for the first time, and there is no technical reference for related species identification methods, and it is difficult to screen and design the specific primers. The screened specific primers need to verify important parameters such as the complementarity of the primers themselves, the complementarity with the DNA template, the complementarity between the two primers, the GC content, and the melting temperature. Most importantly, it is necessary to scientifically design verification experiments according to the phylogenetic relationship of the species to ensure the uniqueness of the primers for bush snails, which is not obvious to those skilled in the art.
[0022] 3. The kit provided by the present invention has strong specificity, and only typical amplification curves appear for bush snails, and no amplification curves appear for other species. The detection takes a short time, the result judgment is accurate, and there is no need for post-PCR treatment, which can effectively avoid false positives and cross-contamination.
[0023] Example 1 1. Materials The test materials are as follows: bush snails, Bradybaena ravida ravida, Bradybaena similaris, Bradybaena kiangsiensis, Bradybaena similaris unibandata, Bradybaena sheni, Cathaica fasciola, Bradybaena brevispira, Helix aspersa.
[0024] The above test snails were intercepted or collected through national port quarantine, and after being confirmed by the Key Laboratory of Mollusk Quarantine and Identification of the General Administration of Customs, they were stored at -20°C for standby.
[0025] 2. Establishment of fluorescence quantitative PCR method 2.1. Design and synthesis of primers: It includes forward primer GCF1, reverse primer GCR1 and TaqMan probe GCP1; The sequence of the forward primer GCF1 is as follows: 5’- AGTTGGGACAGGGTTGTCAT -3’ (SEQ ID NO.1); The reverse primer GCR1 sequence is as follows: 5’- ACCTTATATCAGGAGCGCCAA -3’ (SEQ ID NO.2); The TaqMan probe GCP1 sequence is as follows: 5’-FAM-ACACCAGTATGGCCTAGCTCAAACCG–BHQ1-3’ (SEQ ID NO.3).
[0026] Based on the COI gene sequence of the bush snail, primers were designed and analyzed with the primer design software Primer Express3. After verifying their specificity by NCBI Blast, they were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.
[0027] The real-time fluorescence PCR detection kit for bush snails includes reaction mixture Ⅰ, reaction mixture Ⅱ, positive control, negative control, ddH 2 O, and an instruction manual. Reaction mixture Ⅰ is 2×GoTaq Probe qPCR Master Mix, which contains Taq DNA polymerase, substrate dNTP, and buffer; reaction mixture Ⅱ is the above primer set with a concentration of 10 μmol / L; the positive control is a recombinant plasmid containing the COI gene of the bush snail with a concentration of 100 ng / μL; the negative control does not contain the COI gene of the bush snail.
[0028] 2.2 DNA extraction: Extracted using the TIANGEN Tissue Genomic DNA Extraction Kit, and DNA was extracted according to the instruction manual. The concentration of DNA was measured with a NanoDrop ultra-micro nucleic acid and protein analyzer. If the DNA concentration is greater than 100 ng / μL, the DNA was diluted to 100 ng / μL with TE solution and stored at -20℃ for later use.
[0029] 2.3 Fluorescent quantitative PCR amplification reaction system: The total volume is 20 μL, including 10 μL of reaction mixture Ⅰ, 3 μL of reaction mixture Ⅱ, 2 μL of DNA template (concentration ≤100 ng / μL), and 5 μL of ddH 2 O. After mixing, it was put into a fluorescent quantitative PCR amplifier for amplification.
[0030] 2.4 The two-step amplification reaction program for fluorescent quantitative PCR is: pre-denaturation at 95℃ for 2 min; 95℃ for 15 s, 60℃ for 1 min, for 40 cycles; end the reaction.
[0031] The real-time fluorescence PCR detection method for bush snails includes the following steps: Extract the DNA of the sample; Use the above kit to perform fluorescent quantitative PCR detection on the sample and analyze and judge the results; After the fluorescence quantitative PCR reaction is completed, the results are analyzed and judged according to the amplification curve. The judgment method is as follows: Under the conditions that the Ct value of the positive control ≤ 30 and a typical amplification curve appears, and the blank control and negative control have no Ct value and no amplification curve, when a typical amplification curve appears in the test sample and the Ct value is less than or equal to 37, it is judged as positive; When the Ct value is equal to 40, it is judged as negative or the DNA template concentration is low. When the Ct value is greater than 37 and less than 40, it is judged as a suspected bush snail, and the DNA should be re-extracted for retesting. If the retested Ct value is equal to 40, it is judged as negative or the DNA template concentration is low; if the retested Ct value is less than 40 and a typical amplification curve appears, it is judged as positive.
[0032] 2.5. Specificity test results: Please refer to Figure 1 , Figure 1 for the fluorescence quantitative PCR specific amplification curve of the bush snail in Example 1; Among them: Curve 1 is the positive control, Curve 2 is the bush snail; Curve 3 is Bradybaena ravida ravida; Curve 4 is Bradybaena similaris; Curve 5 is Bradybaena kiangsiensis; Curve 6 is Bradybaena similaris; Curve 7 is Bradybaena shensiensis; Curve 8 is Cathaica fasciola; Curve 9 is Bradybaena brevispira; Curve 10 is Limax maximus; Curve 11 is the blank control.
[0033] Figure 1 In, under the conditions that the Ct value of the positive control ≤ 30 and a typical amplification curve appears, and the blank control and negative control have no Ct value and no amplification curve, only the bush snail shows a typical amplification curve on the fluorescence quantitative PCR instrument and the Ct value is less than 37, and no typical amplification curve appears in other samples, indicating that this method can be used for the specific detection of bush snails.
[0034] Example 2 According to the technical solution of Example 1, the detection sensitivity test of the real-time fluorescence PCR detection kit for bush snails is carried out.
[0035] The recombinant plasmid dry powder containing the COI gene of the bush snail is diluted with TE into different concentration gradients of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL and 1 fg / μL by the 10-fold concentration series dilution method.
[0036] Please refer to Figure 2, where Curve 1 is 100 ng / μL; Curve 2 is 10 ng / μL; Curve 3 is 1 ng / μL; Curve 4 is 100 pg / μL; Curve 5 is 10 pg / μL; Curve 6 is 1 pg / μL; Curve 7 is 100 fg / μL; Curve 8 is 10 fg / μL; Curve 9 is 1 fg / μL; Curve 10 is the negative control; Curve 11 is the blank control.
[0037] Fluorescent quantitative PCR amplification reaction system: The total volume is 20 μL, including 10 μL of Reaction Mixture Ⅰ, 3 μL of Reaction Mixture Ⅱ, 2 μL of DNA template, and 5 μL of ddH 2 O. After mixing, put it into a fluorescent quantitative PCR amplifier for amplification.
[0038] The two-step amplification reaction program of fluorescent quantitative PCR is: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 1 min, for 40 cycles; end the reaction.
[0039] Sensitivity test results: When the DNA concentration is 1 fg / μL, an amplification curve still appears, indicating that this method has high sensitivity, and the lower limit of detection sensitivity can reach 1 fg / μL ( Figure 2 ).
[0040] Please refer to Figure 3 , Figure 3 the standard curve shown in 11 -10 3 copies / mL range, the standard curve R 2 = 0.997 of the bush snail, and the logarithm of the reaction concentration has a good linear relationship with the number of cycles.
[0041] The above are only the embodiments of the present invention, and do not limit the patent scope of the present invention. All equivalent transformations made using the content of the specification and drawings of the present invention, directly or indirectly applied in the relevant technical fields, are equally included in the patent protection scope of the present invention.
Claims
1. A primer set for detecting bush snails, characterized in that: include: forward primer GCF1, reverse primer GCR1, and TaqMan probe GCP1; The forward primer GCF1 sequence is as follows: SEQ ID NO.1; The reverse primer GCR1 sequence is as follows: SEQ ID NO.2; The TaqMan probe GCP1 sequence is as follows: SEQ ID NO.
3.
2. The primer set for detecting bush snails according to claim 1, characterized in that: The TaqMan probe GCP1 is labeled with FAM at its 5' end and BHQ1 at its 3' end.
3. A kit for detecting scrub snails, characterized in that: The method comprises the primer set according to any one of claims 1 to 2, 2×GoTaq Probe qPCR Master Mix, a positive control, a negative control and ddH2O.
4. A method for detecting bush snails, characterized in that: include: Extract DNA from samples; Using the kit described in claim 2 to perform fluorescent quantitative PCR on the sample DNA; When the positive control Ct value is ≤30 and a typical amplification curve appears, and the blank control and negative control have no Ct value and no amplification curve; When the sample to be tested shows a typical amplification curve and the Ct value is less than or equal to 37, it is judged as positive; When the Ct value is equal to 40, it is judged as negative or the DNA template concentration is low; When the Ct value was greater than 37 and less than 40, it was determined to be a suspected bush snail; When it is determined to be a suspected bush snail, DNA is re-extracted for retesting; If the retest Ct value is equal to 40, it is judged as negative or the DNA template concentration is low; if the retest Ct value is less than 40 and a typical amplification curve appears, it is judged as positive.
5. The method for detecting bush snails according to claim 4, characterized in that: The fluorescence quantitative PCR program is: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 1 min, 40 cycles; end the reaction.
Citation Information
Patent Citations
A method for detecting and identifying forest onion snails by fluorescent quantitative PCR
CN109182555A
Method for detecting and identifying topspin tooth snails by fluorogenic quantitative PCR
CN109486968A
Five-fold real-time fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for simultaneously detecting five parasites as well as special primer and probe of five-fold real-time fluorescent quantitative PCR detection kit
CN119372304A
Primers for synthesising full-length cDNA and their use
EP1074617A2