SNP molecular marker of PSMC2 gene associated with African swine fever virus antibody level, primer and application

Abstract

The invention relates to the technical field of molecular markers, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker associated with an African swine fever virus antibody level, a primer and application. The SNP molecular marker is located at the upstream 22bp position of a transcription start site of a pig PSMC2 gene with the gene version number of NM001245008.1, and has G / A polymorphism. The SNP molecular marker provided by the invention is closely associated with the African swine fever virus antibody level of the pig, and compared with the pig with the genotype of GA and AA at the site, the pig with the genotype of GG has higher African swine fever virus antibody level in serum; the SNP molecular marker can be used for identifying high-quality boars resistant to African swine fever virus, so that the breeding efficiency of the boars is improved, and the economic benefit of breeding the boars is effectively improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to SNP molecular markers, primers related to the antibody level of African swine fever virus, and their applications. Background Art

[0002] African swine fever (ASF) is a highly contagious disease of pigs caused by infection with African swine fever virus (ASFV). Clinically, it is manifested as high fever, depression, anorexia, skin cyanosis, and bleeding in various organs. This disease poses a serious threat to the pig industry.

[0003] At present, there are still certain difficulties in the development of vaccines against African swine fever virus. Although traditional inactivated vaccines have relatively high safety, their immunogenicity is poor, and they cannot form a complete protective effect after vaccination. The detection of ELISA antibody levels can accurately and timely understand the virus antibody levels in pigs, judge the immune level of the pig herd, and thus help formulate prevention and control measures for African swine fever. Research shows that p72 and p30 proteins are important antigen proteins that can cause humoral immune responses during the infection process of African swine fever virus. Antibodies against the p72 protein can prevent virus adsorption, and antibodies against the p30 protein can prevent virus endocytosis. Therefore, these proteins are often used as important markers for the serological diagnosis of African swine fever virus and the development of vaccines.

[0004] High expression of the p30 protein can be observed 2 to 4 hours after infection with African swine fever virus, and it can persist throughout the virus infection cycle. p30 antibodies can be detected 8 - 12 days after infection with African swine fever virus, about 1 week earlier than the detection time of other protein antibodies, which can be used to judge the early virus infection situation, but its duration is short and the antibody level decreases rapidly. The expression of the p72 gene occurs in the late stage of virus infection and is regulated by the late virus promoter. p72 antibodies can be detected on the 17th day after infection with African swine fever virus. Its duration is long and the antibody level is high, which is a sign of persistent virus infection or established immunity. After pigs are vaccinated with inactivated African swine fever vaccines, there are significant differences in the antibody levels of African swine fever virus produced. Approximately 67% of individuals have relatively high levels and can provide complete protection, while the rest have relatively low levels and cannot provide complete protection. Therefore, it is necessary to explore SNP molecular markers of genes related to antibody formation and apply them to the breeding of breeding pigs with high African swine fever virus antibody levels. SNP molecular marker-assisted selection related to antibody levels is one of the possible ways to prevent the spread of African swine fever. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides SNP molecular markers, primers of the PSMC2 gene related to the antibody level of African swine fever virus, and their applications, in order to provide new technical means for the genetic improvement of breeding pigs.

[0006] The present invention firstly provides an SNP molecular marker of the PSMC2 gene associated with the African swine fever virus antibody level and the application of this marker in the identification of breeding pigs; secondly, it provides a primer set for amplifying the SNP molecular marker of the PSMC2 gene associated with the African swine fever virus antibody level, the application of the primer set, and a specific application method.

[0007] In the first aspect of the present invention, an SNP molecular marker of the PSMC2 gene associated with the African swine fever virus antibody level is provided. The SNP molecular marker is located 22 bp upstream of the transcription start site of the porcine PSMC2 gene with the gene version number NM_001245008.1, and has G / A polymorphism; the frequency of the G allele is greater than that of the A allele.

[0008] Preferably, the nucleotide sequence of the promoter region of the porcine PSMC2 gene is as shown in SEQ ID NO.1:

[0009] TGACCATCGTTATCACTGTATGGCAGCAGGCTCAAAAATTGAAACCACCTACTTTCTCATCCCTTGTTAACATCAAATTAATGAACAACTCCTATTTACCTTCACTCTATTTGTAAATCTAGCCCGTACTCATCGCGTAACTAATTATGCTACGTACTTCACACTGTTATTTTATGCACCCACAATGCTGTGAGTTCACGGGGAAATTAACACCAAAATTCAAGAAATTACCCAAGAGTACAGAGTAAATGATTAAAGCAGGATTTAAACTCAGCACCTGAGCCTGAGTTGGTCTTGAAATCTGTTGCTCGGGGAACTGCCCATGGTGCGGGACCAGGTTAGACCTTAGACCAACGCTTCCTTCCAACAGGAAATCCCACGTACTGTCATTAACTGCGATCTGAAGCCAGCGCGGGTCCAGAGCGCTCTTCCGCCTGGCGCGGCTGTAAAAGGGCCCGCAGATCCAGCTTTACTTCCGGTGGGGAAGGGAGAGGGAGGG.

[0010] Preferably, the antibody level is the antibody level of the p72 protein.

[0011] In the second aspect of the present invention, a primer set for amplifying the SNP molecular marker of the PSMC2 gene associated with the African swine fever virus antibody level is provided. The nucleotide sequence of the upstream primer of the primer set is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3:

[0012] SEQ ID NO.2: CTAGCCCGTACTCATCGCGTA.

[0013] SEQ ID NO.3: TAGCCCCACAAAAGCGACGGA.

[0014] In the third aspect of the present invention, a kit for detecting the genotype of the SNP molecular marker of the PSMC2 gene associated with the African swine fever virus antibody level is provided. The kit contains the primer set described in the second aspect of the present invention.

[0015] Furthermore, the kit further includes a DNA extraction reagent, a DNA purification reagent, a PCR reaction reagent, an agarose solution, an electrophoresis buffer, and a staining solution.

[0016] In the fourth aspect of the present invention, an application of the above-mentioned SNP molecular marker, the above-mentioned primer set, or the above-mentioned kit in the identification of breeding pigs is provided.

[0017] In the fifth aspect of the present invention, a method for identifying breeding pigs is provided, including the following steps:

[0018] Using porcine genomic DNA as a template, PCR amplification is carried out using the primer set described in the second aspect of the present invention to obtain a PCR product.

[0019] The PCR product is subjected to agarose gel electrophoresis and sequencing.

[0020] It is detected that the African swine fever virus antibody level in the serum of breeding pigs with the GG genotype of the G / A polymorphism at 22 bp upstream of the transcription start site of the porcine PSMC2 gene is higher than that in the serum of breeding pigs with the GA or AA genotype.

[0021] Furthermore, the reaction system for PCR amplification is as follows.

[0022] 2×Taq Master Mix 10 μL, DNA template 1 μL, upstream primer 0.5 μL, downstream primer 0.5 μL, ddH 2 O 8 μL.

[0023] Furthermore, the reaction program for PCR amplification is as follows.

[0024] Pre-denaturation at 93 - 95°C for 5 min; denaturation at 93 - 95°C for 30 s, annealing at 57 - 60°C for 20 s, extension at 72°C for 20 s, with 39 cycles; extension at 72°C for 5 min, store at 4°C.

[0025] In summary, compared with the prior art, the present invention has the following advantages and effects:

[0026] The present invention provides an SNP molecular marker associated with the antibody level of African swine fever virus. The SNP molecular marker is located 22 bp upstream of the transcription start site of the porcine PSMC2 gene with the gene version number of NM_001245008.1 and has G / A polymorphism. By deeply studying the key genes in the porcine antigen presentation pathway, the present invention first provides a new locus significantly related to the antibody level of African swine fever virus. Through verification, it is found that the G / A mutation at 22 bp upstream of the transcription start site of the PSMC2 gene is negatively correlated with the antibody level of African swine fever virus in porcine serum.

[0027] The SNP molecular marker provided by the present invention can be applied to the identification and selection of African swine fever-resistant breeding pigs, which is beneficial to improving the breeding efficiency of breeding pigs, enhancing the health level of animals, and reducing unnecessary breeding costs and time costs. In addition, the molecular marker provided by the present invention also has important scientific value for studying the molecular mechanism affecting the antibody level of African swine fever virus. Description of the Drawings

[0028] Figure 1 For the correlation analysis of the expression level of the target gene of MECP2 in lymph nodes and the MECP2 binding site; Figure 1 In the figure, Figure A is the weighted image of the transcription factor binding site (Gene-set), and the blue curve in the figure represents the weighted function of each transcription factor binding site; Figure B is the weighted image of the gene expression level (Gene-list), and the blue curve in the figure represents the weighted function of each gene expression level; Figure C is the image of the correlation analysis of the unweighted gene expression level and the unweighted transcription factor binding site. The blue curve in the figure is the unweighted fitting curve of the transcription factor binding site score and the gene expression level; Figure D is the image of the correlation analysis of the weighted gene expression level and the weighted transcription factor binding site. The blue curve in the figure is the weighted fitting curve of the transcription factor binding site score and the gene expression level. The green dots represent the two-dimensional distribution of the binding site score and the gene expression level of the target gene of MECP2, and the diameter size of the green dots represents the level of the weighted value.

[0029] Figure 2 For the comparison of the sequencing results of 3 pigs with different PSMC2 genotypes; the G-22A mutation site is shown in the yellow box, and the MECP2 binding site of the PSMC2 gene is shown in the blue box.

[0030] Figure 3 The figure showing the effect of the G-22A mutation site of the PSMC2 gene on the African swine fever virus antibody level trait;

[0031] Figure 3 Among them, Figure A shows the effect of the G-22A mutation of the PSMC2 gene on the p72 antibody level; Figure B shows the effect of the G-22A mutation of the PSMC2 gene on the p30 antibody level; the vertical coordinate in the figure is the African swine fever virus antibody level (S / N), the horizontal coordinate is the genotype, and a, b, and c respectively represent the groups of multiple comparison results. Different letters indicate significant differences between groups, p<0.05. Detailed implementation manners

[0032] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings.

[0033] In the description of the present invention, unless otherwise specified, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0034] Antigen presentation is closely related to traits such as the antibody level, disease resistance ability, and health level of animals. SNP molecular marker-assisted selection is an important means in modern domestic pig breeding projects. Since relatively few SNP molecular markers directly related to the African swine fever virus antibody level trait have been developed currently, it has restricted the application of SNP molecular marker breeding technology in the improvement of African swine fever-resistant breeding pigs.

[0035] The present invention first uses transcriptome sequencing and Grit / Flaver software analysis to discover the differentially expressed transcription factor MECP2 related to African swine fever virus infection. And PSMC2 is one of the key target genes of MECP2, and the function of PSMC2 is related to antigen presentation. By comparing the re-sequencing data of 30 Duroc×Landrace×Yorkshire pigs, it is found that there is G / A polymorphism at 22 bp upstream of the transcription start site of the PSMC2 gene of pigs. Primers are designed for this specific region and sequence amplification is carried out. After sequencing, it is found that the genotype frequency of the PSMC2 gene at this SNP site shows a trend of GG>GA>AA. Subsequently, it is verified that the SNP molecular marker provided by the present invention is negatively correlated with the African swine fever antibody level in pig serum and is easy to detect.

[0036] Example 1. Obtaining of the PSMC2 gene fragment and SNP molecular marker

[0037] Transcriptome sequencing was performed on three African swine fever virus-infected pigs and three control pigs. The expression levels of infected / control genes were compared based on the transcriptome results, and the expression level measurement value of each differentially expressed gene was calculated. The weighted Kendall correlation statistics of Grit / Flaver software were used to detect the correlation between the expression level of each differentially expressed gene and the binding sites of the target genes acted by various transcription factors in pigs.

[0038] The results are as follows Figure 1 As shown in the figure, for target genes containing MECP2 binding sites, the higher the score of the binding site, the higher the expression level, and the expression level is significantly positively correlated with the score of the transcription factor binding site, p < 0.05. Among them, the target gene PSMC2 of MECP2 is one of the key genes involved in antigen presentation.

[0039] The resequencing data of 30 Duroc × Landrace × Large White pigs were compared, and it was found that the promoter region of the PSMC2 gene of the pig had a G / A polymorphism 22bp upstream of the transcription start site. Three individuals with different genotypes were selected for sequencing using the Sanger method. The comparison results are as follows Figure 2 As shown, the yellow box indicates the G-22A mutation site, and the blue box indicates the binding site of MECP2.

[0040] Blood samples from 206 African swine fever virus-positive pigs were collected from a farm in Jingzhou City, Hubei Province. Whole genome DNA was extracted from the 206 blood samples using a peripheral blood DNA extraction kit (purchased from Beijing Solebow Company).

[0041] According to the PSMC2 gene nucleotide sequence published in the GenBank database, the gene version number of the PSMC2 gene is NM_001245008.1, the promoter region of the PSMC2 gene was compared online, specific primers for this region were designed using Oligo software, and PCR amplification reaction was performed using 206 genomic DNAs of the tested individuals as templates. The nucleotide sequence of the promoter region of the PSMC2 gene is shown in SEQ ID NO.1.

[0042] SEQ ID NO.1:

[0043] TGACCATCGTTATCACTGTATTGGCAGCAGGCTCAAAAATTGAAACCAC

[0044] CTACTTTCTCATCCCTTGTTAACATCAAATTAATGAACAACTCCTATTTACC

[0045] TTCACTCTATTTGTAAATCTAGCCCGTACTCATCGCGTAACTAATTATGCTA

[0046] CGTACTTCACACTGTTATTTTATGCACCCACAATGCTGTGAGTTCACGGGG

[0047] AAATTAACACCAAAATTCAAGAAATTACCCAAGAGTACAGAGTAAATGAT

[0048] TAAAGCAGGATTTAAACTCAGCACCTGAGCCTGAGTTGGTCTTGAAATCT

[0049] GTTGCTCGGGGAACTGCCCATGGTGCGGGACCAGGTTAGACCTTAGACCA

[0050] ACGCTTCCTTCCAACAGGAAATCCCACGTACTGTCATTAACTGCGATCTGA

[0051] AGCCAGCGCGGGTCCAGAGCGCTCTTCCGCCTGGCGCGGCTGTAAAAGGGCCCGCAGATCCAGCTTTACTTCCGGTGGGGAAGGGAGAGGGAGGG。

[0052] The upstream primer sequence of the PSMC2 gene is shown as SEQ ID NO.2; the downstream primer sequence is shown as SEQ ID NO.3.

[0053] SEQ ID NO.2: CTAGCCCGTACTCATCGCGTA.

[0054] SEQ ID NO.3: TAGCCCCACAAAAGCGACGGA.

[0055] Table 1 shows the specific parameters of the PCR reaction system.

[0056] Table 1 PCR reaction system

[0057] Component Content, μL 2×TaqMasterMix 10 Forward primer, 10 μM 0.5 Reverse primer, 10 μM 0.5 DNA template 1.0 <![CDATA[ddH 2 O]]> 8.0

[0058] Table 2 shows the PCR amplification program.

[0059] Table 2 PCR amplification program

[0060]

[0061] Take 4 μL from each tube of PCR products for agarose gel electrophoresis. After imaging, the PCR products containing a single band were sent to Shanghai Bioengineering Co., Ltd. for sequencing. The SeqMan software was used to compare and analyze the sequencing results, find the mutation sites in the sequences, and record the mutation types of the corresponding site A-22G in each individual.

[0062] The G-22A mutation site of the PSMC2 gene showed three genotypes in 206 pigs to be tested, with genotype frequencies of GG: 0.84; GA: 0.13; AA: 0.03, showing a trend of GG>GA>AA, and the frequency of allele G was 0.92, and the frequency of allele A was 0.08. The frequency of the G allele was greater than that of the A allele.

[0063] Example 2. Verification of SNP molecular markers related to African swine fever virus antibody levels

[0064] To establish the relationship between the PSMC2 gene and the trait of African swine fever virus antibody levels in pigs, enzyme-linked immunosorbent assay was used to measure the antibody levels of African swine fever virus p72 and p30 in 206 blood samples in Example 1. The results were expressed as S / N values (sample OD450nm value / average OD450nm of negative control). The larger the S / N value, the lower the antibody level. The results showed that the antibody levels of p72 in 153 breeding pigs were relatively high, and those in 53 breeding pigs were relatively low. The antibody level of p30 was lower than that of p72.

[0065] The ANOVA program in R 4.1 software was used to perform a correlation analysis on the SNP sites of the PSMC2 gene and the data of African swine fever virus antibody level traits. The results are as Figure 3 shown. The S / N value of the African swine fever virus p72 antibody in the serum of pigs with the GG genotype was 0.46±0.05, that of the GA genotype was 0.50±0.06, and that of the AA genotype was 0.63±0.05. There were significant differences in the p72 antibody levels in the serum of GG>GA>AA, p<0.05; the S / N value of the African swine fever virus p30 antibody in the serum of pigs with the GG genotype was 0.50±0.05, that of the GA genotype was 0.53±0.06, and that of the AA genotype was 0.60±0.07. The p30 antibody levels in the serum of each genotype of pigs were not high.

[0066] The overall level of the p30 antibody was relatively low, and there was a significant gap compared with the p72 antibody level. This difference may be related to the relatively weak immunogenicity of the p30 antigen or the relatively low antibody production efficiency. Given that the p72 antibody level is higher and more stable, and can more accurately reflect the true situation of the immune response, therefore, the present invention selects the p72 antibody level as the correlation index to improve the reliability of the molecular marker.

[0067] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0068] The above-described embodiments only express several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A SNP molecular marker associated with the level of antibodies to African swine fever virus, characterized in that: The SNP molecular marker is located 22 bp upstream of the transcription start site of the pig PSMC2 gene with the gene version number NM_001245008.1, and has a G / A polymorphism.

2. The SNP molecular marker associated with the level of African swine fever virus antibodies according to claim 1, characterized in that: The nucleotide sequence of the promoter region of the porcine PSMC2 gene is shown in SEQ ID NO.

1.

3. The SNP molecular marker associated with the level of African swine fever virus antibodies according to claim 1, characterized in that: The antibody level is the antibody level of p72 protein.

4. A primer set for amplifying the SNP molecular marker associated with the African swine fever virus antibody level according to claim 1, characterized in that: The nucleotide sequence of the upstream primer of the primer set is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

5. A kit for detecting the SNP molecular marker genotype associated with the African swine fever virus antibody level according to claim 1, characterized in that: The kit comprises the primer set according to claim 2.

6. The kit according to claim 5, characterized in that The kit also includes a DNA extraction reagent, a DNA purification reagent, a PCR reaction reagent, an agarose solution, an electrophoresis buffer solution, and a staining solution.

7. Use of the SNP molecular marker associated with African swine fever virus antibody level according to claim 1, the primer set according to claim 4 or the kit according to claim 5 in breeding of breeding pigs.

8. A method for identifying a breeding pig, characterized in that: The following steps are involved: Performing PCR amplification on a pig DNA template using the primer set described in claim 4 to obtain a PCR product; Performing agarose gel electrophoresis and sequencing on the PCR product; It was detected that the G / A polymorphism at 22 bp upstream of the transcription start site of the pig PSMC2 gene had a higher African swine fever virus antibody level in sows with the GG genotype than in sows with the GA or AA genotype.

9. The method according to claim 8, characterized in that The reaction system for PCR amplification was: 2×TaqMasterMix 10 μL, DNA template 1.0 μL, upstream primer 0.5 μL, downstream primer 0.5 μL, and ddH2O 8.0 μL.

10. The method according to claim 8, characterized in that The reaction procedure of PCR amplification was as follows: pre-denaturation at 93°C-95°C for 5 min; denaturation at 93°C-95°C for 30 s, annealing at 57°C-60°C for 20 s, extension at 72°C for 20 s, 39 cycles; extension at 72°C for 5 min, and storage at 4°C.

Images