Method for detecting carcass and meat quality traits of cattle by using GOT2 gene genetic marker

Abstract

The invention discloses a detection method for detecting carcass and meat quality characters of cattle by using a GOT2 gene marker, which is a method for screening GOT2 gene mutation sites in a Chinese Simmental cattle population and analyzing genotypes of the GOT2 gene mutation sites of Chinese Simmental cattle individuals by combining a PCR (Polymerase Chain Reaction) technology and a first-generation DNA (Deoxyribose Nucleic Acid) sequencing technology. The SNP from A to C of 25bp in the 3 'UTR region of the GOT2 gene is screened, and it is found that the SNP is remarkably related to the economic characters such as the slaughter rate, the liver weight, the waist meat thickness, the backfat and the carcass fat coverage rate of the Simmental cattle, so that the carcass and meat quality characters of corresponding cattle individuals are further evaluated. The method belongs to the technical field of molecular biology, can be applied to early selection and molecular pyramiding breeding of beef cattle, and further accelerates breeding and improvement of the performance of Chinese Simmental beef.

Description

Technical Field

[0001] The present invention discloses a method for detecting beef carcass meat quality traits using the GOT2 gene genetic marker, and particularly relates to a method for detecting 9 trait molecular markers including slaughter rate, hind hoof weight, hide weight, liver weight, kidney fat, penis, loin meat thickness, backfat, and carcass fat coverage rate of Simmental cattle through SNPs in the 3' untranslated region (UTR) sequence of the GOT2 gene, belonging to the technical field of breeding prediction and breeding of beef carcass and meat quality traits. Background Art

[0002] Beef has higher nutritional value and price. Beef is rich in protein, iron, zinc, vitamin B, essential amino acids and polyunsaturated fatty acids, which better meet the nutritional needs of the human body. The deficiencies in the cattle breeding industry mainly include uneven breeding technology levels, backward breeding levels of excellent breeds, low production levels, and imbalance between market demand and supply. Among them, how to breed excellent beef cattle breeds is the key and difficult point that needs to be solved urgently at present.

[0003] As a third-generation molecular marker-assisted selection technology, SNP is widely used. It can be used as a molecular marker and is suitable for constructing genetic maps; it can be used as molecular marker-assisted selection and applied to the breeding improvement of animal and plant populations; in population evolution research, it can promote phylogenetic analysis and population genetics research; in kinship identification, it can be used to protect species genetic diversity and construct molecular pedigrees. As a rich genetic marker, SNP provides a tool for evaluating genetic diversity, constructing genetic maps and gene mapping. SNP has been widely used in beef cattle breeding, and PCR-RFLP is one of the classic detection methods among them. In recent years, the research on beef cattle breeding has developed rapidly, and many SNPs have been proven to be related to the growth, meat production, reproduction and disease resistance of beef cattle.

[0004] Glutamate-oxaloacetate transaminase 2 (GOT2) gene is located on chromosome 18 of cattle, and the number of exons is 11. GOT2 is mainly expressed in metabolically active organs such as the heart, liver, and kidneys. It participates in the metabolic process of amino acids. Especially in the processes of amino acid oxidation and synthesis, it can catalyze the transamination reaction between glutamate and oxaloacetate to generate α-ketoglutarate and aspartate. This reaction is an important link in the tricarboxylic acid cycle and is crucial for maintaining the balance of amino acids and the normal progress of metabolism. The main role of GOT2 in the body is to regulate various metabolic pathways and signal pathways. In the malate-aspartate shuttle (MAS) pathway and the tricarboxylic acid cycle (TCA), GOT2 transports the reducing equivalent (NADH) in the cytoplasm to the mitochondria to support the electron transport chain and ATP production in the mitochondria. In lipid metabolism, an important function of GOT2 is to participate in the transport process of fatty acids, which can promote the uptake of long-chain free fatty acids by cells. It can be known that the role of GOT2 is not limited to catalyzing the transamination reaction between glutamate and oxaloacetate, and it also undertakes the important function of participating in fatty acid transport. Summary of the Invention

[0005] The present invention provides a method for detecting bovine carcass and meat quality traits using the genetic marker of the GOT2 gene. Using the GOT2 gene marker as a method for predicting and selecting 9 traits including beef cattle slaughter rate, hind hoof weight, skin weight, liver weight, kidney fat, bullwhip, lumbar muscle thickness, back fat, and carcass fat coverage rate, it lays a foundation for the early selection of genetic workers and the improvement of meat quality, thereby further improving the economic benefits of beef cattle breeding.

[0006] The present invention provides a method for detecting bovine carcass and meat quality traits using the genetic marker of the GOT2 gene, characterized in that: 1. The molecular marker of the above gene is the A / C mutation at the 25th bp of the 3' untranslated region (UTR) of the bovine GOT2 gene, that is, SNP1: 3'UTR-25 A>C.

[0007] The method for detecting bovine carcass and meat quality traits using the genetic marker of the GOT2 gene described in the present invention includes the following steps: The first step: Collect whole blood or tissue samples of the cattle to be detected, and extract genomic DNA using the whole blood or tissue samples of the cattle. The second step: A pair of primers designed according to the bovine GOT2 gene sequence are as follows: GOT2-F: 5’ GCTAACACACCAAACTCTAGGAAT3’; GOT2-R: 5’ GAGGAAAGGAACAGCAGTGATTA3’; Step 3: Using bovine genomic DNA as a template, perform PCR amplification with the primers synthesized in the previous step to obtain a PCR product containing the target fragment of the bovine GOT2 gene; PCR reaction system: 12.5 μL of Taq PCR Mix, 0.25 μL each of the upstream primer and the downstream primer, 1 μL of pooled DNA / individual DNA, 11 μL of deionized water, a total of 25 μL, mix well for PCR amplification; PCR reaction program: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, cycle 35 times; extension at 72°C for 10 min; store at 4°C; use agarose gel electrophoresis to check the fragment length and quality of the PCR amplification product, and store at 4°C or -20°C for standby; Step 4: Use DNA sequencing technology to sequence the PCR product, use sequence analysis software to find the position of the SNP locus in the 3’ untranslated region of the GOT2 gene in the sequencing results, and perform genotype analysis on the detected bovine population or individual samples according to the molecular marker SNP1 of the GOT2 gene, namely AA genotype, AC genotype or CC genotype. Finally, evaluate and predict 9 traits including beef cattle dressing percentage, hind hoof weight, hide weight, liver weight, kidney fat, bullwhip, loin muscle thickness, backfat, and carcass fat coverage rate through the genotype.

[0008] The positive effects of the present invention are as follows: Through PCR amplification using bovine genomic DNA pooled or individual DNA as a template and detection by DNA sequencing method, 1 SNP1 locus is disclosed, and based on the genotyping of each individual's SNP1 and the correlation analysis results of bovine carcass and meat quality traits, a molecular marker capable of early screening and predicting bovine carcass and meat quality traits at the DNA level is provided, which is applied to molecular breeding and early selection of beef cattle; the present invention uses SNP1 of the GOT2 gene, namely 3’UTR-25 A>C, as a method for detecting genetic markers of economic traits such as backfat thickness and loin muscle thickness of beef cattle, laying a foundation for genetic breeding research and early selection of high-quality cattle individuals in production and feeding and improving beef quality and carcass traits. Description of the Drawings

[0009] Figure 1 It is the 1% agarose gel electrophoresis diagram of the PCR product of the Chinese Simmental cattle GOT2 gene in the embodiment of the present invention (Note: 1-7 are partial PCR products of the GOT2 gene; M: DL8000 Marker); Figure 2 It is the sequencing detection diagram of the 3’UTR-25 A>C mutation site of the GOT2 gene (Note: A. AA genotype; B. AC genotype; C. CC genotype). Specific embodiments

[0010] The present invention is further described by the following examples, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or change that is easily achieved by those of ordinary skill in the art will fall within the scope of the claims of the present invention. Example 1

[0011] 1. Test reagents and analysis software Agarose (BIOWEST); Genomic Blood Extraction Kit, 2×Green Taq mix, and DNA Marker 8000 were purchased from TIANGEN Company; PCR primer design software: Primer Premier 6.0; Data analysis software: IBM SPSS statistics 25.0; Sequence analysis software: Chromas.

[0012] 2. Test methods Taking the Chinese Simmental cattle population as the detection object, a large cattle farm in Wulagai area of Inner Mongolia was selected, and samples were collected by venous blood sampling; The genomic DNA of Chinese Simmental cattle blood was extracted using the TIANGEN Company's Blood Genomic DNA Extraction Kit, and a total of 281 DNA samples of cattle individuals were obtained and numbered; For the extraction of genomic DNA, the operation was carried out according to the instructions of the TIANGEN Company's Blood Genomic DNA Extraction Kit. Finally, the quality of genomic DNA was detected by 1% agarose gel electrophoresis, and the genomic DNA was stored at -80°C for later use; Primer synthesis and PCR amplification were synthesized by Sangon Biotech Co., Ltd.; The primer sequences are as follows: GOT2-F: 5’ GCTAACACACCAAACTCTAGGAAT 3’; GOT2-R: 5’ GAGGAAAGGAACAGCAGTGATTA 3’; PCR amplification was carried out using the synthesized GOT2 gene primers: The reaction system was a 25 μL system, as shown in Table 1; Table 1: PCR reaction system:

[0013] The reaction program was: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min, and finally stored at 4°C; Sequencing analysis of PCR amplification products Using Sanger sequencing technology, the PCR amplification products of different templates were mixed and sequenced. The sequencing result peak map was viewed using sequencing analysis software to find out whether there was an A / C mutation at the 25 bp position of the 3'UTR of the GOT2 gene. If this mutation site existed in the population, each bovine DNA sample was separately subjected to PCR amplification, and the reaction system and reaction program were the same as those for pooled amplification. After DNA sequencing, the genotypes of the sequencing results of each PCR product were analyzed to determine the genotypes of the SNP1 locus of each bovine individual.

[0014] Statistical analysis The genotype data obtained by the above method were statistically analyzed with the corresponding meat quality and carcass traits of Chinese Simmental cattle individuals. SPSS 25.0 was used to conduct an association analysis between individual genotypes and meat quality and carcass traits. p <0.05 was defined as a significant difference. p <0.01 was defined as an extremely significant difference.

[0015] 3. Results A PCR product containing the GOT2 gene sequence with a length of 937 bp was obtained by PCR amplification. The results of 1% agarose gel electrophoresis showed that the PCR amplification product was consistent with the expected fragment size. Part of the electrophoresis results are shown as follows Figure 1 . According to the PCR sequencing results of the GOT2 product, 1 SNP locus SNP1 of the GOT2 gene was found in the Chinese Simmental cattle population, that is, an A>C mutation site at the 25 bp position of the 3'UTR. Through the analysis of the sequencing results of each bovine individual's PCR product, among the detected Chinese Simmental cattle population, the SNP1 analysis results showed that there were 151 AA wild-type individuals, 116 AC-type individuals, and 14 CC-type individuals. The peak map results of the two genotypes are shown as follows Figure 2 . SPSS 25.0 software was used to verify the correlation between SNP1 of the GOT2 gene and the meat quality and carcass traits of Simmental cattle. The results showed that there was a significant correlation between the SNP1 locus of the GOT2 gene and 9 meat quality and carcass-related traits including the dressing percentage, hind hoof weight, skin weight, liver weight, kidney fat, bullwhip, loin muscle thickness, backfat, and carcass fat coverage rate of Chinese Simmental cattle ( p <0.05), as shown in Table 2: Table 2: Correlation analysis between SNP1 of GOT2 gene and meat quality and carcass traits of Chinese Simmental cattle

[0016] Note: Different capital letters for the same trait indicate extremely significant differences ( p <0.01), and different lowercase letters indicate significant differences (p <0.05).

[0017] Genetic analysis and verification results of the 3'UTR of the GOT2 gene in 281 Chinese Simmental cattle showed that SNP1 of the GOT2 gene, namely 3'UTR-25 A>C, was significantly associated with 9 important meat quality and carcass traits including cattle slaughter rate, hind hoof weight, hide weight, liver weight, kidney fat, etc. Among them, the slaughter rate, liver weight, kidney fat, loin meat thickness, back fat and carcass fat coverage rate of individuals with the AA genotype were the largest, and the hind hoof weight, hide weight and bull whip weight of the CC genotype were larger. This molecular marker can be used for early screening and prediction of cattle carcass and meat quality traits at the DNA level, as well as for molecular breeding of cattle with excellent traits.

Claims

1. A method for detecting cattle carcass and meat quality traits using a GOT2 gene marker, characterized in that: The single nucleotide polymorphism site of the above gene is 25 bp of the 3'UTR of the bovine GOT2 gene, and the single nucleotide polymorphism site is SNP1: 3'UTR-25 A>C.

2. A method for detecting cattle carcass and meat quality traits using a GOT2 gene marker, characterized in that: A pair of primers designed based on the bovine GOT2 gene sequence are as follows: GOT2-F:5'GCTAACACACCAACTCTAGGAAT3'; GOT2-R: 5' GAGGAAAGGAACAGCAGTGATTA 3'.

3. A method for detecting cattle carcass and meat quality traits using a GOT2 gene marker, comprising the following steps: Step 1: Collect whole blood or tissue samples from the cattle to be tested, and use the whole blood or tissue samples to extract genomic DNA; Step 2: synthesizing primers according to the sequence provided in claim 2; Step 3: Using the bovine genomic DNA as a template, PCR amplification was performed using the primers synthesized in the previous step to obtain a PCR product containing the target fragment of the bovine GOT2 gene; PCR reaction system: Taq PCR Mix 12.5 μL, upstream primer and downstream primer 0.25 μL each, pooled DNA / individual DNA 1 μL, deionized water 11 μL, a total of 25 μL fully mixed for PCR amplification; PCR reaction program: 95℃ pre-denaturation 5min, 95℃ denaturation 30s, 55℃ annealing 30s, 72℃ extension 30s, 35 cycles; extension 72℃ 10 min; 4℃ storage; agarose gel electrophoresis to check the length and quality of PCR amplification product fragments, 4℃ or -20℃ for use; Step 4: DNA sequencing technology is used to sequence the PCR products, and sequence analysis software is used to find the location of the SNP site in the 3' untranslated region of the GOT2 gene in the sequencing results. According to the molecular marker SNP1: 3'UTR-25 A>C of the GOT2 gene in claim 1, genotype analysis is performed on the tested cattle population or individual samples, namely, AA genotype, AC genotype and CC genotype, and finally genotypes are used to evaluate and predict 9 traits including cattle slaughter rate, hind hoof weight, skin weight, liver weight, kidney fat, bullwhip, loin meat thickness, back fat, and carcass fat coverage.

Images