Indel molecular marker for identifying ricefield eel strain and application of Indel molecular marker
By developing Indel molecular markers and using specific nucleic acid sequences for PCR amplification, the problem of targeted screening of eel lines in different regions was solved, and rapid identification and precise breeding of eel lines were achieved.
Patent Information
- Application Number
- CN202510533873.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-27
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-04-27
AI Technical Summary
The existing technology lacks effective methods to targeted screening of eel lines in different regions, resulting in serious damage to the genetic resources of wild eels.
An Indel molecular marker was developed to PCR amplify the eel genomic DNA through specific nucleic acid sequences (SEQ ID NO:3 and SEQ ID NO:4) to accurately identify eel lines in Jiangxi and non-Jiangxi regions.
The rapid identification of eel strains has been achieved, helping to accelerate the domestication and breeding of wild germplasm resources and achieve precise breeding.
Smart Images

Figure CN120060500A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of aquaculture molecular breeding, and particularly relates to an Indel molecular marker for identifying the strains of Monopterus albus, and its application, which is particularly suitable for identifying the strains of Monopterus albus in Jiangxi region and non-Jiangxi region. Background Art
[0002] Monopterus albus, belonging to Synbranchiformes, Synbranchidae, and Monopterus, is widely distributed in paddy fields, swamps and mud ponds in East Asia, South Asia and Southeast Asia. It has many advantages such as good taste, high nutritional value and prominent flavor, and is known as one of the "characteristic freshwater fish" with economic value in China due to its commercial importance and delicious meat. At present, the resource output is in short supply and the price is high, and its market potential is huge. Jiangxi region belongs to the middle reaches of the Yangtze River Basin, with many natural water systems and criss-crossing artificial canals, making this area one of the regions with the highest river network density in China, having rich Monopterus albus resources and a developed Monopterus albus aquaculture industry. However, the habitats of wild Monopterus albus are decreasing, and its genetic resources are severely damaged. Therefore, it is particularly necessary to accurately and directionally screen high-quality wild resources.
[0003] At present, there is no effective method to directionally screen the strains of Monopterus albus in different regions. Therefore, it is necessary to develop molecular markers for screening the strains of Monopterus albus in specific regions. Molecular markers are genetic markers based on nucleotide sequence variations in the genetic material among individuals, and can reflect specific DNA fragments with certain differences in the genomes among populations. Compared with other morphological markers, cytological markers, microsatellite markers, etc., Indel markers have the advantages of simple operation, high precision and efficiency, high repeatability, etc., and DNA in different tissues at different stages of biological development can be used for marker analysis. Summary of the Invention
[0004] The present invention provides an Indel molecular marker for identifying the strains of Monopterus albus. Using this molecular marker, the strains of Monopterus albus in Jiangxi region and non-Jiangxi region can be quickly identified, which helps to quickly achieve genetic identification, accelerate the domestication and breeding of wild germplasm resources, and realize precision breeding.
[0005] On the one hand, the present invention provides an Indel molecular marker for identifying the strains of Monopterus albus.
[0006] On the other hand, the present invention provides an application of an Indel molecular marker for identifying the strains of Monopterus albus.
[0007] On the further hand, the present invention provides a method for identifying the strains of Monopterus albus.
[0008] The technical solution of the present invention is as follows: An Indel molecular marker for identifying the eel strain is Indel molecular marker A, and Indel molecular marker A contains the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4.
[0009] Through the above Indel molecular marker, it is used to accurately identify the eel strains in Jiangxi region and / or non-Jiangxi region. The nucleic acid sequence shown in SEQ ID NO:3 is used to accurately identify the eel strains in Jiangxi region, and the nucleic acid sequence shown in SEQ ID NO:4 is used to accurately identify the eel strains in non-Jiangxi region.
[0010] The Jiangxi region includes but is not limited to Yichun, Nanchang, Jiujiang, etc. in Jiangxi.
[0011] The non-Jiangxi region includes but is not limited to Chongqing, Changsha in Hunan, Weinan in Shaanxi, Ankang in Shaanxi, Kunming in Yunnan, Xiantao in Hubei, Zhanjiang in Guangdong, Zhengzhou in Henan, Nanning in Guangxi, Dandong in Liaoning, Dongying in Shandong, Huai'an in Jiangsu, Baoding in Hebei, Sanya in Hainan, Chengdu in Sichuan, etc.
[0012] An application of a product containing the Indel molecular marker for identifying the above eel strains in identifying eel strains, and the product includes but is not limited to any one or any combination of primers, probes, reagents, reagent kits, gene chips, devices or equipment, etc.
[0013] A primer of the Indel molecular marker for identifying eel strains, and the primer pair is shown as SEQ ID NO:1 and SEQ ID NO:2, which is used to identify eel strains.
[0014] At least one of the following products contains the primer of the Indel molecular marker for identifying eel strains: (1) A probe of the Indel molecular marker for identifying eel strains; (2) A reagent of the Indel molecular marker for identifying eel strains; (3) A reagent kit of the Indel molecular marker for identifying eel strains; (4) A gene chip of the Indel molecular marker for identifying eel strains; (5) A device or equipment of the Indel molecular marker for identifying eel strains.
[0015] A method for identifying eel strains, the steps include: using the eel genomic DNA as a template, amplifying with the primer pair shown in SEQ ID NO:1-2 to obtain an amplification product; comparing the amplification product with the Indel molecular marker of the eel strain to identify the eel strain.
[0016] Further, when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker of the rice eel strain shown in SEQ ID NO:3, or when the band of the amplification product is 137bp, it is the rice eel strain in Jiangxi region; when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker of the rice eel strain shown in SEQ ID NO:4, or when the band of the amplification product is 160bp, it is the rice eel strain in non-Jiangxi region.
[0017] The advantages of the solution of the present invention are as follows: The present invention provides an Indel molecular marker for identifying the rice eel strain in Jiangxi region. By using the molecular marker primers required for detection provided by the present invention to perform PCR amplification on rice eel strains in different regions, it is possible to quickly identify whether it is the rice eel strain in Jiangxi region based on the amplified fragment. Applying the Indel marker provided by the present invention to practice is beneficial to quickly realizing genetic identification, accelerating the domestication and breeding of wild germplasm resources, and achieving precision breeding. Description of the Drawings
[0018] Figure 1 It is the gel electrophoresis diagram of PCR amplification of DNA of 18 rice eel strains using primer pair 1.
[0019] Among them, the numbers 1-18 respectively represent the following 18 rice eel strains: 1. Yichun, Jiangxi; 2. Nanchang, Jiangxi; 3. Jiujiang, Jiangxi; 4. Chongqing; 5. Changsha, Hunan; 6. Weinan, Shaanxi; 7. Ankang, Shaanxi; 8. Kunming, Yunnan; 9. Xiantao, Hubei; 10. Zhanjiang, Guangdong; 11. Zhengzhou, Henan; 12. Nanning, Guangxi; 13. Dandong, Liaoning; 14. Dongying, Shandong; 15. Huai'an, Jiangsu; 16. Baoding, Hebei; 17. Sanya, Hainan; 18. Chengdu, Sichuan. Detailed Embodiments
[0020] The following examples are only used to further illustrate the content of the present invention, but should not be construed as a limitation to the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement of the methods, steps or conditions of the present invention belongs to the scope of the present invention. The experimental methods without specific conditions and the reagents and materials without specific formulations described in the examples are all in accordance with the conventional conditions in the art, and the reagents used can be obtained commercially.
[0021] The present invention provides Indel markers for identifying whether the rice field eel is a strain from Jiangxi region. The method for obtaining the molecular markers is as follows: Based on the existing rice field eel genome sequence, by resequencing the rice field eels of different regional strains, genome-wide association analysis is performed to identify the genomic regions where the rice field eel strain from Jiangxi region is different from the rice field eel strains in other regions, which are located at the physical positions of 48875995 - 48876017 on chromosome 2 (Chr2) and 7926193 - 7926213 on chromosome 9 (Chr9) of the rice field eel. The flanking sequences of 200 bp before and after the Indel variation in this genomic region are selected for primer development. After PCR amplification of the Indel markers with the primers, whether the tested rice field eel is a strain from Jiangxi region is identified by the differences in the amplified fragments. The amplified fragments that respectively conform to the nucleotide sequence of the Indel marker SEQ ID NO:3 of the present invention are the rice field eel strains from Jiangxi region.
[0022] The present invention provides primer pairs for detecting the Indel molecular markers, and their forward and reverse primer sequences are respectively shown as SEQ ID NO:1 - 2.
[0023] Table 1 Nucleotide sequences of primer pairs
[0024] Example 1: Identification of rice field eel strains from 18 regions (1)Extraction of genomic DNA from rice field eel samples Cut a small section of tail muscle (about 0.5 g) of the tested rice field eel, and extract genomic DNA using a tissue genomic DNA extraction kit (brand: Tiangen, product number: 69504). Use a NanoDrop2000 spectrophotometer to detect the purity and concentration of the obtained DNA sample. The extracted DNA can be stored at -20°C for a long time.
[0025] (2)PCR amplification of Indel marker fragments Using the above-obtained rice field eel genomic DNA as a template, PCR amplification is performed with the primer pair shown in the nucleotide sequence of primer pair 1 SEQ ID NO:1 - 2 in Table 1.
[0026] Use a pre-mixed PCR kit with dye (brand: TaKaRa, product number: RR903A) to prepare the following 20 μl reaction system: Premix Taq 10 μl, 10 μM forward primer 0.5 μl, 10 μM reverse primer 0.5 μl, template DNA 1 μl, and supplement ddH 2 O to a total volume of 20 μl.
[0027] The procedure for PCR amplification was as follows: pre-denaturation at 98°C for 10 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, with 35 cycles, and extension at 72°C for 5 min.
[0028] (3)Perform agarose gel electrophoresis on the amplified products Prepare a 2% agarose gel, add the above PCR amplified products and use 50 bp DNA marker as a marker for electrophoresis. Set the electrophoresis conditions as voltage 110V and electrophoresis time 60 min. Use a gel imager to take pictures of the bands to obtain gel pictures.
[0029] (4)Identify the amplified products Identify according to the bands on the gel picture or the sequencing results of the PCR amplified products (sequencing was performed by Shanghai Sangon Biotech Co., Ltd.).
[0030] When the band shown on the electrophoresis gel of primer pair 1 is at 137 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:3, the tested rice field eels are the rice field eel strain in Jiangxi region; if the band is shown at 160 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:4, the tested rice field eels are the rice field eel strains from non-Jiangxi regions.
[0031] CACTGCTGTGAAATTCCTGCTTGACCTGCCACATTATTCAGAGAAACAACTAATGGTAAGTCCATTCATTTCCTTTGTTTTAACAAGCTTATACAAATTCTCTTTTTATAATCTGAACGAGCATGGATTGGAGAAGT (SEQ ID NO:3) CACTGCTGTGAAATTCCTGCTTGACCTGCCACATTATTCAGAGAAACAACTAATGGTAAGTCCATGTCAGCATGTTTTAAAAGTTCATTCATTTCCTTTGTTTTAACAAGCTTATACAAATTCTCTTTTTATAATCTGAACGAGCATGGATTGGAGAAGT (SEQ ID NO:4) There is a deletion of the following sequence at the 63 - 85 bp bases of the sequence shown in SEQ ID NO:4: CATGTCAGCATGTTTTAAAAGTT, which corresponds to SEQ ID NO:3.
[0032] The experimental results are respectively as Figure 1 shown.
[0033] Figure 1The amplified product bands of Samples 1-3 are located at 137 bp, and the amplified bands of Samples 4-18 are located at 160 bp.
[0034] It can be clearly seen from Figure 1 that Samples 1-3 from Yichun, Nanchang, and Jiujiang in Jiangxi are indeed the rice field eel strains in Jiangxi region, while Samples 4-18 of rice field eels come from other regions respectively.
[0035] The above results indicate that the Indel marker A described can effectively identify whether it is a rice field eel strain in Jiangxi region. Therefore, the Indel marker provided by the present invention can be applied to the rapid identification of germplasm resources of specific geographical strains, so as to obtain excellent traits of the strain and ultimately achieve precision breeding.
Claims
1. An Indel molecular marker for identifying rice field eel strains, characterized in that: It is Indel molecular marker A, and Indel molecular marker A contains the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:
4.
2. Use of the product of the Indel molecular marker described in claim 1 in identifying rice field eel strains.
3. The use according to claim 2, characterized in that: The product includes primers, and / or probes, and / or kits, and / or gene chips, and / or devices.
4. A primer for identifying the Indel molecular marker according to claim 1, characterized in that: The primer pair is shown as SEQ ID NO:1 and SEQ ID NO:
2.
5. At least one of the following products contains the primer according to claim 4: (1) Probes for indel markers to identify rice field eel strains; (2) A kit for identifying Indel molecular markers for rice field eel strains; (3) Gene chip for indel molecular markers to identify rice field eel strains; (4) A device for identifying Indel molecular markers for rice field eel strains.
6. A method for identifying eel strains, characterized in that the steps include: Using the genomic DNA of the yellow eel as a template, amplification is performed using the primers described in claim 4 or the product described in claim 5 to obtain an amplified product; The amplified product is compared with the Indel molecular marker described in claim 1 to identify the yellow eel strain.
7. The identification method according to claim 6, characterized in that: When the nucleic acid sequence of the amplified product is consistent with the Indel molecular marker shown in SEQ ID NO:3 in claim 1, or the band of the amplified product is 137bp, it is a yellow eel strain from Jiangxi region; when the nucleic acid sequence of the amplified product is consistent with the Indel molecular marker shown in SEQ ID NO:4 in claim 1, or the band of the amplified product is 160bp, it is a yellow eel strain not from Jiangxi region.
Citation Information
Patent Citations
Monopterus albus germ cell xenotransplantation and post-transplantation chimeric gonad detection method
CN114592075A
Indel molecular marker for identifying ricefield eel strain in southwest region and application of Indel molecular marker
CN119265316A
Indel molecular marker for identifying ricefield eel strains in two Guangdong regions and application of Indel molecular marker
CN119639914A
Single nucleotide polymorphic DNA markers for discriminating habitat of the albino swamp eel, monopterus albus and a method using the same
KR101514431B1
Cited By
Indel molecular marker for identifying ricefield eel strain in southwest region and application of Indel molecular marker
CN119265316A
Indel molecular marker for identifying monsoonal fish strain in southwest region and application thereof
CN119265316B