Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

95 results about "Monopterus" patented technology

Monopterus is a genus of swamp eels mainly native to Asia, but with two species in Africa. They live in various freshwater habitats and some have a fossorial lifestyle. Three species, M. eapeni, M. digressus and M. roseni, live in underground waters.

Method for cultivating and domesticating monopterus fries

InactiveCN103299941ALow costSolve problems that cannot be used for farmingClimate change adaptationPisciculture and aquariaMonopterusDisinfectant
The invention relates to a method for cultivating and domesticating monopterus fries, which comprises the following steps: 1) choosing the fries; 2) pre-processing cultivating facilities; 3) processing cultivating water quality; 4) inputting initial feed and domesticating with food; 5) inputting secondary cultivated fish; 6) equipping with oxygenation; 7) cultivating successfully when the feeding rate of mixed feed of the monopterus fries reaches 2% of the weight of the monopterus fries, and entering into regular cultivation. The entire cultivating process is without spraying disinfectant and using antibiotics; the cultivating method is easy to understand and learn; the monopterus fries are easy to cultivate after the domestication; the survival rate is high. The method also solves the difficult problem that monopterus wild fries caught from January to July can not be used for cultivating at present. The method cultivates the fries successfully, can save 50% of the fry cost, and can obtain remarkable economic benefit whether selling to other farmers to cultivate or employing people to cultivate continuously.
Owner:蒋石容

Monopterus albus gene editing method

The invention discloses a monopterus albus gene editing method. The monopterus albus gene editing method comprises the following steps: 1, acquiring an artificially inseminated monopterus albus 1-cell stage embryo by establishing an indoor eel whole artificial propagation technology; 2, establishing a transcription activator-like effector nuclease gene editing vector of a target gene, performing in-vitro transcription to synthesize mRNA, and transferring the mRNA into the monopterus albus 1-cell stage fertilization embryo by adopting a microinjection method; 3, screening to obtain a monopterus albus with a mutant target gene through a three-primer detection method, and determining the mutation type of the target gene through sequencing. According to the method, a micromanipulation technology for a monopterus albus embryo is established for the first time, a precise monopterus albus endogenous gene editing technology is established for the first time, and powerful technological means is provided for performing function research on a monopterus albus gene and genetic improvement of monopterus albus breeding variety.
Owner:INST OF AQUATIC LIFE ACAD SINICA

Method for high-density net cage monopterus albus breeding in vinyl house

The invention relates to a method for high-density net cage monopterus albus breeding in a vinyl house and belongs to the technical field of fishery science application. The method is characterized in that a breeding net cage, a micro flowing water system and a temperature rising facility used at low temperatures are arranged in the built vinyl house so that the water level and the water temperature in a breeding system can be maintained 0.5-0.8 m and 25-28 DEG C respectively, and monopterus albus can be bred in the breeding net cage. The put volume of fries of the monopterus albus is 5-6 kg / m<2>, feed feeding the monopterus albus is a feed mixture of animal feed and compound feed special for the monopterus albus, and the feed amount a day is 8-12 percent the weight of the monopterus albus in the net cage. According to the method for high-density net cage monopterus albus breeding in the vinyl house, high-density breeding of the monopterus albus can be achieved, the breeding time of the monopterus albus is prolonged by five months or more each year, the survival rate of the monopterus albus is more than 95 percent, compared with a pond net cage breeding manner, the yield per unit area is improved by 5-8 times, and the method has the advantages that the breeding density is large, the monopterus albus grows fast and is high in quality, cost is low, and catching is convenient.
Owner:YANGTZE UNIVERSITY

A CRERV RT-CPA detection prim for Monopterus albus rhabdovirus and application thereof

The invention belongs to the field of virus detection, in particular discloses a rhabdovirus of Monopterus albus CrERV RT- CPA detection prim and application, inventors first isolate a kind of Monopterus albus rhabdovirus from diseased Monopterus albus seedlings, which is Monopterus albus rhabdovirus (Monopterus albus rhabdovirus- Field eel rhabdovirus) CrERV, primers designed for the virus sequence, 1s: CAGGATATACGACCCAATC; 2a1s:TAACTCTTTGAGCAGGCCTCAGGATATACGACCCAATC; 2a:TAACTCTTTGAGCAGGCCT; 3a:CATCAGATTCATGTGTACA; 4s:CAGAAGTCTCAGGACCACCA; 5a:AGGGATGGGCTGCCTTGGAGC; Monopterus albus rhabdovirus can be detected with this primer, which has good specificity and high sensitivity.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Soilless propagation method of monopterus albus Zuiew

The invention discloses a soilless propagation method of monopterus albus Zuiew. The soilless propagation method comprises the following steps: setting an opened net cage which is not less than 15m<2> in area in a pond or a greenhouse, putting a pile of round myriophyllum aquaticum in the net cage every 1.5m, putting two parent monopterus albus Zuiew in each pile of the myriophyllum aquaticum, feeding mixed bait every 2 to 3 days, and moving monopterus albus Zuiew fries attached to roots of Pistias tratiotes out of the net cage for independent breeding in 15th to 30th days after bubbling and spawning of the monopterus albus Zuiew. According to the soilless propagation method disclosed by the invention, the area of a monopterus albus Zuiew propagation net cage is enlarged, the myriophyllum aquaticum is utilized to replace soil so as to be used as a monopterus albus Zuiew nest, the number of parent monopterus albus Zuiew in the net cage is increased, the pairing success rate of the parent monopterus albus Zuiew is greatly increased, and meanwhile, a parent stress reaction is relieved by utilizing rich roots of the myriophyllum aquaticum, so that the influence of adverse weather is cast off, the propagation frequency is increased, and the soilless propagation method has the characteristics of convenience in operation, wide application range, high germination quantity per unit area, high economic benefit and the like.
Owner:苏州善道农业科技有限公司

Monopterus albus breeding feed and production method thereof

The invention discloses a monopterus albus breeding feed and a production method thereof, wherein the raw materials comprise, by weight, 10-15 parts of peanut meal, 10-15 parts of bean meal, 8-10 parts of carrot root powder, 8-10 parts of rose root powder, 5-7 parts of spirulina powder, 10-12 parts of rheum palmatum l-scutellaria baicalensis-cortex phellodendri powder, 15-20 parts of corn powder, 13-15 parts of sorghum powder, 13-15 parts of rough rice powder, 10-12 parts of peanut powder, 7-9 parts of soybean protein powder, 7-8 parts of rapeseed meal powder, 20-25 parts of fish powder, 18-20 parts of shrimp powder, 15-17 parts of silkworm chrysalis powder, 5-8 parts of pig blood powder, 8-10 parts of fly maggot powder, 5-8 parts of a nutrition mixture, 8-10 parts of a Chinese herb additive, and 3-5 parts of edible salt. According to the present invention, the monopterus albus breeding feed can supply the basic nutrients of monopterus albus, can promote the rapid growth of monopterus albus at the growing period, and can improve the growth efficiency of monopterus albus; the various materials in the formula are the non-polluting substances so as to provide the green environmental protection; and with the application of the monopterus albus breeding feed to feed monopterus albus, the disease resistance is significantly enhanced, the survival rate is substantially increased, the breeding is rapid, the yield is increased, and the fed monopterus albus has characteristics of delicious meat and rich nutrition.
Owner:凤阳徽亨商贸有限公司

Nutritious feed for chicken

Disclosed nutritious feed for chicken is prepared from the following raw materials in parts by weight: 7-12 parts of loach, 10-15 parts of dry earthworm, 6-12 parts of earthworm manure, 8-16 parts of tenebrio molitor, 5-8 parts of calcium hydrogen phosphate, 3-6 parts of edible salt, 2-4 parts of mung bean, 3-5 parts of hippophae rhamnoides, 4-7 parts of gynostemma pentaphyllum, 7-14 parts of asparagus, 2-4 parts of apocynum venetum, 5-7 parts of spirulina platensis, 30-50 parts of corn, 20-30 parts of corn straw, 10-18 parts of Chinese Cabbage, 7-16 parts of bran, 5-8 parts of purple cabbage, 7-10 parts of laminaria japonica, 8-16 parts of fish bone meal and 7-12 parts of monopterus albus. The provided nutritious feed for chicken is capable of improving immunity of chicken, reducing incidence rate of diseases, improving laying rate of chicken and egg quality, and also improving chicken quality.
Owner:QINGDAO BOHONG MARINE BIOTECH

Cultivation method for inducing classification of monopterus albus fries via multi-net cage

The invention discloses a cultivation method for inducing classification of monopterus albus fries via a multi-net cage. The method comprises the following operation steps: 1, pond preparation; 2, netcage manufacture and arrangement; 3, fry breeding outside the cage; 4, induction of classification for training; and 5, large-scale monopterus albus fry capturing. In the whole implementation process, a disinfectant does not require to be splashed, and antibiotics are not used; time and labor are saved, the cases that monopterus albuses make stress reaction and cruelly eat each other are reduced,so that the fry survival rate is improved; monopterus albus fries can be trained via classification, have a unified standard, and are fast in growth rate. By the method, the fries can be successfullytrained, the fry survival rate can be improved by 20%, the total weight is increased by 15%, and the monopterus albus fries have the unified standard and are convenient to sell, thereby being able toobtain remarkable economic benefit.
Owner:FISHERIES RES INST ANHUI ACAD OF AGRI SCI

Jasmine fragrance type grass carp feed and preparation method thereof

The invention relates to a jasmine fragrance type grass carp feed which comprises the following raw materials in parts by weight: 24 parts of corn gluten meal, 19 parts of corn stalks, 22 parts of peanut meals, 9 parts of rice sprout powder, 2 parts of sweet potato vine powder, 25 parts of rice bran, 3 parts of wheat bran, 8 parts of yellow mealworm, 2 parts of wall-broken yeast, 2 parts of monopterus albus spine, 2 parts of salt, 2 parts of calcium hydrophosphate, 6 parts of vitamin C, 0.5 part of Chinese medicine additive and 1 part of jasmine flavoring agent. The jasmine flavoring agent consists of the following raw materials in parts by weight: 7 parts of jasmine flower, 2 parts of pine nuts, 2 parts of buckwheat, 0.3 part of watermelon juice, 0.09 part of medlar honey, 0.3 part of lemon juice and 1 part of coix seed oil. The feed is green and healthy, has good taste and has fragrance of jasmine flower; by adding the Chinese medicine additive, the immunity of grass carps is reinforced, and disease-resistant and antibacterial abilities are improved; for the grass carps eating the feed disclosed by the invention, the morbidity is effectively reduced, weights are obviously increased, the grass carps actively eat, and a feed utilization rate is high.
Owner:HUAINING LONGSHENG GRASS IND CO LTD

Immunity enhancing feed for pigs

The present invention belongs to the technical field of livestock and poultry breeding and particularly relates to an immunity enhancing feed for pigs. The feed for the pigs consists of corns, soybean meal, monopterus albus bones, egg shells, B12, eichhornia crassipes, skim rice bran, phymatopsis engleri, polygonum aviculare, compound vitamins, fructo-oligosaccharides, duchesnea indica, sclareol, cucumis melo var. agrestis, zinc sulfate, copper sulfate and pumpkin seeds. The feed for the pigs is full in nutrition and good in palatability, can increase appetite of the pigs, promotes intestinal health, promotes digestion, strengthens immune capacity of the pigs, improves disease resistance, reduces the prevalence, and is safe and free of hormones.
Owner:广西聚银牧业集团有限公司

Monopterus albus rhabdovirus Cr-ERV and RT-PCR detection primer and application thereof

The invention belongs to the virus detection field, in particular, discloses a Chinese rice virus-Field eel rhabdovirus Cr-ERV and RT-PCR detection primer and an application thereof. The Monopterus albus rhabdovirus is isolated from diseased Monopterus albus seedlings, and the virus is (Chinese rice virus-Field eel rhabdovirus) CrERV, deposited as CCTCC NO: V201819, is of pioneering significance for the study of Monopterus albus rhabdovirus. Primers are designed to detect rhabdovirus of Monopterus albus. The primers have good specificity and high sensitivity.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Monopterus albus AKR (aldo-keto reductase) gene and in-vitro expression method thereof

The invention relates to the field of genetic engineering, in particular to a monopterus albus AKR (aldo-keto reductase) gene with nucleotide and amino acid sequences shown in SEQ ID NO:1 and SEQ ID NO:2. A recombinant expression vector of a monopterus albus Eakr gene is constructed with methods in molecular biology and genetic engineering, induction expression and affinity chromatography are performed, and purified recombinant expression protein is obtained. Monopterus albus Eakr recombinant protein can catalyze different substrates such as methylglyoxal, acetone, progesterone, methyltestosterone and the like and has theoretical guidance significance and application reference value for industrial application of AKR. Besides, the invention further provides an in-vitro expression method of the monopterus albus AKR gene.
Owner:YANGTZE UNIVERSITY

Efficient shrimping bait

The invention discloses an efficient shrimping bait. The technical formula of the efficient shrimping bait comprises that the efficient shrimping bait comprises, by weight percentage, 0.1%-0.5% sodium benzoate, 0.1%-0.5% sorbic acid, 4%-8% trash fish meal, 4%-8% Monopterus meal, 3%-8% sesame powder, 5%-9% duck blood meal, 6%-12% water hyacinth powder, 8%-15% highland barley powder, 6%-10% protein power, 7%-11% shrimp sachet powder, 3%-10% stone naphthalene powder, 2%-7% aginomoto, 9%-19% vinasse powder and 13%-24% shrimp phagostimulant powder. The preparing process comprises selecting, cleaning and airing trash fish, Monopterus, and duck blood, then putting the trash fish, the Monopterus, and the duck blood into a dryer, drying the trash fish, the Monopterus, and the duck blood in the dryer for 1-3 hours at a temperature of 50-90 DEG C and at a dryness of 85%-95%, and smashing the dried trash fish, the Monopterus, and the duck blood into particles; smashing the vinasse, the stone naphthalene and the water hyacinth; mixing the substances together for 10 minutes to 1 hour to achieve sufficient mixing and to further obtain the efficient shrimping bait. The efficient shrimping bait is good in atomization performance, is very fragrant when placed in water, improves the sense of hunger of various shrimps when the shrimps smells the smell of the bait, enables the shrimps to keep an ingestion activated state and to enter a cage for ingestion after the shrimps smell the smell of the bait, has no pollution to a water body, and solves the problem that people has difficulty in gathering the shrimps together.
Owner:陈培林

Monopterus albus breeding structure capable of scattering smell and quantitatively feeding

The invention discloses a monopterus albus breeding structure capable of scattering smell and quantitatively feeding. The monopterus albus breeding structure capable of scattering smell and quantitatively feeding structurally comprises a feed storage barrel, a smell scattering and quantitative feeding structure and a floating plate, wherein the smell scattering and quantitative feeding structure is provided with a bidirectional feeding trigger structure, an oblique angle stress spreading structure and a smell scattering hook structure, and the bidirectional feeding trigger structure is fixed on the front side above the floating plate. The monopterus albus breeding structure capable of scattering smell and quantitatively feeding has the beneficial effects that through the arranged smell scattering and quantitative feeding structure, winding connection double ropes and a trigger single rope can simultaneously convey the oblique angle stress spreading structure to the water bottom throughrotation of a hollow-hole disc, insects and smell objects which are hung above a hook device scatter smell to attract part of monopterus albus on the water bottom, a part of feed of the inside slidesdown to be eaten by the monopterus albus; and the structure moves to another place for operation by the use of the method, and the problem that granulated feed cannot resist impact and soaking of water flow and then is reduced into minced feed is avoided.
Owner:绍兴玖越智能装备有限公司

Polypeptide cold noodle and production process thereof

The present invention discloses a polypeptide cold noodle which is characterized by being prepared by the following components in parts by weight: 90-150 parts of flour, 1-5 parts of corn peptide, 1-2 parts of flavored salt, 4-6 parts of flavored powder, 1.5-2.5 parts of dried donkey white blood powder, 1-2 parts of monopterus albus bone meal, 0.4-0.6 parts of dried serpent-head meat intestine powder, and an appropriate amount of soup-stock; and the polypeptide cold noodle is prepared by the following steps: the flour, corn peptide, flavored salt, flavored powder, dried donkey white blood powder, monopterus albus bone meal and dried serpent-head meat intestine powder are mixed with the appropriate amount of soup-stock, the dough is kneaded, cured, compounded, rolled strip cut, oven-dried and packaged. The polypeptide cold noodle is nutritious, does not contain harmful substances to human health and growth, has wide sources of raw materials, simple preparation process and low cost, and a variety of human body essential trace elements are added.
Owner:ANHUI FOZILING FLOUR IND

Spraying device for monopterus albus breeding and with good spraying effect

The invention discloses a spraying device for monopterus albus breeding and with a good spraying effect. The device comprises a feed cylinder, a base, support columns and a feeding through pipe; a telescopic rod is movably connected to the middle in the feed cylinder, a bearing is movably connected to the middle of the telescopic rod, the base is fixedly connected to the bottom of the feed cylinder, the feeding through pipe is fixedly connected to one side of the feed cylinder, a mounting bin is fixedly connected to one side of the feeding through pipe, a rotating column is movably connected to one side of the mounting bin, and sprayers are movably connected to one side of the rotating column; the spraying efficiency of the spraying device is well improved through the sprayers, the spraying speed of the spraying device is well increased through two spraying nozzles and the sprayers, the spraying efficiency of the spraying device is well improved through the spraying nozzles and the sprayers, the elasticity and flexibility of the spraying device are well improved through springs, the practicability of the spraying device is well improved through excitation boards, the flexibility ofthe spraying device is well improved through stirring balls, and the spraying device is suitable for use and has broad development prospects in the future.
Owner:唐德均

Waterless keep-alive transportation method for shrimps

The invention relates to the technical field of keep-alive transportation of shrimps, and provides a waterless keep-alive transportation method for shrimps in order to solve the problems that an existing waterless shrimp transportation technology has many influencing factors and unstable shrimp survival rate. The method comprises the following steps of (1) temporary rearing; (2) precooling, wherein a keep-alive agent is precooled to 6-15 DEG C, and the keep-alive agent is mixed mucus of misgurnus anguillicaudatus and monopterus albus; (3) cold shock, wherein the shrimps are soaked in the precooled keep-alive agent until the shrimps enter shock states; (4) packaging, wherein the shrimps are packaged in a packaging bag, and the packaging bag is sealed after being filled with oxygen; (5) transportation; (6) recovery. The waterless keep-alive transportation method for the shrimps can effectively relieve the stress response of the shrimps during transportation, improve the capability to tolerate hypoxia, maintain the health of the shrimps, and effectively increase the survival rate of waterless transportation, and the survival rate after the shrimps are transported for 15 hours can reach 91%.
Owner:ZHEJIANG UNIV

Method using solar energy to fast breed Monopterus albus in high-yield manner

The invention relates to a method using solar energy to fast breed Monopterus albus in a high-yield manner. The method is characterized in that a solar photovoltaic cell panel matrix is arranged on aMonopterus albus breeding tank, solar energy is utilized to generate power, thje electric energy is used to supply water for the Monopterus albus breeding tank and regulate the water temperature of the Monopterus albus breeding tank, and the water temperature is kept at 28-32 DEG C; Monopterus albus hibernation is avoided, and the hibernation-free, fast and high-yield Monopterus albus breeding method is created; the Monopterus albus breeding tank is well selected and built; the Monopterus albus breeding tank, breeding net cages, a fry breeding tank, fry breeding net cages, an adult Monopterusalbus tank, adult Monopterus albus net cages and a Monopterus albus tank escape-preventing fence are built, and sterilizing and tank cleaning are performed; water hyacinth is transplanted in the tanksand the net cages, and Monopterus albus breeding, Monopterus albus fry culturing and Monopterus albus cultivation are performed; Chinese Monopterus albus varieties are used, the different specifications and reasonable density of parent Monopterus albus and Monopterus albus fry are determined during breeding, the Monopterus albus is reasonably fed with disease-resistant feed for the fast growth ofthe Monopterus albus, and the disease control of the Monopterus albus breeding is well performed; the use of industrial compound feed and medicine during Monopterus albus breeding is avoided, and natural animal and biological feed is used to perform novel scientific and ecological breeding.
Owner:王文梅

Breeding method for deinagkistrodon

The invention discloses a breeding method for deinagkistrodon. The method comprises the following steps: (1) selecting a site: an idle house is reconstructed into a snake house, corner angles are arranged in an arc shape, the wall surface is set to be smooth, no large gaps exist, a layer of fresh sand with a thickness of about 10-15 cm is spread on the ground, at the same time, at least a water pool is arranged in the snake house, aquatic plants are planted near the water pool, an iron wire mesh is arranged at a water inlet of the water pool, a feed tank is built near the water pool, aquatic plants are planted in the feed tank, monopterus albus, misgurnus anguillicaudatus, batrachia and elaphe rufodorsata are stocked in the feed tank, the exterior of a wall is provided with steps, and flower and grass plants with stronger vitality are placed in the snake house. The scientific breeding method for the deinagkistrodon provided by the invention is suitable for large-scale breeding of the deinagkistrodon; and through selective management of the snake house, a feeding technology of young snakes, research and development of feed for feeding the young snakes, and research and development of a traditional Chinese medicine attractant, the survival rate of the young snakes is effectively improved, the physique of the bred deinagkistrodon can be enhanced, and the yield of the deinagkistrodon can be improved.
Owner:CHONGQING DONGHONGXIN TECH

Monopterus albus capturing cage with butterfly-shaped inverted whiskers

The invention relates to a monopterus albus capturing cage with butterfly-shaped inverted whiskers. The cage comprises a reinforcement cage, wherein meshes wrap the outer side of the reinforcement cage to form a cage body which is in a shape of a long circle; a monopterus albus storage bag is connected to the rear opening of the cage body; the monopterus albus storage bag is fixed and connected through mesh wire ropes of the monopterus albus storage bag and provided with two steel bar supporting rings to support the inner space; two ends of the cage body are opposite to each other and a monopterus albus inlet and a monopterus albus outlet are separately formed at the two ends; the butterfly-shaped steel bar inverted whiskers are mounted on the monopterus albus inlet and are fixed by the meshes; inner inverted whiskers are mounted at the inlet of the monopterus albus storage bag, the inner inverted whiskers extend inward to connect an inner inverted whisker opening, the inner inverted whisker opening is fixed by an inner inverted whisker opening pull rope, a bait bag is placed in a cavity of the cage body, and the bait bag is fixed by a bait bag pull rope.
Owner:XUZHOU YITONG FISHING GEAR

Feed for improving functions of sow in lactation period and preparation method thereof

The invention discloses feed for improving the functions of a sow in the lactation period. The feed is prepared from the following materials in parts by weight: 90-100 parts of cotton seed cake, 70-80 parts of expanded soybean powder, 4-5 parts of monopterus albus meat, 4-5 parts of loach meat, 5-6 parts of onions, 3-4 parts of perilla leaf powder, 1-2 parts of royal jelly freeze-dried powder, 6-9 parts of shell powder, 2-3 parts of bone meal, 7-8 parts of honey, 30-35 parts of fresh orange juice, 1-2 parts of clove, 1-2 parts of radix ophiopogonis, 2-3 parts of cowherb seeds, 3-4 parts of yeast, 3-4 parts of a phagostimulant and a proper amount of water. The feed disclosed by the invention has the beneficial effects that the cotton seed cake and the expanded soybean powder are adopted as the main materials; due to addition of the Chinese herbal medicines, the feed is beneficial to improving the body functions and the autoimmunity of the sow and is helpful for enhancing the absorption of nutrient substances and improving the quality and the yield of the milk of the sow, so that the growth of piglets is promoted and the farming benefit is good.
Owner:安徽省家牧动物营养科技有限公司

Feed for Monopterus albus

The invention discloses feed for Monopterus albus. The feed comprises the following raw materials in parts by weight: 20-35 parts of wheat cakes, 3-20 parts of peanut vines, 30-50 parts of mulberry leaves, 10-15 parts of straw, 2-6 parts of masson pine leaf juice, 5-15 parts of cotton seed cakes, 10-20 parts of corn flour, 5-10 parts of fish bone meal, 1-6 parts of sapropel, 1-2 parts of salt, 2-6parts of microbial enzymes, 2-8 parts of tryptophan, 2-8 parts of vitamin A, and 1-5 parts of mineral substances. The feed for Monopterus albus is used, in order to optimize deficiency of original feed for Monopterus albus; a lot of green herbaceous plants are supplemented in the feed for Monopterus albus, in order to avoid the problem that green herbaceous plants needed by Monopterus albus cannot be normally supplied due to deficiency of green herbaceous plants in winter; the feed can promote uniform nutrition of Monopterus albus, so that Monopterus albus grows fast with good meat quality, and economic benefits of meat quality culture are improved.
Owner:陈扣香

Compound islet function repairing hyperglycemic capsule

The invention relates to a compound islet function repairing hyperglycemic capsule. The formula comprises: 5% of red ginseng, 6% of astragalus, 3% of ganoderma lucidum, 3% of Schisandra chinensis, 6% of kudzu vine root, 6% of Salvia Miltiorrhiza, 4% of Ligusticum wallichii, 2% of Monopterus albus, 3% of semen cuscutae, 1% of black sesame, 7% of radix rehmanniae, 6% of prepared rhizome of rehmannia, 5% of black fungus, 2% of a ginkgo leaf extract, 3% of ophiopogon japonicus, 3% of radix asparagi, 6% of mulberry leaf, 3% of mulberry, 4% of Gynostemma pentaphyllum, 3% of pearl powder, 2% of cassia seed, 2% of coix seed, 3% of corn stigma, 3% of Coptis chinensis, 4% of bitter gourd, 4% of malt, and 1% of licorice. The preparation method includes: mixing obtained Chinese herbal mixed extract powder and mixed concentrated liquid together uniformly, putting the mixture into an infrared drying sterilization box to conduct drying and sterilization, and then loading the product into a capsule.
Owner:ZHENGZHOU GUOSHOU BIOLOGICAL TECH CO LTD

Chinese herba preparation for treating backache

InactiveCN104958586ACompatibility is reasonableIn line with dialectical theoryAntipyreticAnalgesicsMonopterusMyrrh
A Chinese herba preparation for treating backache is prepared by the following crude drugs: 5-10 grams of rhizoma atractylodis, 5-10 grams of frankincense, 5-10 grams of myrrh, 5-10 grams of drynaria rhizome, 5-10 grams of bletilla striata, 10-30 grams of radix rehmanniae recen, 10-15 grams of prepared rehmannia roots, 5-15 grams of root barks of the peony tree, 10-15 grams of peach seeds, 5-15 grams of safflower carthamus, 5-15 grams of eucommia ulmoides, 10-12 grams of gastrodia elata, 9-11 grams of semen cuscutae, 7-9 grams of sesame seeds, 5-20 grams of barbary wolfberry fruit, 9-11 grams of rhizoma alismatis, 9-11 grams of rhizoma anemarrhenae, 12-14 grams of golden cypress, 11-13 grams of fructus aurantii, 25-35 grams of Chinese angelica, 4-6 grams of jujube pits, 4-6 grams of tree-of-heaven ailanthus barks, 4-6 grams of monopterus albus spine, 5-15 grams of liquorice and 4-6 grams of sorghum roots. The Chinese herba preparation is reasonable in compatibility of medicines and conforms to a traditional Chinese medicine differentiation theory, a curative effect is quick, the cure rate is high, and the backache of a patient cannot relapse after being treated.
Owner:许五妮

Novel method for monopterus albus cultivation

The invention discloses a novel method for monopterus albus cultivation, and relates to the technical field of aquaculture. The novel method comprises the following steps of selection of parent monopterus albus, construction of a monopterus albus pond, monopterus albus pond management, feed management and disease control. The novel method for monopterus albus cultivation has the advantages that production resources are made full use of, no professional equipment is required, breeding pollution is avoided, the breeding technology is standard, feed supply is scientific and standard, the cultivation technology is improved to a large extent, and therefore the quality and the yield of the monopterus albus are improved.
Owner:曹全民

Controlled aquiculture method of monopterus albus

InactiveCN110574717AAvoid the problem of long-term shut-mouth and not eatingReduced responseClimate change adaptationPisciculture and aquariaMonopterusWater flow
The invention provides a controlled aquiculture method of monopterus albus. The method comprises the following steps of S1, configuration of aquiculture equipment, wherein aquiculture ponds are dug inan aquiculture area, water inlet pipes are arranged around the aquiculture ponds, so that water flows circularly when injected into the aquiculture ponds, and the bottoms of the aquiculture ponds areprovided with drain valves; S2, setting of monopterus albus nests, wherein the monopterus albus nests comprise nest bodies in the water and food tables thereof on the top, and each nest body comprises multiple rows of hollow meshy cylindrical tubes; S3, pond soaking; S4, monopterus albus fry putting; S5, daily management, wherein after stocking is carried out for 3 days, feeding training is conducted at nightfall, and when feeding training begins, the bait casting amount is 1-2% of the weight of monopterus albus fry; after 5-7 days, the bait casting amount is increased to 3-4% of the weight of the monopterus albus fry; after 10-15 days, the bait casting amount is increased to 5-6% of the weight of the monopterus albus fry, feeding is carried out once in the morning and in the evening separately after the monopterus albus is domesticated, and after a bait is placed, the four water inlet pipes on the four corners of each aquiculture pond and the drain valves on the bottom of the corresponding aquiculture pond are switched on, so that microflow water exists in the aquiculture ponds. According to the method, the pollution of bait residues and sewage to the water during monopterus albus aquiculture can be reduced, and the survival rate of the monopterus albus is increased.
Owner:宜昌欣翔农业发展有限公司

Honeysuckle-containing health tea with function of clearing heat, and preparation method of health tea

The invention discloses honeysuckle-containing health tea with a function of clearing heat, and a preparation method of the health tea. The health tea is prepared from the following raw materials in parts by weight: 60-70 parts of chrysanthemum, 30-40 parts of mangnolia, 30-40 parts of honeysuckle, 30-40 parts of hibiscus, 9-11 parts of monopterus albus meat, 12-15 parts of sour plum drink, 3-4 parts of garlic paste, 3-4 parts of coffee beans, 4-5 parts of peanut butter, 4-6 parts of malt, 6-8 parts of malabar spinach, 5-7 parts of shredded olive, 2-3 parts of corn oil, 4-5 parts of cabbage, 1-2 parts of folium isatidis, 1-2 parts of prepared rehmannia glutinosa, 1-2 parts of radix asparagi, 1-1.5 parts of fructus psoraleae, 1-1.5 parts of tree peony root bark, proper amount of water and 35-45 parts of a nutritional additive. Honeysuckle is added into the health tea, has the effects of clearing heat and detoxifying, resisting inflammation, tonifying deficiency and treating rheumatism and is mainly used for treating diseases such as lower tumescence disease, warm disease fever, heat toxin and large carbuncle, tumors and the like; the traditional Chinese medicines added into the health tea have the effects of nourishing yin and clearing away heat, moistening lung and kidney, activating blood circulation to dissipate stasis and removing deficiency-heat.
Owner:CHUZHOU SHIJI TEA PLANTATION

Feed for breeding ptyas korroses, and preparation method of feed

The invention relates to a feed for breeding ptyas korroses, and a preparation method of the feed. The feed is prepared from the following raw materials in parts by weight: 60-80 parts of duck meat, 60-80 parts of bamboo rat meat, 10-15 parts of broken corn grains from a late milk stage to an early dough stage, 10-15 parts of raw eggs, 20-30 parts of bone meal, 2-3 parts of lemon juice, 5-6 parts of health-care extractum, 1-2 parts of yeasts, and 8-10 parts of composite vitamins, wherein the health-care extractum is prepared from caulis bambusae in taenia, raw astragali radix, acanthopanax roots, radix angelicae and notopterygium roots according to the weight ratio of caulis bambusae in taenia to raw astragali radix to acanthopanax roots to radix angelicae to notopterygium roots being 2:3:1:1:2; the bone meal is prepared by mixing dove bone meal, monopterus albus bone meal and chicken bone meal according to the weight ratio of dove bone meal to monopterus albus bone meal to chicken bone meal being 2:2:3, and grinding the mixture of the dove bone meal, the monopterus albus bone meal and the chicken bone meal till the grain diameter is 10-25mm. Through the adoption of the feed disclosed by the invention, the immunity of ptyas korroses is improved, and the possibility that ptyas korroses catch cold is lowered.
Owner:北海市铁山港区富群养殖有限公司

Polysaccharide extracted from monopterus albus fishskins

The invention discloses a polysaccharide extracted from monopterus albus fishskins, and belongs to the technical field of polysaccharide extraction. The extraction of the fishskin polysaccharide comprises the following steps: pretreatment; cell crushing; polysaccharide extraction; polysaccharide column chromatography; and lyophilization. According to the invention, an active polypeptide and a repeated freezing-thawing method are utilized, thus fishskin cell walls are crushed, and a yield of the polysaccharide is improved; and through separation and purification, purity of the polysaccharide is further improved, and the extracted polysaccharide has a low molecular weight, and remarkable effects on blood glucose reduction and blood fat reduction, and is easily absorbed by people.
Owner:浦江县欧立生物技术有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More