130 results about "Hippophae" patented technology

The invention belongs to the technical field of exosome preparation, and provides an extraction method of sea-buckthorn exosomes and application of the sea-buckthorn exosomes in relieving ulcerative bowel disease, fresh sea-buckthorn berries are cleaned and crushed, residues are filtered out, and juice is collected; carrying out primary centrifugal treatment on the juice, discarding precipitate and collecting supernatant; carrying out centrifugal treatment on the obtained supernatant again, discarding the precipitate and collecting the supernatant; carrying out third centrifugal treatment on the obtained supernatant, discarding the precipitate and collecting the supernatant; carrying out centrifugal treatment on the obtained supernate in an ultra-high-speed centrifuge to obtain exosome precipitates, and resuspending the exosome precipitates in a proper amount of precooled PBS (Phosphate Buffer Solution); according to the method, the high-purity hippophae rhamnoides exosome can be obtained through multi-stage centrifugation and sucrose gradient centrifugation, and the hippophae rhamnoides exosome has potential anti-inflammatory and anti-oxidation effects, can be used for treating inflammatory bowel diseases, can also be expanded to the field of treatment of other inflammatory diseases, and has wide application prospects.

The invention discloses application of total flavonoids of branches and trunks of hippophae rhamnoides in preparation of anti-inflammatory drugs, and belongs to the technical field of biological medicines. The total flavonoids are prepared by taking the branches and trunks of the sea-buckthorn as raw materials, the total flavonoids have good antioxidant and anti-inflammatory effects, and the contents of TNF-alpha, IL-6 and CYP2E1 secreted by cells can be reduced by the total flavonoids of the branches and trunks of the sea-buckthorn with different concentrations, so that inflammation is relieved. Meanwhile, tests prove that the total flavonoids of the branches and trunks of the sea-buckthorn and the purple corn extract have a synergistic effect when being used together, the anti-inflammatory effect can be remarkably improved, and the composition has an excellent anti-inflammatory protection effect on alcoholic liver injury.

The invention is applied to the technical field of health-care products, and discloses a sea-buckthorn soft capsule, which comprises a capsule shell and a content, the capsule shell is composed of gelatin, water, glycerin and an auxiliary material, the auxiliary material is a preservative or a plasticizer, the content is composed of one of seabuckthorn seed oil or fruit oil, seabuckthorn powder and an auxiliary material, the auxiliary material is one of a suspending aid and an antioxidant or a mixture of the suspending aid and the antioxidant, the seabuckthorn powder is rich in flavone, and the auxiliary material is a mixture of the suspending aid and the antioxidant. The soft capsule has the effects of lowering lipid, softening blood vessels and preventing vascular diseases. According to the hippophae rhamnoides soft capsule, a product capsule shell is prepared from gelatin, water and glycerin according to a specific proportion, it can be guaranteed that the capsule shell has proper hardness and elasticity and is convenient to process and store, hippophae rhamnoides seed (fruit) oil and hippophae rhamnoides powder in the content are matched according to a reasonable proportion, the hippophae rhamnoides powder is rich in flavone, and the hippophae rhamnoides powder and the hippophae rhamnoides seed (fruit) oil act the effects of lowering lipid, softening blood vessels and preventing vascular diseases can be better exerted.

The invention discloses a fat-reducing composition as well as a preparation method and application thereof. The fat-reducing composition comprises a hippophae rhamnoides leaf extract and a first mixed component and / or a second mixed component, wherein the first mixed component comprises an ampelopsis grossedentata extract and a fructus momordicae extract, the second mixed component comprises first coffee freeze-dried powder and second coffee freeze-dried powder, and the second coffee freeze-dried powder contains chlorogenic acid. The preparation method of the fat-reducing composition comprises the step of mixing all the components. All the components of the fat-reducing composition provided by the invention have a better fat-reducing effect through synergistic interaction, all the components belong to safe and side-effect-free components, dependence is not generated, and fat can be reduced more effectively.

The invention provides a molecular marker and a primer group for identifying male and female sea-buckthorn plants and application of the molecular marker and the primer group, and relates to the technical field of molecular markers. The molecular marker is located in a specific interval of a second chromosome of male sea-buckthorn, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1. The nucleotide sequences of a primer group designed aiming at the molecular marker are as shown in SEQ ID NO.2 and SEQ ID NO.3. The invention further discloses a kit for detecting the molecular marker. The primer group provided by the invention is used for amplifying the DNA of the hippophae rhamnoides genome under a given PCR (Polymerase Chain Reaction) condition, a specific 341bp band can be obtained from a male hippophae rhamnoides plant, and a female hippophae rhamnoides does not generate the specific band. Therefore, the molecular marker is stable in amplification and can be used for sex judgment of sea-buckthorn plants.

The invention discloses a composite plant polypeptide composition with the effects of repairing pancreas and reducing blood sugar. The traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 10 to 50 parts of ginsenoside, 5 to 30 parts of radix astragali seu hedysari extract, 3 to 20 parts of radix rehmanniae polysaccharide, 2 to 15 parts of radix trichosanthis alkaloid, 5 to 25 parts of rhizoma dioscoreae polysaccharide, 5 to 30 parts of bitter gourd polypeptide, 3 to 20 parts of folium mori alkaloid, 8 to 40 parts of rhizoma polygonati polysaccharide, 5 to 25 parts of fructus hippophae flavone, 10 to 35 parts of wheat germ peptide, 2 to 15 parts of coptis berberine, 10 to 45 parts of corn stigma polysaccharide and 3 to 20 parts of saussurea involucrata polyphenol. 1-10 parts of sophora flavescens total alkaloids, 5-25 parts of a dendrobium extract, 5-30 parts of a radix puerariae extract, 8-35 parts of L-arabinose and 10-40 parts of small molecule peptides; 20 to 100 parts of collagen peptide and 15 to 80 parts of albumin peptide; 5-50 parts of microcrystalline cellulose, 3-30 parts of fructo-oligosaccharide and 0.5-5 parts of magnesium stearate; the limitation of single sugar control or simple component mixing in the prior art is broken through, a synergistic system of plant active components and functional polypeptides is constructed, and the purity and retention rate of the plant active components are improved by optimizing the extraction process.

The invention discloses a folding and unfolding device for harvesting hippophae rhamnoides fruit branches, relates to the technical field of agricultural machinery, and solves the problems that existing equipment lacks enough flexibility in the operation process, the harvesting angle and the operation range cannot be freely adjusted, and the existing equipment cannot fully adapt to different hippophae rhamnoides planting line spacing and terrains. The folding and unfolding device comprises a turnover device and a rotary supporting bearing, folding and unfolding can be conducted through control of a hydraulic system between the equipment working state and the equipment non-working state, a unique folding and unfolding mechanism is adopted, and the device is unfolded to cover a large working range in the working state; in a non-working state, the device can be contracted to a compact size through the folding and unfolding mechanism, so that road transportation and storage are facilitated. Through the design, the problem of conversion of mechanical equipment between a field and a transportation scene is effectively solved, and the adaptability and flexibility of the equipment are improved.

Hippophae rhamnoides peel polysaccharides, and a preparation method therefor and a use thereof. The hippophae rhamnoides peel polysaccharides comprise the following monosaccharides: rhamnose, mannose, galactose, glucose, galacturonic acid, and arabinose. The preparation method comprises: degreasing, extracting, concentrating and performing alcohol precipitation to obtain water-soluble crude polysaccharides; and then using a non-polar macroporous adsorption resin to perform purification to obtain hippophae rhamnoides peel polysaccharides. The yield and content of the polysaccharides are high. By using the non-polar microporous adsorption resin to replace a relatively costly DEAE-cellulose and Sephadex gel, active polysaccharides in the Hippophae rhamnoides peel are enriched, the yield and purity of the polysaccharides are also greatly improved, and the polysaccharides have low production costs and are used for industrial batch production. The hippophae rhamnoides peel polysaccharides have significant effects of resisting ulcerative colitis, and alleviating constipation, indigestion, and intestinal flora disorder.

The invention discloses a hippophae rhamnoides composition for dispelling effects of alcohol and a hippophae rhamnoides plant The hippophae rhamnoides fruit composition comprises the following components by weight: 16g of hippophae rhamnoides fruit primary pulp, 0.1 g of globe artichoke juice powder, 0.45 g of ampelopsis grossedentata leaf instant powder, 0.01 g of rhizoma curcumae longae, 0.02 g of radix puerariae powder and 0.03 g of hovenia dulcis thunb powder. The hippophae rhamnoides composition for dispelling the effects of alcohol is prepared from the following six ingredients: hippophae rhamnoides, radix puerariae, hovenia dulcis thunb, globe artichoke, ampelopsis grossedentata leaves and turmeric, so that the hippophae rhamnoides composition has the effects of nourishing the liver to promote digestion, clearing heat, promoting diuresis, promoting the circulation of qi, harmonizing blood, dissolving turbidity, reducing lipid and relieving Meanwhile, the hippophae rhamnoides plant drink can effectively relieve shielding damage of ethanol to gastrointestinal tracts, reduce the levels of serum ALT and AST after drinking, relieve oxidative stress of the liver, also has a certain improvement effect on balance movement and learning and memory ability damage caused by drinking, and has a relatively comprehensive hangover alleviating effect.

The invention discloses hippophae rhamnoides polysaccharide with the activity of reducing blood sugar and blood fat as well as a preparation method and application thereof. Adding water into the degreased hippophae rhamnoides, adjusting the pH value to be acidic, then heating, stirring and extracting under an ultrasonic condition, and collecting filtrate; and performing post-treatment to obtain the sea-buckthorn polysaccharide. The content of neutral sugar in the sea buckthorn polysaccharide is 25.31%-30.68%, the content of uronic acid in the sea buckthorn polysaccharide is 54.66%-59.79%, and the content of protein in the sea buckthorn polysaccharide is 1.91%-2.14%. According to the method, the sea-buckthorn polysaccharide is extracted by adopting acid assistance-ultrasonic extraction, and the prepared sea-buckthorn polysaccharide has remarkable blood sugar and blood fat reducing activity. When the concentration of the sea-buckthorn polysaccharide is as low as 0.1 mg / mL, the glucose uptake of HepG2-IR cells can still be obviously improved, and the content of total cholesterol and total triglyceride of the HepG2-IR cells can be obviously reduced. The hippophae rhamnoides polysaccharide can be applied to preparation of food or medicine for reducing blood sugar and / or blood fat.

The invention relates to a method for in-situ synthesis of a bacterial cellulose membrane by using a hippophae rhamnoides fruit juice additive, which comprises the following steps: juicing hippophae rhamnoides fruits to obtain fruit pulp, mixing the fruit pulp with deionized water, filtering to obtain hippophae rhamnoides fruit juice, adding the hippophae rhamnoides fruit juice into a culture medium, inoculating microorganisms into the culture medium, and further synthesizing the bacterial cellulose membrane. The bacterial cellulose membrane synthesized by the method is of a three-dimensional network structure, and the average diameter is 10-100nm; x-ray diffraction characterizes that the bacterial cellulose added with different hippophae rhamnoides fruit juice has a cellulose I structure, and has three characteristic diffraction peaks at 2theta of 14.5 degrees, 16.7 degrees and 22.7 degrees. Through jade software calculation, it is found that the crystallinity of the bacterial cellulose added with the hippophae rhamnoides fruit juice is not greatly different from that of the bacterial cellulose not added with the The synthesis method is simple, convenient, efficient, green and environmentally friendly, the yield of the bacterial cellulose can be remarkably increased, and the obtained bacterial cellulose membrane is stable in structure and good in crystallinity and has good application prospects.

The invention discloses a sea-buckthorn small molecule peptide and a preparation method thereof, and relates to the field of biological medicine and food processing. According to the method, sea-buckthorn pulp residues and sea-buckthorn seed residues are used as composite raw materials and are mixed and stirred to form homogenate, and then cell wall structures are destroyed through ultrasonic wall breaking treatment to release protein components; then cutting off a peptide bond under the action of compound enzymes (plant protease, neutral protease and pepsase) by adopting an ultrasonic-enzyme synergistic hydrolysis process to generate a small molecule peptide fragment; after removing impurities through centrifugal separation, purifying through an ultrafiltration membrane (the molecular weight cut-off is 1-3kDa) to obtain a small molecule peptide solution; and performing debitterizing treatment by using macroporous adsorption resin, and preparing sea-buckthorn small molecule peptide powder by using a vacuum freeze-drying technology. According to the method, through ultrasonic-enzyme synergistic interaction, multi-stage purification combination and low-temperature keep-alive processes, the yield, molecular weight uniformity and antioxidant activity of small molecular peptides are remarkably improved, and high-valued utilization of sea-buckthorn processing by-products is achieved.

The invention discloses a specific primer for sex identification of hippophae rhamnoides, an identification method and application of the specific primer, the specific primer for sex identification of hippophae rhamnoides comprises a Higy04 primer pair or a Higy06 primer pair, the Higy04 primer pair comprises a forward primer Higy04F: 5 '-CCCCTATAGTCACACCAACAC-3', a reverse primer Higy04R: 5 '-ATCCCATGATCATACCATAC-3', a reverse primer Higy04R: 5 '-ATCCCATGATATCATACCATAC-3', a reverse primer Higy04R: 5 '- The primer pair of the Higy06 comprises a forward primer of Higy06F: TAATCTGGTGCCTTCGATCAATT, and a reverse primer of Higy06R: TCTGTACAATTTATGCAGCACCAC, and the primer pair of the Higy06 comprises a forward primer of Higy06F: TAATCTGGTGCCTTCGATCATT, a reverse primer of Higy06R: The invention makes an important breakthrough in the development of the sex-specific molecular marker of the sea-buckthorn, has the remarkable advantages of high efficiency, strong universality, high accuracy, reliability and practicability, and can meet the urgent needs of breeding, cultivation and research of the sea-buckthorn.

The invention relates to a traditional Chinese medicine preparation for treating climacteric syndrome and a preparation method of the traditional Chinese medicine preparation. Hippophae rhamnoides fruit oil comprises the following effective components in parts by weight: 80-150 parts of palmitic acid, 110-120 parts of palmitoleic acid, 90-110 parts of oleic acid, 0.9-1.3 parts of vitamin E, 0.2-0.5 part of total fatty acid, 90-110 parts of linoleic acid, 100-120 parts of alpha-linolenic acid, 12-18 parts of total flavonoids of hippophae rhamnoides fruits, 16-25 parts of total amino acid, 3-8 parts of alpha-tocopherol and 3-6 parts of ferulic acid. Through the improved enzymolysis process, the contents of vitamin E, total fatty acid, linoleic acid, alpha-linolenic acid, total flavonoids of hippophae rhamnoides, total amino acid, alpha-tocopherol and ferulic acid in the prepared hippophae rhamnoides fruit oil are obviously increased. The traditional Chinese medicine preparation soft capsule is feasible and reasonable in formula, simple and feasible in preparation process and wide in market application prospect.

The hippophae rhamnoides fruit source nourishing paste is prepared from the following raw materials in parts by weight: 40 to 60 parts of fructus crataegi, 3 to 7 parts of hippophae rhamnoides fruit, 50 to 70 parts of white hyacinth bean, 140 to 160 parts of semen coicis, 25 to 35 parts of rhizoma dioscoreae, 50 to 70 parts of endothelium corneum gigeriae galli, 90 to 110 parts of poria cocos, 25 to 35 parts of fructus amomi, 50 to 70 parts of malt, 50 to 70 parts of fructus ziziphi jujubae, 50 to 70 parts of pericarpium citri reticulatae and 40 to 60 parts of isomaltooligosacharide. According to the sea-buckthorn source nourishing paste, sea-buckthorn and poria cocos are used as monarch drugs together to achieve the effects of tonifying spleen, eliminating dampness and repairing stomach and viscera together; the coix seeds, the white hyacinth beans and the Chinese yams are used as ministerial drugs and cooperate with one another, so that the spleen-tonifying and dampness-eliminating effects of the monarch drugs are enhanced, and both qi and yin are nourished; hawthorn, endothelium corneum gigeriae galli, malt, fructus amomi and pericarpium citri reticulatae are used as conductant drugs and emphasize on promoting digestion and removing food stagnation, promoting the circulation of qi and removing dampness, and food retention and qi stagnation associated with spleen deficiency are solved; the Chinese dates and the isomaltooligosacharide are used for regulating medicine properties and protecting intestinal microecology; the effects of nourishing the spleen and the stomach are achieved.

The utility model discloses a hippophae rhamnoides fruit pulp fermentation device which comprises a fermentation tank, a supporting mechanism assembled on the outer side of the fermentation tank and a stirring mechanism assembled in the fermentation tank, the stirring mechanism comprises a rotating frame rotationally installed at the center position of the bottom of the fermentation tank, and a fixing column is fixedly installed at the top of the rotating frame. Spiral blades are fixedly installed on the outer side of the fixing column, and cutting knives are fixedly installed on the outer side of the fixing column and located between the spiral blades. According to the sea-buckthorn fruit pulp fermentation device, sea-buckthorn fruit pulp can flow on the surfaces of the heat conduction blocks, heat can be directly transferred to the sea-buckthorn fruit pulp through the multiple heat conduction blocks for rapid heating, meanwhile, the sea-buckthorn fruit pulp can pass through the through holes, the contact area of the sea-buckthorn fruit pulp and the heat conduction blocks can be increased, and the heat conduction efficiency is improved. The fructus hippophae pulp can be uniformly heated, so that the fermentation effect of the fructus hippophae pulp is improved.

The utility model relates to the related technical field of fruit juice filling, in particular to a sea-buckthorn fruit juice primary pulp filling machine which comprises a filling table, and a stirring mechanism is arranged at one end of the filling table. According to the hippophae rhamnoides fruit juice primary pulp filling machine, through the arrangement of the fixing frame, the liquid storage tank, the motor, a rotating rod, a rotating plate, a connecting column, a first gear, a first connecting rod, a second gear, a third gear and a second connecting rod, the motor is started during filling, and the motor enables the rotating rod to drive the rotating plate to rotate; at the moment, a second gear connected with the first gear in a meshed mode drives a first connecting rod and a third gear to rotate, a fourth gear connected with the third gear in a meshed mode drives a second connecting rod and a rotating block to rotate, and a rotating column at one end of the rotating block and a stirring frame rotate with the second connecting rod as the center; at the moment, the stirring frame also rotates by taking the rotating rod as the center, so that the hippophae rhamnoides fruit juice can be efficiently and comprehensively stirred, and the hippophae rhamnoides fruit juice is prevented from precipitating in the liquid storage tank to influence the taste.

The invention provides a ginseng compound beverage and a preparation method thereof, and relates to the field of food preparation and processing. The ginseng compound beverage is prepared by taking 0.8 g of ginseng, 5.0 g of fried hippophae rhamnoides leaves, 5.0 g of medlar, 0.7 g of astragalus membranaceus and 0.5 g of gastrodia elata as raw materials, adding 15mL of plant water extract, 0.7500 g of flavoring agent erythritol, 0.3000 g of xylitol, 0.0450 g of acesulfame potassium, 0.0075 g of DL-malic acid, 0.0375 g of edible salt and 0.0080 g of taurine according to a material-liquid ratio of 1: 40g / ml, and adding water to 150mL. Meanwhile, the bitter taste of the raw materials such as the ginseng and the scorched taste of the fried hippophae rhamnoides leaves are eliminated, so that the beverage is fragrant in sense and the cost is reduced. The prepared beverage is simple in process and has the effects of resisting oxidation and reducing uric acid.

The invention belongs to the technical field of feed processing, and provides a periplaneta americana nymph feed and a preparation method thereof. The feed for the periplaneta americana nymphs comprises the following raw materials: basic grains, composite acid-base materials and composite Chinese herbal medicines. The preparation method comprises the following steps: (1) cleaning hippophae rhamnoides leaves, lemon leaves, shaddock peel and tartary buckwheat, drying, and crushing to obtain hippophae rhamnoides leaf powder, lemon leaf powder, shaddock peel powder and tartary buckwheat powder; (2) mixing and crushing the solid raw materials, adding phosphoric acid and sodium bicarbonate, and uniformly mixing to obtain a premix; and (3) adding hot water into the premix, uniformly stirring, cooling, steaming in a steamer, covering with a thermal insulation material, and stacking at normal temperature. According to the feed for the nymphs, the formula of the feed is improved, so that the absorption and digestion of the feed nutrient substances by the nymphs of the cockroaches can be remarkably improved, and the adult cockroaches which are shorter in nymph period, better in growth and development and higher in nutritional value can be obtained. The preparation method is easy to operate, beneficial to improving the fertilizer efficiency and suitable for large-scale production.

The invention discloses an edible and medicinal compound hippophae rhamnoides flavone concentrated plant beverage and a preparation method thereof, belongs to the technical field of plant beverages, and aims to solve the problems that an existing hippophae rhamnoides product is single in function, high in sugar and low in flavone content, and centrifugal equipment is easy to block, poor in sealing and difficult to maintain. The invention provides a beverage formula which comprises the following components in parts by weight: 11-15 parts of hippophae rhamnoides raw pulp, 2-4 parts of erythritol, 11-13 parts of edible and medicinal compound water extract concentrated solution and 0.001-0.003 part of stevioside. The preparation method provided by the invention comprises the following steps: performing low-temperature quick-freezing, fine grinding, high-efficiency centrifugation and high-pressure homogenization preparation on sea-buckthorn primary pulp, performing staged micro-boiling extraction on an edible and medicinal compound water extraction concentrated solution, and then mixing in proportion; a special centrifugal device in the preparation method is provided with a double-anti-blocking, double-sealing and closed-loop rigid frame, and the beverage is high in flavone content, low in sugar, safe, synergistic in function, efficient, stable and easy to maintain, can solve industrial pain points and has remarkable technical innovation and application value.

The invention discloses a sea-buckthorn-derived T5H gene and application of an encoding protein thereof in improving the cold resistance of plants, and belongs to the technical field of biology. The hippophae rhamnoides-derived T5H gene and the encoded protein thereof can enhance the survival rate and cold resistance of plants (such as crops) under low-temperature stress, and have wide application prospects and popularization values in agricultural production practice.

The utility model discloses a hippophae rhamnoides fertilizing device, which belongs to the technical field of agricultural instruments and comprises a storage box, a storage chamber is arranged in the storage box, a guide chute is arranged at the bottom of an inner cavity of the storage chamber, a stirring mechanism is arranged on the storage box, and a spraying mechanism is arranged on the storage box. Two supports are fixedly connected to the bottom face of the storage box, a double-shaft motor is fixedly installed on the bottom face of the storage box, and two output shafts of the double-shaft motor extend to the outer sides of the supports correspondingly and are fixedly connected with driving wheels in a sleeving mode. According to the hippophae rhamnoides fertilizing device, the double-shaft motor is used for driving the driving wheel to rotate, the driving wheel is used for driving the storage box to move, the first motor is used for driving the steering wheel to rotate, and the steering wheel is used for adjusting the moving direction of the storage box, so that the hippophae rhamnoides fertilizing device can automatically move, and it is guaranteed that the device can be conveniently moved to the outside of hippophae rhamnoides fertilizing; the hippophae rhamnoides can be conveniently fertilized

The invention relates to the technical field of tea powder preparation, in particular to beauty-maintaining hippophae rhamnoides fruit tea powder and a preparation method thereof.The beauty-maintaining hippophae rhamnoides fruit tea powder is prepared from, by weight, 20-40 parts of hippophae rhamnoides fruit extract, 5-15 parts of pearl powder, 10-20 parts of rose fruit powder, 15-30 parts of xylooligosaccharide and 0.5-2 parts of sodium hyaluronate; the sea-buckthorn extract, the pearl powder, the rose fruit powder, the xylooligosaccharide and the sodium hyaluronate are selected for scientific compatibility, and the raw materials form a synergistic effect on beautifying effects, so that respective natural beautifying characteristics can be exerted, mutual promotion can be realized, superposition and complementation of the effects are realized, and the comprehensive beautifying value of the product is comprehensively improved; moreover, the sea-buckthorn is extracted by adopting a supercritical carbon dioxide extraction technology and is matched with a specific entrainer, so that active ingredients in the sea-buckthorn can be efficiently extracted under mild conditions, ingredient damage caused by high temperature or a chemical solvent in a traditional extraction method is avoided, and natural effects of the sea-buckthorn are completely reserved.

The invention discloses a water resource recycling method for an arid region, which belongs to the technical field of water resource recycling and comprises the following steps of S1, site selection and laying, S2, installation and butt joint, S3, planting, S4, working, S5, backflow and S6, maintenance. By recycling moisture-containing air generated during transpiration of sea-buckthorn crops planted in a greenhouse and moisture-containing air generated by evaporation of internal moisture of external sandy soil through direct solar radiation in the daytime, the problem of water resource shortage in arid regions can be effectively relieved, and agricultural development in the arid regions can also be supported. Meanwhile, due to the fact that the arid region is windy and dusty, the greenhouse can serve as a barrier to block the windy and dusty sand and reduce the damage of the windy and dusty sand, in addition, due to artificial planting of the hippophae rhamnoides, excessive collection of the wild hippophae rhamnoides is effectively reduced, and ecological balance is protected.

The invention provides a plant lactobacillus and application thereof. The first aspect of the invention provides the plant lactobacillus, the plant lactobacillus is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC NO.28495. The invention also provides a preparation method of the plant lactobacillus. According to the plant lactobacillus provided by the invention, the content of flavonoid compounds in a plant fermentation product can be increased by at least 10%, specifically, the content of isorhamnetin in a hippophae rhamnoides fermentation product can be increased to 7 times of that before fermentation, and the content of isorhamnetin in the hippophae rhamnoides fermentation product can be increased by at least 10%. The content of quercetin-3-O-sophorobiose-7-O-rhamnoside in a mulberry leaf fermentation product can be increased to 7.5 times that of the folium mori fermentation product before fermentation, the content of isorhamnetin-3-O-sophorobiose-7-O-rhamnoside in a hawthorn fermentation product can be increased to 1.1 times that of the hawthorn fermentation product before fermentation, and the method has the advantages of being low in cost, environmentally friendly, efficient and the like.

The utility model discloses a hippophae rhamnoides oil microcapsule granulation device, which belongs to the technical field of microcapsule granulation and can realize integral screening treatment of particles in the subsequent granulation process, improve the integral practicability of the device and avoid secondary screening of the particles as much as possible. The hippophae rhamnoides oil microcapsule granulation device comprises a granulation cylinder, a material guiding pipe is installed at the bottom of the granulation cylinder, a screening cylinder is installed at the bottom of the material guiding pipe, a discharging pipe is installed at the bottom of the screening cylinder, the granulation cylinder, the material guiding pipe, the screening cylinder and the discharging pipe are internally communicated, a liquid guiding pipe is installed at the center of the top of the granulation cylinder, and an atomization spraying head is installed at the bottom of the liquid guiding pipe. An exhaust pipe is mounted at the top of the granulation cylinder, a collecting cover is mounted at the inner top of the granulation cylinder, the collecting cover is connected with the exhaust pipe, and a hot air assembly for assisting drying and granulation is mounted in the granulation cylinder; a filtering assembly assisting in screening is fixed in the screening cylinder, and a discharging assembly assisting in particle conveying out is installed in the discharging pipe.

To provide a cosmetic composition that exhibits superior moisture retention and smooths the skin and hair without causing a sticky sensation.SOLUTION: A cosmetic composition comprises (A) at least one selected from olive oil, shea butter, Hippophae rhamnoides seed oil, peppermint oil, orange oil, or jasmine oil, and (B) at least one selected from Prunus yedoensis extract, artichoke extract, or rosemary extract, where the content of the component (A) is 0.001 to 10 mass%, and the content of the component (B) is 0.0001 to 0.2 mass% (based on solid content).SELECTED DRAWING: None

The invention relates to a method for promoting growth, nodulation and nitrogen fixation of indigofera pseudotinctoria by utilizing rhizobium D303 and a bacterial solution thereof. The biological preservation number of the rhizobium sp. D303 is CCTCC (China Center for Type Culture Collection) NO: M20252803. Pot culture tie-back tests prove that the indigofera pseudotinctoria seedlings inoculated with the rhizobium are obviously superior to a control group in the aspects of plant height, root length, overground dry weight, underground dry weight, root nodule number, root nodule weight, root nodule diameter, nitrogenase activity, antioxidant enzyme activity and the like. The rhizobium strain provided by the invention has efficient nodulation and nitrogen fixation capability and excellent growth promoting characteristic, obviously improves the growth speed, nodulation capability and nitrogen fixation efficiency of the indigofera pseudotinctoria, reduces the dependence on chemical nitrogen fertilizer, and has a broad application prospect in development of special biological bacterial fertilizer for indigofera pseudotinctoria. The method has important ecological and economic benefits for promoting the application of the indigofera pseudotinctoria in ecological restoration and feed production, and is suitable for slope greening, water and soil conservation and barren mountain ecological restoration projects.

The invention relates to a method for establishing an agrobacterium tumefaciens-mediated halostachys sieboldii transient transformation system, and belongs to the technical field of plant genetic engineering. The method comprises the following steps: culture of aseptic seedlings, acquisition of explants, preparation of an infection solution containing agrobacterium tumefaciens, agrobacterium tumefaciens infection, co-culture, GFP verification and GUS staining. The method disclosed by the invention is simple and convenient to operate, short in period and capable of realizing high-efficiency expression of the target gene in the halostachys sieboldii tissue. According to the system, an instantaneous transformation platform is established in the halostachys sieboldii for the first time, and a key technical support is provided for functional analysis and stress resistance molecular mechanism research of the halostachys sieboldii.

The utility model discloses a hippophae rhamnoides pruning and smashing device, which belongs to the technical field of hippophae rhamnoides pruning and comprises a storage box, a smashing box is fixedly sleeved on the top of the storage box, a telescopic pipe is fixedly sleeved on the top of the smashing box, and a pruning cylinder is fixedly connected at the top end of the telescopic pipe. According to the hippophae rhamnoides pruning device, the storage box is pulled to the side portion of hippophae rhamnoides through cooperation of the moving wheels and the handle, the first motor is started to drive the first conical column and the pruning knife to rotate, the handle is held by hand to pull the pruning barrel, branches needing to be pruned stretch into an inner cavity of the pruning barrel, and the branches are pruned through the rotating pruning knife; the smashing box, the telescopic pipe and the pruning cylinder generate suction force through the air suction pump, the pruned branches are sucked into the storage box through the suction force of the pruning cylinder, the functions of convenient pruning and storage are achieved, and the problem that the convenience is not good enough when scissors are manually taken for pruning is solved.