KASP molecular marker KASPAR-FwC9 for identifying pea fusarium wilt resistance gene FwC9 and application of KASP molecular marker KASPAR-FwC9

Abstract

The invention discloses a KASP molecular marker KASPar-FwC9 for identifying a pea fusarium wilt resistance gene FwC9 and application of the KASP molecular marker KASPar-FwC9. The invention further discloses an SNP site related to pea wilt resistance, the SNP site is located at the 277th site of the wilt-resistant gene FwC9 shown in the sequence 1, the polymorphism of the site is G / A, and the KASP molecular marker KASar-FwC9 co-separated from the wilt-resistant gene FwC9 is developed on the basis of the SNP site. The identification and variety breeding efficiency of the pea fusarium wilt resistance germplasm resources containing the fusarium wilt resistance gene FwC9 is greatly improved, auxiliary selection is provided for pea fusarium wilt resistance breeding, and the fusarium wilt resistance breeding work process is accelerated.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a KASP molecular marker KASPar-FwC9 for identifying a pea wilt-resistance gene FwC9 and an application thereof. Background Art

[0002] Pea wilt, caused by Fusarium oxysporum f.sp. pisi, is a major disease that impedes pea production. It occurs in all pea-producing areas of my country and causes severe damage. The pathogen can infect peas at all stages of growth, causing leaf curling, chlorosis, browning of vascular bundles, plant wilt, and death. Yields in affected fields typically decrease by 25%, and in severe cases, by more than 50%, or even total crop failure. Currently, global economic losses from pea wilt exceed US$200 million annually.

[0003] Planting pea varieties resistant to wilt is the most economical, effective, and environmentally safe method for controlling pea wilt. Developing molecular markers linked to pea wilt-resistance genes can facilitate targeted selection of pea varieties, improve target traits, and enhance breeding efficiency. It can also screen pea varieties and strains for resistance, providing resistance resources for variety selection and accelerating the breeding process. Therefore, it is necessary to vigorously explore and utilize disease-resistance genes to develop new and efficient molecular markers for identifying and screening pea wilt resistance.

[0004] KASP (Kompetitive allele-specific PCR) achieves genotyping by using fluorescent probes to specifically identify gene loci. It can be used to detect single nucleotide polymorphisms (SNPs) and indels (InDels). KASP markers, with their exceptional accuracy, flexibility, and cost-effectiveness, are widely used in the precise mapping of plant trait genes, molecular-assisted breeding, and seed resource identification. Summary of the Invention

[0005] The present invention aims to provide a SNP site for identifying pea wilt resistance, and a KASP molecular marker KASPar-FwC9 for identifying pea wilt resistance developed based on the SNP site. The KASP molecular marker KASPar-FwC9 can be used to identify whether the pea to be tested contains the wilt resistance gene FwC9, and can be used to screen pea wilt-resistant germplasm resources, varieties, lines or individual plants containing the wilt resistance gene FwC9.

[0006] In a first aspect, the present invention claims a method for identifying or assisting in identifying resistance to pea blight.

[0007] The method for identifying or assisting in identifying resistance to fusarium wilt in peas claimed in the present invention comprises the following steps: detecting whether the genotype of the pea to be tested is a GG genotype, a GA genotype, or an AA genotype, and determining whether the pea to be tested contains a fusarium wilt resistance gene FwC9 according to the genotype of the pea to be tested: if the pea to be tested is a TT genotype or a TC genotype, it indicates that the pea to be tested contains the fusarium wilt resistance gene FwC9 and exhibits or is a candidate for exhibiting resistance to fusarium wilt; if the pea to be tested is a CC genotype, it indicates that the pea to be tested does not contain the fusarium wilt resistance gene FwC9 and exhibits or is a candidate for exhibiting resistance to fusarium wilt or susceptible to fusarium wilt;

[0008] The GG genotype is a homozygous body in which the 277th deoxyribonucleotide corresponding to sequence 1 in the pea genome is all G;

[0009] The GA genotype is a hybrid of G and A corresponding to the 277th deoxyribonucleotide in sequence 1 in the pea genome;

[0010] The AA genotype is a homozygous body in which the 277th deoxyribonucleotide corresponding to sequence 1 in the pea genome is all A.

[0011] In the above method, the method for detecting whether the pea genotype to be tested is a GG genotype, a GA genotype, or an AA genotype may include the following steps: using the genomic DNA of the pea to be tested as a template, using a primer set to perform PCR amplification, scanning the obtained amplification product for a fluorescence signal, and determining whether the pea genotype to be tested is a GG genotype, a GA genotype, or an AA genotype based on the fluorescence signal.

[0012] Furthermore, the method for determining whether the pea genotype to be tested is a GG genotype, a GA genotype, or an AA genotype based on the fluorescence signal comprises the following steps: after PCR amplification is completed, fluorescence signal processing is performed using a Douglas-Araya high-throughput pipeline fluorescence signal scanner, and genotyping results are exported using Douglas's dedicated Kraken software, thereby determining whether the pea genotype to be tested is a GG genotype, a GA genotype, or an AA genotype: if the fluorescence signal data of the amplified product of the pea to be tested appears red after software analysis, the genotype of the pea to be tested is an AA genotype; if the fluorescence signal data of the amplified product of the pea to be tested appears blue after software analysis, the genotype of the pea to be tested is a CC genotype; if the fluorescence signal data of the amplified product of the pea to be tested appears green after software analysis, the genotype of the pea to be tested is a GA genotype.

[0013] Furthermore, the primer set consists of an upstream primer F1, an upstream primer F2 and a downstream primer R;

[0014] The upstream primer F1 is a single-stranded DNA shown in sequence 2;

[0015] The upstream primer F2 is a single-stranded DNA shown in sequence 3;

[0016] The downstream primer R is a single-stranded DNA shown in Sequence 4.

[0017] In the above method, the reaction system for PCR amplification can be 0.8 μL of pea genomic DNA (22.2 ng / μL), 0.022 μL of KASP Primer Mix, 0.4 μL of KASP V4.0 2×Mastermix 1536, and 0.4 μL of ddH2O.

[0018] The PCR amplification program can be as follows: heat activation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, annealing and extension at 61-55°C for 60 seconds, 10 cycles, with a decrease of 0.6°C per cycle; denaturation at 94°C for 20 seconds, annealing and extension at 55°C for 60 seconds, 26 cycles, and storage at 12°C.

[0019] In a second aspect, the present invention claims a new use of a substance for detecting the genotype of a pea SNP site to be tested.

[0020] The present invention claims the use of a substance for detecting the genotype of a pea SNP site to be tested in any one of the following (a1) to (a12):

[0021] (a1) identifying or assisting in identifying whether the pea to be tested contains the wilt resistance gene FwC9;

[0022] (a2) preparing a product for identifying or assisting in identifying whether the pea to be tested contains the wilt resistance gene FwC9;

[0023] (a3) identifying or assisting in identifying resistance to pea wilt;

[0024] (a4) preparing a product for identifying or assisting in identifying resistance to pea wilt;

[0025] (a5) screening or assisting in screening pea germplasm resources, varieties, lines or individual plants containing the wilt resistance gene FwC9;

[0026] (a6) preparing products for screening or assisting in screening pea germplasm resources, varieties, lines or individual plants containing the wilt resistance gene FwC9;

[0027] (a7) screening or assisting in screening pea germplasm resources, varieties, strains or individual plants resistant to wilt disease;

[0028] (a8) preparing products for screening or assisting in screening pea germplasm resources, varieties, strains or individual plants resistant to wilt;

[0029] (a9) Improving pea germplasm resources, varieties, strains or individual plants;

[0030] (a10) preparing products that improve pea germplasm resources, varieties, strains or individual plants;

[0031] (a11) Pea breeding;

[0032] (a12) preparing pea breeding products;

[0033] The SNP site is the 277th deoxyribonucleotide in the pea genome corresponding to the DNA molecule described in sequence 1.

[0034] In a third aspect, the present invention claims protection for any one of the following products (b1) to (b3):

[0035] (b1) the above primer set;

[0036] (b2) a PCR reagent containing the primer set described in (b1);

[0037] (b3) A kit comprising the primer set described in (b1) or the PCR reagent described in (b2).

[0038] Furthermore, the kit may further include at least one of KASP V4.0 2×Mastermix 1536, ddH2O, a standard positive template, and the like.

[0039] The application of the above product in any of the following (c1)-(c6) also falls within the scope of protection of the present invention:

[0040] (c1) identifying or assisting in identifying whether the pea to be tested contains the wilt resistance gene FwC9;

[0041] (c2) identifying or assisting in identifying resistance to pea wilt;

[0042] (c3) screening or assisting in screening pea germplasm resources, varieties, lines or individual plants containing the wilt resistance gene FwC9;

[0043] (c4) screening or assisting in screening pea germplasm resources, varieties, lines or individual plants resistant to wilt disease;

[0044] (c5) Improving pea germplasm resources, varieties, strains or individual plants;

[0045] (c6) Pea breeding.

[0046] The fourth invention claims a method for screening or assisting in screening pea germplasm resources, varieties, lines or individual plants that are resistant to wilt.

[0047] The method for screening or auxiliary screening of pea germplasm resources, varieties, lines or individual plants resistant to wilt disease claimed in the present invention comprises the steps of selecting pea germplasm resources, varieties, lines or individual plants of GG genotype or GA genotype;

[0048] The GG genotype is a homozygous body in which the 277th deoxyribonucleotide corresponding to sequence 1 in the pea genome is all G;

[0049] The GA genotype is a hybrid of G and A corresponding to the 277th deoxyribonucleotide of sequence 1 in the pea genome.

[0050] In a fifth aspect, the present invention claims a method for improving pea germplasm resources, varieties, lines or individual plants.

[0051] The method for improving pea germplasm resources, varieties, lines or individual plants claimed in the present invention comprises the step of breeding using the pea germplasm resources, varieties, lines or individual plants resistant to wilt disease screened according to the above method as breeding materials.

[0052] The application of any of the above methods in pea breeding also falls within the scope of protection of the present invention.

[0053] In any of the above applications or methods, the wilt-resistant pea germplasm resources, varieties, lines or individual plants are wilt-resistant pea germplasm resources, varieties, lines or individual plants containing the wilt-resistant gene FwC9.

[0054] In any of the above applications or methods, the pea breeding is molecular marker-assisted selection breeding, especially molecular marker-assisted breeding of pea offspring populations resistant to wilt disease. The purpose of the breeding is to select pea germplasm resources, varieties, lines or individual plants resistant to wilt disease.

[0055] In any of the above-described applications or methods, the peas or peas to be tested can be any pea germplasm resource, variety, strain, or individual plant. The germplasm resource can specifically be any of the 45 pea germplasm resources listed in Table 1. The individual plant can specifically be an individual plant of a progeny population (e.g., an individual plant of an F2 population) obtained by hybridizing a fusarium wilt-resistant strain, Chengwan No. 9-8, as the male parent, and a fusarium wilt-susceptible strain, Chengwan No. 9-1, as the female parent.

[0056] In any of the above-mentioned applications or methods, the nucleotide sequence of the wilt resistance gene FwC9 is shown in Sequence 1.

[0057] The beneficial effects of the present invention are as follows:

[0058] (1) The present invention precisely maps a new pea wilt resistance gene, FwC9, to pea chromosome 4. This gene has excellent resistance to Chinese pea wilt, can effectively control the occurrence of Chinese pea wilt, and reduce the yield loss caused by the disease.

[0059] (2) The present invention establishes a KASPar-FwC9 genotyping method based on the KASP molecular marker to distinguish different genotypes of FwC9, which can greatly improve the efficiency of identification and variety breeding of pea wilt-resistant germplasm resources containing the wilt-resistant gene FwC9.

[0060] (3) The KASP molecular marker KASPar-FwC9 provided by the present invention, which is co-segregated with the pea wilt resistance gene FwC9, is a molecular marker obtained in the F2 population of the hybrid offspring of the disease-resistant strain Chengwan No. 9 Chengwan No. 9-8, the susceptible strain Chengwan No. 9-1 and their stable resistance, and can be used for molecular marker-assisted selection of pea wilt-resistant offspring and identification of pea wilt-resistant resources.

[0061] (4) The KASP molecular marker KASPar-FwC9 provided by the present invention is co-segregated with the wilt resistance gene FwC9. Based on the co-segregated molecular markers and pea genome sequence information, these markers are subjected to haplotype analysis of the gene, and it is expected that new disease resistance genes can be cloned.

[0062] The present invention first uses the F2 population derived from a hybrid combination of Chengwan 9's disease-resistant strain Chengwan 9-8 and the susceptible strain Chengwan 9-1 as a mapping population. Based on the analysis results of whole-genome resequencing of the parents and the extremely susceptible mixed pool, candidate intervals and differential sites are initially obtained. Corresponding KASP molecular markers are then developed based on the differential sites within the candidate intervals for preliminary mapping. Finally, based on the preliminary mapping results, homozygous marker-genotype disease-resistant plants are selected to construct an extremely disease-resistant mixed pool for whole-genome resequencing. After analysis, the candidate intervals and differential sites are optimized, and the disease-resistance gene FwC9 is finely mapped to obtain the KASP molecular marker KASPar-FwC9, which co-segregates with the wilt-resistance gene FwC9. The KASP molecular marker KASPar-FwC9 obtained by the present invention greatly improves the efficiency of identifying pea wilt-resistant germplasm resources containing the wilt-resistance gene FwC9 and breeding varieties, providing auxiliary selection for pea wilt-resistance breeding and accelerating the progress of wilt-resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 These are the disease investigation results 28 days after inoculation of the pea wilt pathogen PF22b in the Chengwan No. 9 strain Chengwan No. 9-8 (CW9-8), Chengwan No. 9-1 (CW9-1), and F2 individual plants in Example 1 of the present invention.

[0064] Figure 2 This is the delta-SNP-Index result based on whole-genome parental and extreme pool resequencing analysis in Example 1 of the present invention.

[0065] Figure 3This is the genetic linkage map of the pea wilt resistance gene FwC9 in Example 1 of the present invention.

[0066] Figure 4 These are the typing results of FwC9 gene detection of some F2 plants of Chengwan 9-8 and Chengwan 9-1 and 45 pea resources using the KASP molecular marker KASPar-FwC9 in Example 1 of the present invention. DETAILED DESCRIPTION

[0067] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0068] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0069] Example 1. Development and Validation of KASP Molecular Marker KASPar-FwC9 Associated with Pea Wilt Resistance 1. Development of KASP Molecular Marker KASPar-FwC9 Associated with Pea Wilt Resistance

[0070] 1. Genetic analysis of resistance of Chengwan No. 9 strain

[0071] The wilt-resistant strain Cheng Wan No. 9-8 was used as the male parent and the wilt-susceptible strain Cheng Wan No. 9-1 was used as the female parent to produce 9 F1 generation plants. The F1 generation was then self-pollinated to obtain an F2 population consisting of 546 F2 plants. The F2 population was subjected to resistance genetic analysis, disease resistance gene location and mapping. The specific steps are as follows: Using the spore suspension root cutting inoculation method, each plant was inoculated with the pea wilt pathogen isolate PF22b. Resistance genetic analysis was performed based on the resistance phenotype of the 546 F2 plants. After inoculation, the plants were cultured in a greenhouse at 27°C for 28 days before disease investigation ( Figure 1 The wilt resistance of 546 F2 plants was identified according to the wilt resistance evaluation criteria in the literature "Deng D, Sun S, Wu W, Zong X, Yang X, Zhang X, He Y, Duan C, Zhu Z. Screening for pea germplasms resistant to Fusarium wilt race 5. Agronomy, 2022, 12(6): 1354." The segregation ratio of resistant and susceptible F2 plant families was investigated, and the inheritance pattern of resistance of Chengwan No. 9-8 to pea Fusarium wilt was studied.

[0072] The results of the resistance test of 546 individuals from 9 F2 families derived from the cross between Chengwan 9-8 and Chengwan 9-1 to the pea wilt isolate PF22b showed that among the 546 individuals, 396 were resistant and 150 were susceptible. The chi-squared fitness test of each individual F2 family and the combined family met the expected 3:1 (χ 2 =1.78, p=0.18), indicating that the resistance of Chengwan 9-8 to Fusarium wilt is controlled by a dominant single gene, which was named FwC9.

[0073] 2. Whole-genome resequencing analysis

[0074] The DNAsecure new plant genomic DNA extraction kit DP320 (TIANGEN BIOTECH, BEIJING) was used to extract genomic DNA from the parents and 546 F2 plants. The specific method was referred to the instructions. Equal amounts of DNA from the disease-resistant parent Chengwan 9-8 and the disease-susceptible parent Chengwan 9-1, as well as 15 homozygous susceptible individuals from 98 F2 plants obtained by self-pollination of one F1 plant, were mixed into a susceptible pool for whole-genome resequencing analysis. The specific analysis method was based on the method in the literature "Takagi H, AbeA, Yoshida K, Kosugi S, Natsume S, Mitsuoka C, Uemura A, Utsushi H, Tamiru M, TakunoS, Innan H, Cano L, Kamoun S, Terauchi R. QTL-seq: rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. The Plant Journal, 2013, 74(1), 174-183.", and candidate intervals for wilt resistance genes in Chengwan 9-8 were obtained.

[0075] By comparing the full genome sequence data of the sensor pool with that of the parents and calculating delta-SNP index values, candidate regions for disease resistance genes were identified. Results revealed multiple small intervals with large delta-SNP indices within the 201.4 Mb interval between base positions 243351840 and 444788063 on pea chromosome 4. KASP molecular markers were then developed based on the differentially expressed loci within these intervals. Initial mapping using the aforementioned 98 F2 plants revealed that two markers within the 292-309 Mb and 408-429 Mb intervals on pea chromosome 4 were linked to the disease resistance gene FwC9 in a small population of 98 F2 plants. Further development of KASP markers revealed that multiple markers within the 307-309 Mb and 424-426 Mb intervals were fully linked to the disease resistance gene FwC9 in this F2 population. Based on the initial mapping results, 15 homozygous disease-resistant plants in the F2 population were selected and mixed into a resistance pool for genome resequencing. The results were compared with the results of the susceptible pool. The method was the same as above. The results showed that the average delta-SNP-index was greater than 0.9 in the 305-309Mb and 424-426Mb intervals of pea chromosome 4. Figure 2 ), combined with the above F2 population mapping results and QTLseqr calculation results, the 308Mb and 425Mb and their nearby intervals were identified as candidate intervals for the disease resistance gene FwC9.

[0076] 3. Using KASP molecular markers to precisely locate the disease resistance gene FwC9 in Pea 9-8

[0077] KASP molecules and InDel markers were developed for population validation at differentially expressed loci at 308 Mb and 425 Mb and their adjacent regions. Mapmaker v3.0 software was used to analyze linkage relationships between markers and disease resistance genes. MapDraw v2.1 software was used to construct a genetic linkage map and finely map the disease resistance gene FwC9.

[0078] After verification of 546 F2 population individuals, it was found that 35 polymorphic KASP molecular markers met the segregation ratio of 3:1 or 1:2:1 in the F2 population by chi-square test. Genetic linkage analysis was performed using Mapmaker v3.0 software. Furthermore, 18 markers with a close genetic distance to FwC9 were selected and a genetic linkage map was drawn using MapDraw v2.1. The FwC9 gene was located between KASP molecular markers A016460 (0.2 cM) and A016663 (0.2 cM), and co-segregated with 9 pairs of KASP molecular markers, including KASPar-FwC9, A016459, and A016443, with a genetic distance of 0 cM ( Figure 3 ).

[0079] Through the above analysis, the present invention discovered a single nucleotide polymorphism (SNP) associated with resistance to pea wilt disease. This SNP is located at position 277 of the FwC9 gene (the nucleotide sequence of the FwC9 gene is shown in SEQ ID NO: 1). The polymorphism at this site is G / A. The KASP molecular marker KASPar-FwC9, developed based on this SNP, consists of the upstream primer KASPar-FwC9_F1_FAM, the upstream primer KASPar-FwC9_F2_HEX, and the downstream universal primer KASPar-FwC9_R. The primer sequences are as follows:

[0080] Upstream primer KASPar-FwC9_F1_FAM (the underlined sequence is the fluorescent signal tag of carboxyfluorescein FAM): 5'- GAAGGTGACCAAGTTCATGCT TCCATGAAGGTATCAACCCTTGT-3′ (SEQ ID NO: 2);

[0081] Upstream primer KASPar-FwC9_F2_HEX (the underlined sequence is the fluorescent signal tag of hexachlorofluorescein phosphoramidate HEX): 5'- GAAGGTCGGAGTCAACGGATT CCATGAAGGTATCAACCCTTGC-3′ (SEQ ID NO: 3);

[0082] Downstream universal primer KASPar-FwC9_R: 5'-CTACCCCATTTCAGCACCATCCAAA-3' (SEQ ID NO: 4).

[0083] Validation of the KASP molecular marker KASPar-FwC9 associated with pea wilt resistance

[0084] Test materials: 9 F2 populations with 546 individual plants.

[0085] Experimental method: The Douglas platform based on the LGC system used the KASP molecular marker KASPar-FwC9 in step 1 to perform genotyping on the test materials.

[0086] The PCR amplification reaction system (total volume of 1.6 μL) included 0.8 μL of pea genomic DNA (22.2 ng / μL), 0.022 μL of KASP Primer Mix, 0.4 μL of KASP V4.0 2× Mastermix 1536 (LGC Biosearch Technologies, catalog number KBS-1016-012), and 0.4 μL of ddH2O; the KASP Primer Mix included the upstream primer KASPar-FwC9_F1_FAM, the upstream primer KASPar-FwC9_F2_HEX, and the downstream universal primer KASPar-FwC9_R.

[0087] The PCR amplification reaction program was as follows: heat activation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 61-55°C for 60 s, 10 cycles with a decrease of 0.6°C per cycle; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 26 cycles, and storage at 12°C.

[0088] After PCR amplification, the fluorescence signal was processed using a Douglas-Araya high-throughput pipeline fluorescence signal scanner, and the genotyping results were exported using Douglas-specific Kraken software.

[0089] The analysis results are as follows Figure 4 As shown. The results show that: the blue scattered points close to the X-axis represent pea materials carrying the AA genotype; the red scattered points close to the Y-axis represent pea materials carrying the GG genotype; the green scattered points in the middle represent pea materials carrying the GA genotype; and the black scattered points represent blank controls in which the DNA template is replaced by a ddH2O sample. Among them, individual plants of the GG genotype (red scattered points) and the GA genotype (green scattered points) both contain the wilt-resistant gene FwC9 (the nucleotide sequence of the FwC9 disease-resistant gene is shown in Sequence 1) and are resistant to wilt; individual plants of the AA genotype (blue scattered points) do not contain the wilt-resistant gene FwC9 and are susceptible to wilt. This indicates that the KASP molecular marker KASPar-FwC9 of the present invention can be used for molecular-assisted selection breeding of peas for resistance to wilt.

[0090] The GG genotype mentioned above is a homozygote in which the 277th deoxyribonucleotide of sequence 1 is all G;

[0091] The GA genotype mentioned above is a hybrid in which the 277th deoxyribonucleotide of sequence 1 is G and A;

[0092] The above-mentioned AA genotype is a homozygous body in which the 277th deoxyribonucleotide of sequence 1 is all A.

[0093] Example 2: Application of KASP molecular marker KASPar-FwC9 associated with pea wilt resistance

[0094] Test materials: 45 pea germplasm resources. The detailed information of the 45 pea germplasm resources is shown in Table 1. Among them, Chengwan 9-1 to Chengwan 9-15 were all bred from a single plant of Chengwan 9. Chengwan 9 and the remaining pea germplasm resources are recorded in the document “Deng D, Sun S, Wu W, Zong X, Yang X, Zhang X, He Y, Duan C, Zhu Z. Screening for pea germplasms resistant to Fusarium wilt race 5. Agronomy, 2022, 12(6): 1354.”

[0095] Experimental method: All 45 pea germplasm resources were genotyped using the KASP molecular marker KASPar-FwC9 according to the method in Example 1, and the wilt resistance of all 45 pea germplasm resources was identified according to the wilt resistance evaluation criteria in the document "Deng D, Sun S, Wu W, Zong X, Yang X, Zhang X, HeY, Duan C, Zhu Z. Screening for pea germplasms resistant to Fusarium wilt race5. Agronomy, 2022, 12(6): 1354."

[0096] Experimental results: KASP molecular markers showed three distinct groups of scattered dots in all tested disease-resistant and susceptible pea germplasm resources: blue dots near the X-axis represent pea germplasm resources with the AA genotype that do not contain the wilt-resistance gene FwC9; red dots near the Y-axis represent pea germplasm resources with the GG genotype that contain the wilt-resistance gene FwC9; and green dots in the middle represent pea germplasm resources with the GA genotype that contain the wilt-resistance gene FwC9. Pea germplasm resources identified as having the GG genotype (red dots) and the GA genotype (green dots) both contain the wilt-resistance gene FwC9 and exhibit wilt-resistance phenotypes. Pea germplasm resources identified as having the AA genotype (blue dots) do not contain the wilt-resistance gene FwC9 and exhibit either wilt-susceptibility or resistant phenotypes. Among these, wilt-resistant resources contain genes other than FwC9 that resist wilt. The above results show that the KASP molecular marker KASPar-FwC9 of the present invention can accurately identify pea resources with GG genotype and GA genotype that are resistant to wilt and other pea germplasm resources that are resistant to wilt and susceptible to wilt, and can be used for the molecular identification of pea germplasm resources that are resistant to wilt and the discovery of new genes that resist wilt.

[0097] Table 1. Resistance phenotypes of 45 pea germplasm resources to Fusarium wilt and their genotypes identified using the KASP molecular marker KASPar-FwC9

[0098]

[0099]

[0100] Note: R means resistant; S means susceptible.

[0101] In practical applications, identification or auxiliary identification of pea wilt resistance can be performed according to the following method: detecting whether the pea genotype is a GG genotype, a GA genotype, or an AA genotype, and determining whether the pea to be tested contains the wilt resistance gene FwC9 based on the pea genotype to be tested; if the pea to be tested is a GG genotype or a GA genotype, it indicates that the pea to be tested contains the wilt resistance gene FwC9, and it exhibits or can exhibit resistance to wilt; if the pea to be tested is an AA genotype, it indicates that the pea to be tested does not contain the wilt resistance gene FwC9, and it exhibits or can exhibit resistance to wilt or susceptibility to wilt; the GG genotype is a homozygote in which the deoxyribonucleotide at position 277 of sequence 1 is all G; the GA genotype is a heterozygote in which the deoxyribonucleotide at position 277 of sequence 1 is all G and A; and the AA genotype is a homozygote in which the deoxyribonucleotide at position 277 of sequence 1 is all A.

[0102] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A method for identifying or assisting in the identification of pea fusarium wilt resistance, comprising the following steps: detecting whether the genotype of the pea to be tested is GG genotype, GA genotype or AA genotype, and determining whether the pea to be tested contains the fusarium wilt resistance gene FwC9 according to the genotype of the pea to be tested: if the pea to be tested is of GG genotype or GA genotype, it indicates that the pea to be tested contains the fusarium wilt resistance gene FwC9, and it shows or is candidate to show fusarium wilt resistance; if the pea to be tested is of AA genotype, it indicates that the pea to be tested does not contain the fusarium wilt resistance gene FwC9, and it shows or is candidate to show fusarium wilt resistance or fusarium wilt susceptibility. The GG genotype is a homozygote in which the 277th deoxyribonucleotide corresponding to Sequence 1 in the pea genome is G. The GA genotype is a heterozygote in which the 277th deoxyribonucleotide corresponding to Sequence 1 in the pea genome is G and A. The AA genotype is a homozygote in which the 277th deoxyribonucleotide corresponding to Sequence 1 in the pea genome is A.

2. The method according to claim 1, characterized in that: The method for detecting whether the genotype of the pea to be tested is GG genotype, GA genotype or AA genotype comprises the following steps: using the genomic DNA of the pea to be tested as a template, performing PCR amplification with a primer set, performing fluorescence signal scanning on the obtained amplification product, and judging whether the genotype of the pea to be tested is GG genotype, GA genotype or AA genotype according to the fluorescence signal.

3. The method according to claim 2, characterized in that: The primer set consists of upstream primer F1, upstream primer F2 and downstream primer R; The upstream primer F1 is the single-stranded DNA shown in Sequence 2; The upstream primer F2 is the single-stranded DNA shown in Sequence 3; The downstream primer R is the single-stranded DNA shown in Sequence 4.

4. Application of a substance for detecting the genotype of the SNP locus of the pea to be tested in any one of the following (a1)-(a12): (a1) Identifying or assisting in the identification of whether the pea to be tested contains the fusarium wilt resistance gene FwC9; (a2) Preparing a product for identifying or assisting in the identification of whether the pea to be tested contains the fusarium wilt resistance gene FwC9; (a3) Identifying or assisting in the identification of the fusarium wilt resistance of the pea to be tested; (a4) Preparing a product for identifying or assisting in the identification of the fusarium wilt resistance of the pea to be tested; (a5) Screening or assisting in screening pea germplasm resources, varieties, lines or individual plants containing the fusarium wilt resistance gene FwC9; (a6) Preparing a product for screening or assisting in screening pea germplasm resources, varieties, lines or individual plants containing the fusarium wilt resistance gene FwC9; (a7) Screening or assisting in screening fusarium wilt-resistant pea germplasm resources, varieties, lines or individual plants; (a8) Preparing a product for screening or assisting in screening fusarium wilt-resistant pea germplasm resources, varieties, lines or individual plants; (a9) Improving pea germplasm resources, varieties, lines or individual plants; (a10) Preparing a product for improving pea germplasm resources, varieties, lines or individual plants; (a11) Pea breeding; (a12) Preparing a product for pea breeding; The SNP locus is the 277th deoxyribonucleotide corresponding to the DNA molecule of Sequence 1 in the pea genome.

5. Any one of the products in (b1)-(b3) below: (b1) The primer set according to claim 2 or 3; (b2) A PCR reagent containing the primer set described in (b1); (b3) A kit containing the primer set described in (b1) or the PCR reagent described in (b2).

6. The application of the product according to claim 5 in any one of (c1)-(c6) below: (c1) Identifying or assisting in identifying whether the pea to be tested contains the fusarium wilt resistance gene FwC9; (c2) Identifying or assisting in identifying the fusarium wilt resistance of the pea to be tested; (c3) Screening or assisting in screening pea germplasm resources, varieties, lines or individual plants containing the fusarium wilt resistance gene FwC9; (c4) Screening or assisting in screening fusarium wilt-resistant pea germplasm resources, varieties, lines or individual plants; (c5) Improving pea germplasm resources, varieties, lines or individual plants; (c6) Pea breeding.

7. A method for screening or assisting in screening fusarium wilt-resistant pea germplasm resources, varieties, lines or individual plants, comprising the step of selecting pea germplasm resources, varieties, lines or individual plants with the GG genotype or the GA genotype; the GG genotype is a homozygote in which the 277th deoxyribonucleotide corresponding to Sequence 1 in the pea genome is G; the GA genotype is a heterozygote in which the 277th deoxyribonucleotide corresponding to Sequence 1 in the pea genome is G and A.

8. A method for improving pea germplasm resources, varieties, lines or individual plants, comprising the step of using the fusarium wilt-resistant pea germplasm resources, varieties, lines or individual plants screened by the method according to claim 7 as breeding materials for breeding.

9. According to the application described in claim 4 or 6 or the method described in claim 7 or 8, characterized in that: The fusarium wilt-resistant pea germplasm resources, varieties, lines or individual plants are fusarium wilt-resistant pea germplasm resources, varieties, lines or individual plants containing the fusarium wilt resistance gene FwC9.

10. The application of the method described in any one of claims 7-9 in pea breeding.

Images