KASP marker related to large vascular bundle number of rice spike neck and application of KASP marker
By developing a KASP molecular marker method related to the number of large vascular bundles in rice ears, the polymorphic locus of the new gene LVN6 was used to solve the problem of ignoring the vascular bundle traits in rice breeding, and the effect of improving the "flow" traits in rice is achieved and the effect of improving the "flow" traits in rice and improving yield is achieved.
Patent Information
- Application Number
- CN202411652134.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art neglects the breeding of vascular bundle traits in rice breeding, resulting in poor grain enrichment and high emptying rate of ultra-high yield rice, which limits the development of yield potential.
A KASP molecular marker method related to the large vascular bundle number of rice ear neck was developed. Using the polymorphic locus SNP88881 of the new gene LVN6, the selection and breeding was assisted by KASP technology to improve the "flow" traits of rice.
This method can effectively screen and identify individuals carrying LVN6 genes, improve the number of large vascular bundles in the ear neck of rice, and thus improve the yield and grain enrichment of rice.
Smart Images

Figure CN120060524A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a KASP molecular marker related to the number of large vascular bundles in rice panicle neck and application thereof, and belongs to the field of rice breeding and molecular genetics. Background Art
[0002] Rice (Oryza sativa L.) is one of the most important food crops and the main staple food for more than half of the world's population. my country is the world's largest rice producer and consumer. Improving the high and stable yield of rice has always been of great strategic significance for ensuring my country's food security and social stability. Nowadays, rice yield has reached a bottleneck, and it will be more difficult to significantly increase yields like the previous two green revolutions. How to further increase rice yields is an urgent problem to be solved in rice high-yield breeding.
[0003] The level of rice yield is mainly determined by the strength of the source, sink, and flow and the degree of coordination between them. Rice leaves, especially the flag leaf, are the main source traits for synthesizing photosynthetic products, while grains are the sink traits for accumulating photosynthetic products, and vascular bundles, especially the panicle neck vascular bundles, are the flow traits for transporting the photosynthetic products of the leaves and the water absorbed by the roots to the panicle. For a long time, breeders have paid more attention to the improvement of source and sink traits, while ignoring the selection of flow traits. Many super-high-yield rice currently cultivated have large sinks and sources, which increases the burden of mediating the flow between the source and sink. Poor flow leads to poor grain filling and high empty and barren rate, limiting the development of yield potential. Therefore, it is particularly important to carry out research on the panicle neck vascular bundle traits to balance the coordinated relationship between the source, sink, and flow, thereby further improving rice yield. Cloning the genes related to the panicle neck vascular bundle of rice and applying them to breeding to cultivate high-yield rice varieties with smooth "flow" is of great significance to ensure my country's food security.
[0004] In recent years, some quantitative trait loci (QTLs) related to vascular bundles have been located using introgression line populations, recombinant inbred line populations, DH populations, and natural populations of germplasm resources. At the same time, some genes regulating vascular bundle-related traits of the panicle neck have been cloned, such as OsNAC2, OsMED14_1, DVB1, OsOPL1, and OsCOMT. The cloning of these vascular bundle genes helps to deepen the understanding of vascular bundle-related traits, and is conducive to improving these traits through genetic regulation and ultimately achieving the goal of increasing yield.
[0005] However, most of the studies on the functions of these genes are at the basic research stage, and the lack of molecular markers that can be used for assisted selection breeding limits the application of vascular bundle-related genes in breeding. Discovering more panicle neck vascular bundle genes and developing molecular markers to apply them to marker-assisted selection breeding are important tasks in breeding high-yield varieties with smooth flow. Summary of the invention
[0006] The technical problem to be solved by the present invention is to provide a KASP molecular marker method related to the number of large vascular bundles in the panicle neck and its application. The molecular marker SNP88881 obtained by the present invention is a gene marker of the new gene LVN6 for the number of large vascular bundles in the panicle neck of rice, and can be used for the assisted selection breeding of the trait of the number of large vascular bundles in the panicle neck of rice.
[0007] The technical solution of the present invention is as follows:
[0008] The new gene LVN6 for the number of large vascular bundles in the panicle neck of rice is located at the physical position of 28586445 - 28590358 on chromosome 6 of rice. This gene can improve the "flow" trait by regulating the number of large vascular bundles in the panicle neck.
[0009] There are polymorphisms among different haplotypes of the gene LVN6 for the number of large vascular bundles in the panicle neck of rice at the physical position of rs6_28588881. Based on this polymorphic SNP locus (A / C), the KASP molecular marker SNP88881 is developed.
[0010] When this locus is AA, it is an excellent genotype for the number of large vascular bundles in the panicle neck. The nucleotide sequence is as shown in SEQ ID NO.1, specifically:
[0011] GAACAACAAGAAATCAGATGGCAAGAAGGCGCCAGCCCAGATGATGCTTTTCGGAAAACCCATACTCACAGAGCAGCAGATATC;
[0012] When this locus is CC, it is a disadvantaged genotype for the number of large vascular bundles in the panicle neck. The nucleotide sequence is as shown in SEQ ID NO.2, specifically:
[0013] GAACAACAAGAAATCAGATGCCAAGAAGGCGCCAGCCCAGCTGATGCTTTTCGGAAAACCCATACTCACAGAGCAGCAGATATC;
[0014] The primer sequences of the marker SNP88881 are as shown in SEQ ID No.3, SEQ ID No.4 and SEQ ID No5, specifically:
[0015] SNP88881A: GAAGGTGACCAAGTTCATGCTAGTATGGGTTTTCCGAAAAGCATCAT;
[0016] SNP88881B: GAAGGTCGGAGTCAACGGATTGTATGGGTTTTCCGAAAAGCATCAG;
[0017] SNP88881C: AGCCCCCAGAACAACAAGAAATCAG.
[0018] A method for detecting whether rice contains the gene LVN6 for the number of large vascular bundles in the rice panicle neck. The functional locus of this gene is located at the physical position of rs6_28588881, and the KASP molecular marker SNP88881 is developed based on this polymorphic SNP locus (A / C).
[0019] When the locus is AA, this breeding material carries the gene LVN6 for the number of large vascular bundles in the rice panicle neck, and the nucleotide sequence is as shown in SEQ ID NO.1, specifically:
[0020] GAACAACAAGAAATCAGATGGCAAGAAGGCGCCAGCCCAGATGATGCTTTTCGGAAAACCCATACTCACAGAGCAGCAGATATC;
[0021] When the locus is CC, this breeding material does not carry the gene LVN6 for the number of large vascular bundles in the rice panicle neck, and the nucleotide sequence is as shown in SEQ ID NO.2, specifically:
[0022] GAACAACAAGAAATCAGATGCCAAGAAGGCGCCAGCCCAGCTGATGCTTTTCGGAAAACCCATACTCACAGAGCAGCAGATATC;
[0023] The primer sequences of the marker SNP88881 are as shown in SEQ ID No.3, SEQ ID No.4 and SEQ ID No5, specifically:
[0024] SNP88881A: GAAGGTGACCAAGTTCATGCTAGTATGGGTTTTCCGAAAAGCATCAT;
[0025] SNP88881B: GAAGGTCGGAGTCAACGGATTGTATGGGTTTTCCGAAAAGCATCAG;
[0026] SNP88881C: AGCCCCCAGAACAACAAGAAATCAG.
[0027] The application of the KASP molecular marker SNP88881 for the trait of the number of large vascular bundles in the rice panicle neck of the present invention or the method for detecting whether rice contains the gene LVN6 for the number of large vascular bundles in the rice panicle neck in rice assisted selection breeding.
[0028] In this invention, 423 materials from 3K germplasm resources were used as test materials. Through genome-wide association analysis, a major QTL (qLVN6) controlling the number of large vascular bundles in the panicle neck node of rice was detected within the physical range of Chr6: 28.55 - 28.92 Mb (370 Kb) on chromosome 6. Through candidate gene-based association analysis, haplotype analysis, and functional annotation, LOC_Os06g47150 was predicted to be the most likely candidate gene for this QTL, which was named Number of Large Vascular bundles 6 (LVN6). Its function in the number of large vascular bundles in the panicle neck was verified by constructing overexpression and CRISPR / Cas9 transgenic lines. Through sequence difference analysis among different haplotypes, the SNP locus rs6_28588881 linked to this gene was identified, and based on this locus, the KASP molecular marker SNP88881 was developed, providing an effective molecular marker for further molecular marker-assisted selection breeding. The KASP molecular marker SNP88881 for the trait of the number of large vascular bundles in the panicle neck of rice is expected to be applied to rice molecular marker-assisted selection breeding.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] 1. The gene LVN6 is a new gene affecting the number of large vascular bundles in the panicle neck detected through association analysis of the phenotype of the number of large vascular bundles in the panicle neck and SNP genotypes using more than 400 rice germplasm resources with extensive genetic variations from different countries around the world. This gene can regulate the number of large vascular bundles in the panicle neck to improve the "flow" trait of rice.
[0031] 2. The determination of the linked locus of the new gene LVN6 for the number of large vascular bundles in the panicle neck and the development of the KASP marker provide effective information for rice molecular marker-assisted selection, enabling the acquisition of rice materials with a "smooth" flow and a larger number of large vascular bundles in the panicle neck. The molecular marker of the present invention can be used to screen for favorable genotypes of the number of large vascular bundles in the panicle neck in the rice breeding population, effectively identify individuals carrying this gene, and accelerate the breeding process. Description of the Drawings
[0032] Figure 1 Phenotypic distribution of the number of large vascular bundles in the panicle neck;
[0033] Figure 2 Genome-wide association analysis for mapping the QTL of the number of large vascular bundles in the panicle neck;
[0034] Figure 3 Screening of candidate genes in the qLVN6 interval;
[0035] Figure 4 Effect of the knockout transgenic line on the number of large vascular bundles in the panicle neck;
[0036] Figure 5Effect of overexpressing transgenic lines on the number of large vascular bundles in the panicle neck;
[0037] Figure 6 F 2 Genotyping results of the segregating population;
[0038] Figure 7 Application of SNP88881 in rice marker-assisted selection breeding. Detailed implementation manners
[0039] The present invention will be further described below in conjunction with specific embodiments, and the methods used are conventional methods unless otherwise specified.
[0040] I. Mining and verification of new genes for the number of large vascular bundles in the rice panicle neck
[0041] 1. Test materials
[0042] The materials used in this experiment were 423 germplasm resources from different countries with relatively close heading dates, screened from the 3K resequenced germplasm resources considering the genetic diversity of the germplasm resources, including 301 indica rice, 79 japonica rice, 17 intermediate types, 10 Basmati, and 16 Aus.
[0043] 2. Phenotypic identification of the number of large vascular bundles in the panicle neck of experimental materials
[0044] Phenotypic identification of the number of large vascular bundles in the panicle neck was carried out on 423 rice materials in this experiment. The specific operation method: 423 rice materials were normally planted in the paddy field, and phenotypic investigation was carried out at the full-heading stage. For each material, the main stems of 5 plants with consistent growth in the middle were taken, and after hand-sectioning at 2 cm above the node of the panicle neck, they were stored in the pre-prepared FAA fixative (acetic acid (5%) + formaldehyde (5%) + 70% ethanol (90%)), and vacuum was pumped to ensure that the fixative quickly entered the tissue interior to maximize the preservation of the tissue original state. Observation was carried out using a ZEISS microscope produced in Germany, and the number of large vascular bundles in the panicle neck was measured. Statistical analysis of the measured phenotypes was carried out using Excel 2019 and R language statistical analysis software. The phenotypic data distribution is as Figure 1 shown.
[0045] 3. Mining candidate genes by genome-wide association analysis
[0046] 27K high-quality SNP genotype data of 423 test materials were retrieved from the Rice SNP-Seek Database (http: / / snp-seek.irri.org / ) constructed by the 3K rice resequencing project, and the selected genotypes were quality-controlled using Tassel 5 (MAF > 5%, GENO < 20%). Finally, 26,097 high-quality SNPs were retained for subsequent genome-wide association analysis.
[0047] Principal component analysis (PCA) and kinship matrix analysis (Kinship) were performed using Tassel 5. The mixed linear model (MLM) was adopted, with PCA and kinship matrix (Kinship) as covariates. Genome-wide association analysis (GWAS) was carried out on the phenotypic values of the number of large vascular bundles at the panicle neck node of 26,097 high-quality SNP markers and 423 rice germplasm resources. A QTL significantly associated with the number of large vascular bundles at the panicle neck was detected on chromosome 6( Figure 2 A), and this QTL was delimited within a 370-kb interval through LD BLOCK analysis( Figure 2 B). No genes related to the number of large vascular bundles at the panicle neck node have been cloned in this interval. We named this major QTL for the number of large vascular bundles at the panicle neck node as qLVN6.
[0048] 4. Screening for candidate genes in the QTL qLVN6 interval
[0049] We retrieved the high-density SNPs on the CDS regions of all candidate genes in this interval and screened for the major candidate gene LOC_Os06g47150 that affects the number of large vascular bundles at the panicle neck based on the candidate genes. We named this gene Number of Large Vascular bundles 6 (LVN6)( Figure 3 A). There are 7 haplotypes for this gene. Haplotype Hap1 mainly exists in indica rice, haplotypes Hap2 and Hap3 mainly exist in japonica rice, while the number of individuals with other haplotypes is small( Figure 3 B). There are significant differences among different haplotypes in the total population( Figure 3 C). In japonica rice, the average phenotypic value of Hap2 is significantly higher than that of Hap3( Figure 3 D). The results indicate that LVN6 is very likely the major gene regulating the number of large vascular bundles in the japonica rice subgroup.
[0050] 5. Transgenic verification of gene function
[0051] To further verify the function of this gene, japonica rice G209 carrying the dominant haplotype Hap2 was selected as the receptor material to construct 2 homozygous knockout transgenic lines( Figure 4 A; Figure 4 B). The results of phenotypic identification showed that the number of large vascular bundles in the knockout lines was significantly reduced compared with the wild type( Figure 4 C; Figure 4 D).
[0052] Meanwhile, we constructed two homozygous overexpression transgenic lines using japonica rice C616 carrying the inferior haplotype Hap3 as the receptor material( Figure 5A), Compared with the wild type, the expression levels of the LVN6 gene in the two overexpression lines were extremely significantly increased ( Figure 5 B), and the number of large vascular bundles in the panicle neck was also significantly increased ( Figure 5 C; Figure 5 D). The results of gene function verification showed that this gene regulated the number of large vascular bundles in the panicle neck node.
[0053] 6. Mining of gene functional sites and development of molecular markers
[0054] In japonica rice, the average phenotypic value of haplotype Hap2 of the LVN6 gene was significantly higher than that of Hap3 ( Figure 3 D). Through sequence alignment, a non-synonymous mutation SNP (A / C) was found at the physical position of rs6_28588881 in the coding region between the two haplotypes, indicating that this site was likely to be a functional site affecting the number of large vascular bundles in the panicle neck node or a marker site linked to the functional gene. Based on this site, the KASP molecular marker SNP88881 was developed, and its primer sequences were respectively:
[0055] SNP88881A: GAAGGTGACCAAGTTCATGCTAGTATGGGTTTTCCGAAAAGCATCAT;
[0056] SNP88881B: GAAGGTCGGAGTCAACGGATTGTATGGGTTTTCCGAAAAGCATCAG;
[0057] SNP88881C: AGCCCCCAGAACAACAAGAAATCAG.
[0058] It could further provide effective molecular markers for marker-assisted selection breeding. The functional molecular marker SNP88881 of the rice panicle neck large vascular bundle gene LVN6 was expected to be applied to rice marker-assisted selection breeding.
[0059] II. F 2 Marker verification analysis of the panicle neck large vascular bundle gene LVN6 in the segregating population
[0060] 1. Field planting of the test materials
[0061] Using the variety C616 with fewer large vascular bundles in the panicle neck carrying the inferior haplotype of the LVN6 gene and the variety G209 with more large vascular bundles in the panicle neck carrying the superior haplotype of the LVN6 gene to construct an F 2 segregating population. A total of 183 plants in this population were normally planted in paddy fields, and the number of large vascular bundles in the panicle neck was investigated after full heading.
[0062] 2. DNA extraction and genotyping
[0063] The genomic DNA of each individual plant was extracted separately using the CTAB method. The individuals in the population were genotyped using the KASP molecular marker SNP88881. Based on the marker information, they could be divided into three types, namely AA, CC, and AC( Figure 6 ).
[0064] 3. Analysis of the effect of marker-assisted selection and t-test analysis
[0065] According to the genotyping results of the SNP88881 molecular marker of the offspring individuals, the correspondence between the phenotype and genotype of the number of large vascular bundles at the panicle neck in the F 2 population is shown in Table 1. Individuals with the homozygous genotype of the dominant parent G209 (P 1 ) had more large vascular bundles at the panicle neck. Individuals with the homozygous genotype of the inferior parent C616 (P 2 ) generally had fewer large vascular bundles at the panicle neck per individual plant, while individuals with the heterozygous genotype had an intermediate number of large vascular bundles at the panicle neck, indicating that SNP88881 had an ideal effect on assisting the selection of the gene LVN6 for the number of large vascular bundles at the panicle neck. The individuals in the F 2 population were divided into two groups. One group was individuals with the homozygous genotype AA at the SNP88881 locus (referred to as the dominant group), with a total of 62 plants; the other group was individuals with the homozygous genotype CC at the SNP88881 locus (referred to as the inferior group), with a total of 32 plants. The average number of large vascular bundles at the panicle neck obtained by examining the two groups of individuals was subjected to variance analysis (Table 2). The results showed that there was a highly significant difference in the number of large vascular bundles at the panicle neck between the two groups of individuals, indicating that the SNP88881 marker was an effective functional molecular marker for identifying the major gene LVN6 for the number of large vascular bundles at the panicle neck.
[0066] Table 1 Correspondence between the genotype and phenotype of the F 2 population at the SNP88881 marker locus
[0067]
[0068]
[0069] Table 2 Performance of the number of large vascular bundles at the panicle neck of two groups of individuals with the homozygous genotypes AA and CC at the SNP88881 marker locus in the F 2 population
[0070]
[0071] III. Application of the KASP molecular marker SNP88881 in marker-assisted selection
[0072] We applied the developed KASP molecular markers in marker-assisted selection. Japonica rice variety G209 (AA) carrying the advantageous allele was crossed with japonica rice variety Zhongnongjing 11 (ZNG11) (CC) carrying the disadvantageous allele, and then backcrossed with Zhongnongjing 11 multiple times and self-crossed (BC 3 F 3 ), and at the same time, marker-assisted selection and identification were carried out using this KASP molecular marker in each generation, and the excellent allele was introgressed into Zhongnongjing 11 (ZNG11) ( Figure 7 A), and finally the number of large vascular bundles at the panicle neck of Zhongnongjing 11 (ZNG11) was significantly increased ( Figure 7 B; Figure 7 C). The results showed that the KASP molecular marker SNP88881 could be applied to the improvement of the number of large vascular bundles at the panicle neck of rice.
Claims
1. A KASP molecular marker SNP88881 associated with the number of large vascular bundles at the neck of rice panicle, characterized in that: The molecular marker SNP88881 is located at the 28588881bp physical position (rs6_28588881) of rice chromosome 6, which has an A / C polymorphism, wherein: When the polymorphic site is AA, the number of large vascular bundles in the rice panicle neck is greater; When the polymorphic site is CC, the number of large vascular bundles in the rice panicle neck is smaller.
2. The KASP molecular marker SNP88881 according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is: GAACAACAAGAAATCAGATG(G / C)CAAGAAGGCCGCCAGCCCAG[A / C]TGATGCTTTTTC GGAAAACCCATACTCACAGAGCAGCAGATATC, Among them, the base A / C at the rs6_28588881 position is the polymorphic site of the molecular marker.
3. A method for detecting whether rice contains the gene LVN6 for large vascular bundle number at the panicle neck, characterized in that: The following steps are involved: The molecular marker SNP88881 was used to detect the base located at the physical position of 28588881bp on chromosome 6 of rice in the genomic DNA of rice breeding materials; If the base at this position is AA, it is determined that the breeding material contains the panicle neck large vascular bundle number gene LVN6, and the specific nucleotide sequence is SEQ ID NO.1; If the base at this position is CC, it is determined that the breeding material does not contain the panicle neck large vascular bundle number gene LVN6, and the specific nucleotide sequence is SEQ ID NO.
2.
4. Use of the KASP molecular marker SNP88881 or the method for detecting whether rice contains the panicle neck large vascular bundle number gene LVN6 according to claim 1 or 3 in rice molecular marker-assisted selection breeding.
5. A primer combination for detecting the rice panicle neck large vascular bundle number gene LVN6, characterized in that: include: Primer SNP88881A, the nucleotide sequence of which is SEQ ID NO.3; Primer SNP88881B, the nucleotide sequence of which is SEQ ID NO.4; Primer SNP88881C, its nucleotide sequence is SEQ ID NO.
5. SEQ ID NO.1: GAACAACAAGAAATCAGATGGCAAGAAGGCGCCAGCCCAGATGATGCTTTTCGGAAAACCCATACTCACAGAGCAGCAGATATC SEQ ID NO.2: GAACAACAAGAAATCAGATGCCAAGAAGGCGCCAGCCCAGCTGATGCTTTTCGGAAAACCCATACTCACAGAGCAGCAGATATC SEQ ID NO.3: GAAGGTGACCAAGTTCATGCTAGTATGGGTTTTCCGAAAAGCATCAT SEQ ID NO.4: GAAGGTCGGAGTCAACGGATTGTATGGGTTTTCCGAAAAGCATCAG SEQ ID NO.5: AGCCCCCAGAACAACAAGAAATCAG 6. Use of the KASP molecular marker SNP88881 for the rice panicle neck large vascular bundle number trait as described in claim 1 or the method for detecting whether rice contains the rice panicle neck large vascular bundle number gene LVN6 as described in claim 2 in rice molecular marker-assisted selection breeding.
Citation Information
Patent Citations
SNP molecular marker for rice genotyping and application thereof
CN108998550A
Functional molecular marking method of rice spike neck small vascular bundle number gene LOCOs07g49460 and application of functional molecular marking method
CN118109630A